pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-664a |
Genomic Coordinates | chr1: 220200538 - 220200619 |
Description | Homo sapiens miR-664 stem-loop |
Comment | This miRNA sequence overlaps an annotated snoRNA, ACA38b. However, both miR and miR* sequences are identified in reference , and the sequence is homologous with rat mir-664. |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-664a-3p | |||||||||||||||||||||||||||||||||||||||||||||
Sequence | 49| UAUUCAUUUAUCCCCAGCCUACA |71 | |||||||||||||||||||||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||||||||||||||||||||
Experiments | Illumina | DRVs in miRNA |
|
|||||||||||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | SNRPB2 | ||||||||||||||||||||
Synonyms | Msl1, U2B'' | ||||||||||||||||||||
Description | small nuclear ribonucleoprotein polypeptide B2 | ||||||||||||||||||||
Transcript | NM_003092 | ||||||||||||||||||||
Other Transcripts | NM_198220 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on SNRPB2 | |||||||||||||||||||||
3'UTR of SNRPB2 (miRNA target sites are highlighted) |
>SNRPB2|NM_003092|3'UTR 1 CATTTGGGATAGTCGTCTTTAAAAGACTTGGTGTTATTTACAGTGTTTGTTTTGATAACATTTGGCTGGGTCATTTTAAT 81 AGTTAGAGATGAGGAGGAGTAAAAGTGAAATTTTTGTGAAGGACTTAAATTATCCAGTGTTTCTTTAGCCTTGGTGAACT 161 ATGAAATACGAAGGCCTTAATTTTGTACAATAAACTTTTATTTGTATTCTGTGTATATAATGCTTTCTTGATTGACCCAT 241 CTCCCTATCATCAAATGACTTCTAGTCTAGAACACACTTAAGGTTTATAAACTTGTGTAATAGGATGCTTTTCTAGTGTT 321 ACTTTGGAGGAGCTAATTATACAACATCATTGAACCATTCAATAAAAGTTAAGTAAAATTAGATCACAGAAGCTAGTAGA 401 TGACTGTTGTATTAATGGTAACAATGATTGTTCTGGGTATTAGAAGAAAATGAGACCCAGGCAGGATCTAAATTTGATCT 481 TTGTATCCTTTTAAGAAATGAATATATTATTTTGCTGCTAGTAGGGATTCCACAAGTTTTCTTCATTCAGTATTAAATAA 561 AGGCTGTTCTTACTGTTTACTGAGAAAACAGAAAGGGAATGCTATCTTCACACTTTGCATTTAATGCTGTTTCCTTCATG 641 AGGCAGGACTGTTCTAAGGTTAATATGCAATCTCTTTATTGAAAGACCTCCAGGGTAAAAATTTTTTGATCTATAGTCTC 721 TTTTCCCCCTTAAGACAAATAGACTGATTAATAAAGAGTTGCCAGTGAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 6629.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 6629.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
Experimental Support 4 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | MCF7 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
CLIP-seq Support 1 for dataset GSM545212 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000377943.5 | 3UTR | AAUAUAUUAUUUUGCUGCUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM545214 | |
---|---|
Method / RBP | PAR-CLIP / AGO3 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000377943.5 | 3UTR | AAUAUAUUAUUUUGCUGCUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM545216 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-124 transfection |
Location of target site | ENST00000377943.5 | 3UTR | AAUAUAUUAUUUUGCUGCUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM545217 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-7 transfection |
Location of target site | ENST00000377943.5 | 3UTR | AAUAUAUUAUUUUGCUGCUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 5 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000377943.5 | 3UTR | AAAUGAAUAUAUUAUUUUGCUGCUAGUAGGGAU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 6 for dataset GSM714645 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repB |
Location of target site | ENST00000377943.5 | 3UTR | AAUAUAUUAUUUUGCUGCUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 7 for dataset GSM1065667 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
Location of target site | ENST00000377943.5 | 3UTR | AAUAUAUUAUUUUGCUGCUAGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
CLIP-seq Support 8 for dataset GSM1065668 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_7 |
