| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-4445 |
| Genomic Coordinates | chr3: 109602828 - 109602897 |
| Description | Homo sapiens miR-4445 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | ||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-4445-5p | |||||||||||||||||||||
| Sequence | 8| AGAUUGUUUCUUUUGCCGUGCA |29 | |||||||||||||||||||||
| Evidence | Experimental | |||||||||||||||||||||
| Experiments | Illumina | |||||||||||||||||||||
| SNPs in miRNA |
|
|||||||||||||||||||||
| Putative Targets | ||||||||||||||||||||||
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | PUM1 | ||||||||||||||||||||
| Synonyms | HSPUM, PUMH, PUMH1, PUML1 | ||||||||||||||||||||
| Description | pumilio RNA binding family member 1 | ||||||||||||||||||||
| Transcript | NM_001020658 | ||||||||||||||||||||
| Other Transcripts | NM_014676 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on PUM1 | |||||||||||||||||||||
| 3'UTR of PUM1 (miRNA target sites are highlighted) |
>PUM1|NM_001020658|3'UTR 1 GGCAGTGTCACCCGCTGTTCCCTCATTCCCGCTGACCTCACTGGCCCACTGGCAAATCCAACCAGCAACCAGAAATGTTC 81 TAGTGTAGAGTCTGAGACGGGCAAGTGGTTGCTCCAGGATTACTCCCTCCTCCAAAAAAGGAATCAAATCCACGAGTGGA 161 AAAGCCTTTGTAAATTTAATTTTATTACACATAACATGTACTATTTTTTTTAATTGACTAATTGCCCTGCTGTTTTACTG 241 GTGTATAGGATACTTGTACATAGGTAACCAATGTACATGGGAGGCCACATATTTTGTTCACTGTTGTATCTATATTTCAC 321 ATGTGGAAACTTTCAGGGTGGTTGGTTTAACAAAAAAAAAAAGCTTTAAAAAAAAAAGAAAAAAAGGAAAAGGTTTTTAG 401 CTCATTTGCCTGGCCGGCAAGTTTTGCAAATAGCTCTTCCCCACCTCCTCATTTTAGTAAAAAACAAACAAAAACAAAAA 481 AACCTGAGAAGTTTGAATTGTAGTTAAATGACCCCAAACTGGCATTTAACACTGTTTATAAAAAATATATATATATATAT 561 ATATATATATAATGAAAAAGGTTTCAGAGTTGCTAAAGCTTCAGTTTGTGACATTAAGTTTATGAAATTCTAAAAAATGC 641 CTTTTTTGGAGACTATATTATGCTGAAGAAGGCTGTTCGTGAGGAGGAGATGCGAGCACCCAGAACGTCTTTTGAGGCTG 721 GGCGGGTGTGATTGTTTACTGCCTACTGGATTTTTTTCTATTAACATTGAAAGGTAAAATCTGATTATTTAGCATGAGAA 801 AAAAAAATCCAACTCTGCTTTTGGTCTTGCTTCTATAAATATATAGTGTATACTTGGTGTAGACTTTGCATATATACAAA 881 TTTGTAGTATTTTCTTGTTTTGATGTCTAATCTGTATCTATAATGTACCCTAGTAGTCGAACATACTTTTGATTGTACAA 961 TTGTACATTTGTATACCTGTAATGTAAATGTGGAGAAGTTTGAATCAACATAAACACGTTTTTTGGTAAGAAAAGAGAAT 1041 TAGCCAGCCCTGTGCATTCAGTGTATATTCTCACCTTTTATGGTCGTAGCATATAGTGTTGTATATTGTAAATTGTAATT 1121 TCAACCAGAAGTAAATTTTTTTCTTTTGAAGGAATAAATGTTCTTTATACAGCCTAGTTAATGTTTAAAAAGAAAAAAAT 1201 AGCTTGGTTTTATTTGTCATCTAGTCTCAAGTATAGCGAGATTCTTTCTAAATGTTATTCAAGATTGAGTTCTCACTAGT 1281 GTTTTTTTAATCCTAAAAAAGTAATGTTTTGATTTTGTGACAGTCAAAAGGACGTGCAAAAGTCTAGCCTTGCCCGAGCT 1361 TTCCTTACAATCAGAGCCCCTCTCACCTTGTAAAGTGTGAATCGCCCTTCCCTTTTGTACAGAAGATGAACTGTATTTTG 1441 CATTTTGTCTACTTGTAAGTGAATGTAACATACTGTCAATTTTCCTTGTTTGAATATAGAATTGTAACACTACACGGTGT 1521 ACATTTCCAGAGCCTTGTGTATATTTCCAATGAACTTTTTTGCAAGCACACTTGTAACCATATGTGTATAATTAACAAAC 1601 CTGTGTATGCTTATGCCTGGGCAACTATTTTTTGTAACTCTTGTGTAGATTGTCTCTAAACAATGTGTGATCTTTATTTT 1681 GAAAAATACAGAACTTTGGAATCTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | HEK293 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
||||||
| Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | HEK293 | ||||||
| Disease | 9698.0 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
||||||
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HCT116 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177622. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_12
PAR-CLIP data was present in ERX177629. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_7
PAR-CLIP data was present in ERX177634. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_12
PAR-CLIP data was present in ERX177617. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_7
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
| Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