Location of target site | ENST00000377943.5 | 3UTR | AAUAUAUUAUUUUGCUGCUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
CLIP-seq Support 9 for dataset GSM1065669 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_8 |
Location of target site | ENST00000377943.5 | 3UTR | AAUAUAUUAUUUUGCUGCUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
CLIP-seq Support 10 for dataset GSM1065670 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / 4-thiouridine, 3_ML_LG |
Location of target site | ENST00000377943.5 | 3UTR | AAUAUAUUAUUUUGCUGCUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
CLIP-seq Support 11 for dataset SRR1045082 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | MCF7 / Untreated |
Location of target site | ENST00000377943.5 | 3UTR | AAUAUAUUAUUUUGCUGCUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 24398324 / SRX388831 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
88 hsa-miR-664a-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT035824 | HIAT1 | major facilitator superfamily domain containing 14A | 1 | 1 | ||||||||
MIRT035826 | FUS | FUS RNA binding protein | 1 | 1 | ||||||||
MIRT069432 | SIVA1 | SIVA1 apoptosis inducing factor | 2 | 2 | ||||||||
MIRT071494 | CALM1 | calmodulin 1 | 2 | 2 | ||||||||
MIRT100410 | HSPA1B | heat shock protein family A (Hsp70) member 1B | 2 | 2 | ||||||||
MIRT143469 | CHD9 | chromodomain helicase DNA binding protein 9 | 2 | 2 | ||||||||
MIRT191113 | ARF6 | ADP ribosylation factor 6 | 2 | 2 | ||||||||
MIRT235584 | SNRPB2 | small nuclear ribonucleoprotein polypeptide B2 | 2 | 8 | ||||||||
MIRT339131 | ARID1A | AT-rich interaction domain 1A | 2 | 2 | ||||||||
MIRT437450 | MAT1A | methionine adenosyltransferase 1A | 1 | 1 | ||||||||
MIRT442234 | BTD | biotinidase | 2 | 2 | ||||||||
MIRT443321 | SLC35G1 | solute carrier family 35 member G1 | 2 | 2 | ||||||||
MIRT443769 | HLF | HLF, PAR bZIP transcription factor | 2 | 2 | ||||||||
MIRT444352 | KIAA1211 | KIAA1211 | 2 | 2 | ||||||||
MIRT456348 | OLIG3 | oligodendrocyte transcription factor 3 | 2 | 8 | ||||||||
MIRT458866 | CD55 | CD55 molecule (Cromer blood group) | 2 | 2 | ||||||||
MIRT466169 | TMED5 | transmembrane p24 trafficking protein 5 | 2 | 2 | ||||||||
MIRT470445 | PPP1R15B | protein phosphatase 1 regulatory subunit 15B | 2 | 6 | ||||||||
MIRT471524 | PCGF3 | polycomb group ring finger 3 | 2 | 6 | ||||||||
MIRT477744 | EDN1 | endothelin 1 | 2 | 2 | ||||||||
MIRT482885 | CACNA2D3 | calcium voltage-gated channel auxiliary subunit alpha2delta 3 | 2 | 2 | ||||||||
MIRT496336 | PTPRT | protein tyrosine phosphatase, receptor type T | 2 | 2 | ||||||||
MIRT497703 | ARL6IP6 | ADP ribosylation factor like GTPase 6 interacting protein 6 | 2 | 2 | ||||||||
MIRT499068 | CTBP1 | C-terminal binding protein 1 | 2 | 4 | ||||||||
MIRT500296 | ZNF667 | zinc finger protein 667 | 2 | 8 | ||||||||
MIRT500506 | ZBTB34 | zinc finger and BTB domain containing 34 | 2 | 8 | ||||||||
MIRT501964 | MAPK8 | mitogen-activated protein kinase 8 | 2 | 2 | ||||||||
MIRT505457 | SUB1 | SUB1 homolog, transcriptional regulator | 2 | 4 | ||||||||
MIRT505955 | RAN | RAN, member RAS oncogene family | 2 | 6 | ||||||||
MIRT507512 | DYNLL2 | dynein light chain LC8-type 2 | 2 | 4 | ||||||||
MIRT512953 | MKI67 | marker of proliferation Ki-67 | 2 | 2 | ||||||||
MIRT520450 | TSPAN2 | tetraspanin 2 | 2 | 6 | ||||||||
MIRT525997 | MAGEL2 | MAGE family member L2 | 2 | 2 | ||||||||
MIRT526424 | ZNF695 | zinc finger protein 695 | 2 | 2 | ||||||||
MIRT527364 | KRTAP13-2 | keratin associated protein 13-2 | 2 | 2 | ||||||||
MIRT529612 | H1F0 | H1 histone family member 0 | 2 | 2 | ||||||||
MIRT529811 | TMLHE | trimethyllysine hydroxylase, epsilon | 2 | 2 | ||||||||