| CLIP-seq Support 1 for dataset GSM545212 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000424085.2 | 3UTR | UCUAGCCUUGCCCGAGCUUUCCUUACAAUCAG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM714645 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repB |
| Location of target site | ENST00000424085.2 | 3UTR | UCUAGCCUUGCCCGAGCUUUCCUUACAAUCAG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
43 hsa-miR-4445-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT063885 | RASSF8 | Ras association domain family member 8 |  |
|
2 | 6 | ||||||
| MIRT087576 | PTMA | prothymosin, alpha | |
|
2 | 8 | ||||||
| MIRT092537 | KBTBD8 | kelch repeat and BTB domain containing 8 | |
|
2 | 6 | ||||||
| MIRT204613 | HSPE1-MOB4 | HSPE1-MOB4 readthrough | |
|
2 | 8 | ||||||
| MIRT204644 | MOB4 | MOB family member 4, phocein | |
|
2 | 8 | ||||||
| MIRT249009 | PUM1 | pumilio RNA binding family member 1 | |
|
2 | 4 | ||||||
| MIRT305656 | MBNL1 | muscleblind like splicing regulator 1 | |
|
2 | 2 | ||||||
| MIRT443971 | SSH2 | slingshot protein phosphatase 2 | |
|
2 | 2 | ||||||
| MIRT457186 | ERC1 | ELKS/RAB6-interacting/CAST family member 1 | |
|
2 | 2 | ||||||
| MIRT463721 | YWHAE | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon | |
|
2 | 8 | ||||||
| MIRT466974 | STARD7 | StAR related lipid transfer domain containing 7 | |
|
2 | 4 | ||||||
| MIRT473413 | MDM4 | MDM4, p53 regulator | |
|
2 | 2 | ||||||
| MIRT484984 | UBE2V1 | ubiquitin conjugating enzyme E2 V1 | |
|
2 | 8 | ||||||
| MIRT485021 | TMEM189-UBE2V1 | TMEM189-UBE2V1 readthrough | |
|
2 | 8 | ||||||
| MIRT485040 | TMEM189 | transmembrane protein 189 | |
|
2 | 8 | ||||||
| MIRT503747 | CEP19 | centrosomal protein 19 | |
|
2 | 6 | ||||||
| MIRT505080 | ZBTB18 | zinc finger and BTB domain containing 18 | |
|
2 | 4 | ||||||
| MIRT505649 | SHMT1 | serine hydroxymethyltransferase 1 | |
|
2 | 4 | ||||||
| MIRT507020 | HMGA2 | high mobility group AT-hook 2 | |
|
2 | 6 | ||||||
| MIRT507080 | GXYLT1 | glucoside xylosyltransferase 1 | |
|
2 | 6 | ||||||
| MIRT507679 | COIL | coilin | |
|
2 | 6 | ||||||
| MIRT511378 | IKZF3 | IKAROS family zinc finger 3 | |
|
2 | 4 | ||||||
| MIRT528246 | BMS1 | BMS1, ribosome biogenesis factor | |
|
2 | 2 | ||||||
| MIRT537033 | GREB1 | growth regulation by estrogen in breast cancer 1 | |
|
2 | 2 | ||||||
| MIRT537063 | GPR176 | G protein-coupled receptor 176 | |
|
2 | 2 | ||||||
| MIRT540927 | OIP5 | Opa interacting protein 5 | |
|
2 | 2 | ||||||
| MIRT544346 | SNAP47 | synaptosome associated protein 47 | |
|
2 | 2 | ||||||
| MIRT544749 | C8orf33 | chromosome 8 open reading frame 33 | |
|
2 | 2 | ||||||
| MIRT552417 | ZNF460 | zinc finger protein 460 | |
|
2 | 4 | ||||||
| MIRT554646 | ROBO1 | roundabout guidance receptor 1 | |
|
2 | 2 | ||||||
| MIRT555803 | PCMT1 | protein-L-isoaspartate (D-aspartate) O-methyltransferase | |
|
2 | 2 | ||||||
| MIRT557337 | HECTD2 | HECT domain E3 ubiquitin protein ligase 2 | |
|
2 | 2 | ||||||
| MIRT563240 | QRFPR | pyroglutamylated RFamide peptide receptor | |
|
2 | 2 | ||||||
| MIRT572692 | NCMAP | non-compact myelin associated protein | |
|
2 | 2 | ||||||
| MIRT607777 | HS6ST3 | heparan sulfate 6-O-sulfotransferase 3 | |
|
2 | 4 | ||||||
| MIRT612106 | CHRM3 | cholinergic receptor muscarinic 3 | |
|
2 | 2 | ||||||
| MIRT616193 | SATB2 | SATB homeobox 2 | |
|
2 | 2 | ||||||
| MIRT627774 | RAB30 | RAB30, member RAS oncogene family | |
|
2 | 2 | ||||||
| MIRT691689 | FLOT2 | flotillin 2 | |
|
2 | 2 | ||||||
| MIRT712623 | GTF2H5 | general transcription factor IIH subunit 5 | |
|
2 | 2 | ||||||
| MIRT719695 | STX6 | syntaxin 6 | |
|
2 | 2 | ||||||
| MIRT723575 | SWAP70 | SWAP switching B-cell complex subunit 70 | |
|
2 | 2 | ||||||
| MIRT724077 | NCKAP1L | NCK associated protein 1 like | |
|
2 | 2 | ||||||
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|