MIRT530971 | EXO5 | exonuclease 5 | 2 | 4 | ||||||||
MIRT531294 | WNT7A | Wnt family member 7A | 2 | 2 | ||||||||
MIRT531870 | POF1B | premature ovarian failure, 1B | 2 | 2 | ||||||||
MIRT532116 | G6PC | glucose-6-phosphatase catalytic subunit | 2 | 2 | ||||||||
MIRT533534 | TPR | translocated promoter region, nuclear basket protein | 2 | 2 | ||||||||
MIRT545934 | ZBTB44 | zinc finger and BTB domain containing 44 | 2 | 4 | ||||||||
MIRT546649 | RPS6KA5 | ribosomal protein S6 kinase A5 | 2 | 2 | ||||||||
MIRT548063 | GNS | glucosamine (N-acetyl)-6-sulfatase | 2 | 2 | ||||||||
MIRT548288 | FAM3C | family with sequence similarity 3 member C | 2 | 4 | ||||||||
MIRT551018 | SPPL3 | signal peptide peptidase like 3 | 2 | 2 | ||||||||
MIRT551139 | ZNF678 | zinc finger protein 678 | 2 | 2 | ||||||||
MIRT552398 | ZNF487P | zinc finger protein 487 | 1 | 1 | ||||||||
MIRT555640 | PHIP | pleckstrin homology domain interacting protein | 2 | 4 | ||||||||
MIRT556267 | MAPK6 | mitogen-activated protein kinase 6 | 2 | 2 | ||||||||
MIRT558864 | CD2AP | CD2 associated protein | 2 | 2 | ||||||||
MIRT559239 | BEND4 | BEN domain containing 4 | 2 | 2 | ||||||||
MIRT559438 | ARSJ | arylsulfatase family member J | 2 | 2 | ||||||||
MIRT559793 | ZNF415 | zinc finger protein 415 | 2 | 2 | ||||||||
MIRT562572 | CBX6 | chromobox 6 | 2 | 2 | ||||||||
MIRT562741 | ZNF83 | zinc finger protein 83 | 2 | 2 | ||||||||
MIRT564737 | ZNF23 | zinc finger protein 23 | 2 | 2 | ||||||||
MIRT565174 | LINC00598 | long intergenic non-protein coding RNA 598 | 2 | 2 | ||||||||
MIRT566301 | PPM1A | protein phosphatase, Mg2+/Mn2+ dependent 1A | 2 | 2 | ||||||||
MIRT571656 | SERBP1 | SERPINE1 mRNA binding protein 1 | 2 | 2 | ||||||||
MIRT610720 | NAV2 | neuron navigator 2 | 2 | 2 | ||||||||
MIRT611486 | ADCYAP1R1 | ADCYAP receptor type I | 2 | 4 | ||||||||
MIRT617118 | KANK2 | KN motif and ankyrin repeat domains 2 | 2 | 2 | ||||||||
MIRT617836 | SIGLEC10 | sialic acid binding Ig like lectin 10 | 2 | 2 | ||||||||
MIRT636145 | VLDLR | very low density lipoprotein receptor | 2 | 2 | ||||||||
MIRT638060 | YAE1D1 | Yae1 domain containing 1 | 2 | 4 | ||||||||
MIRT640159 | CDK13 | cyclin dependent kinase 13 | 2 | 2 | ||||||||
MIRT644257 | WEE2 | WEE1 homolog 2 | 2 | 2 | ||||||||
MIRT646838 | TLDC1 | TBC/LysM-associated domain containing 1 | 2 | 2 | ||||||||
MIRT653074 | ST8SIA4 | ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 | 2 | 2 | ||||||||
MIRT657671 | GPR26 | G protein-coupled receptor 26 | 2 | 2 | ||||||||
MIRT660601 | AP3M2 | adaptor related protein complex 3 mu 2 subunit | 2 | 2 | ||||||||
MIRT668908 | CREB1 | cAMP responsive element binding protein 1 | 2 | 2 | ||||||||
MIRT672685 | GTF2H5 | general transcription factor IIH subunit 5 | 2 | 2 | ||||||||
MIRT680977 | DCAF17 | DDB1 and CUL4 associated factor 17 | 2 | 2 | ||||||||
MIRT682271 | RS1 | retinoschisin 1 | 2 | 2 | ||||||||
MIRT702058 | RNMT | RNA guanine-7 methyltransferase | 2 | 2 | ||||||||
MIRT707786 | UNK | unkempt family zinc finger | 2 | 2 | ||||||||
MIRT709238 | RANGAP1 | Ran GTPase activating protein 1 | 2 | 2 | ||||||||
MIRT710119 | MED23 | mediator complex subunit 23 | 2 | 2 | ||||||||
MIRT710675 | ADAP2 | ArfGAP with dual PH domains 2 | 2 | 2 | ||||||||
MIRT712884 | NIPBL | NIPBL, cohesin loading factor | 2 | 2 | ||||||||
MIRT719015 | HPGD | 15-hydroxyprostaglandin dehydrogenase | 2 | 2 | ||||||||
MIRT723323 | COLEC10 | collectin subfamily member 10 | 2 | 2 | ||||||||
MIRT724947 | TXNL1 | thioredoxin like 1 | 2 | 2 | ||||||||
MIRT725535 | EN2 | engrailed homeobox 2 | 2 | 2 | ||||||||
MIRT734156 | FHL1 | four and a half LIM domains 1 | 3 | 0 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|