| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-4477a |
| Genomic Coordinates | chr9: 41233755 - 41233835 |
| Description | Homo sapiens miR-4477a stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | |||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-4477a | ||||||||||||||||||||||||||||||||||||||||||
| Sequence | 48| CUAUUAAGGACAUUUGUGAUUC |69 | ||||||||||||||||||||||||||||||||||||||||||
| Evidence | Experimental | ||||||||||||||||||||||||||||||||||||||||||
| Experiments | Illumina | ||||||||||||||||||||||||||||||||||||||||||
| SNPs in miRNA |
|
||||||||||||||||||||||||||||||||||||||||||
| Putative Targets | |||||||||||||||||||||||||||||||||||||||||||
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | AKIRIN1 | ||||||||||||||||||||
| Synonyms | C1orf108, STRF2 | ||||||||||||||||||||
| Description | akirin 1 | ||||||||||||||||||||
| Transcript | NM_001136275 | ||||||||||||||||||||
| Other Transcripts | NM_024595 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on AKIRIN1 | |||||||||||||||||||||
| 3'UTR of AKIRIN1 (miRNA target sites are highlighted) |
>AKIRIN1|NM_001136275|3'UTR 1 AGCTTTGTCACATATCTGGGTACCAGGTTTGACCTCAAGAGATGGCTGCTGTACACTTTTTGCAACTGGTTTGATGTCAC 81 ATTTCAGCTCCAACTTTGCATCCTGAGAACACTTAAACGTTTCTGCAGGTCCATTTTATACAACTTGAAAGACCGTAAAA 161 CTTTCTGGTTGCCACAAGCATATCTTTCTTTTCTGCTCATCCAATAAACAGCTGTGCCCTACTGTGATAGATTTTCCAAA 241 CAAAAATACCTGGAGCAGCAGTTTAGCAAAATATGCCTTCAGTGGCATTCAACAAATGGAGTTTCCCCAAGCACAGTTCT 321 GTAAGAAGTGCGTGTGAGAGTGTGTGTATATGTGTGTATGTGTATTTTAAGTTATTATTTGTATTGTGCAAAAATTTTTT 401 TTTGATCTTGGGGATTCTGGCTGTGAATTTGGTGCACGACAATTATGGTAAAAAAACATTTGCTTGGTCTAAAGAAGATC 481 ATTAATGTTTTGTGACCATACAAGTTGTAACAGTGGATTGTTTTTATGTGTAGGTATTGTTAAATACAGGGACTGTTTCC 561 AGGCACAGAATATGAATCGTAAGTTAGGATGGACATTAGATGTGATTATGATGATAAAGCGAAGGTCTGCGGTCCTATAT 641 CTACAGACACGTGGTGAGAAATTAGAACAAACTGGAGACGGGCCATTGACACATGGACTCTGCCTGGGCATGTTAGGTTA 721 ATTCTTTGACTCCAAGCCTTAAAATACTCACATGGAGTCAGCGCTCACCTCATTCACACAATTATCATAGAGCTCCCTGG 801 ACACTGAACCTCTAAAGGGAAAAGGTCTACCCTGGAGCCAGGAGCATCAGGGTTGGCTTGGGAGCATGAGAGGTGAGCCC 881 AGGGCTAGGCCTGGGCCAGGCCCCGGCAGCACTGCTACTTGGGAGGAGCCACTTCACCTTTGTATTAGTTATTAAAAAAT 961 ATAATTTGGGCTGGGCGCAGTGGCTCACGCCTGTAATCCCAGCACTTTGGGAGTCCGAGGCATGCGGATCACTTGAGGTC 1041 AGGAGTTCGAGACCACCCTGGCCAATATGGTGAAACCCCATCTCTACTAAAAATACAACAAAGTTAGCCGGGCGTGGTGG 1121 CAGGCGTCTGTAATCCCAGCTGCTTGGGAGGCTGAGGCAGGAGAATCACTTGAACCCTGGAGGTGGCGGTTGCAGTGAGC 1201 ACAGATCATGCCACTGCACTCCAGCCTGGGCAACAAAACGAGACTTCGTCTCAAAAAAAAAAAAAAAACATAGAATTTGG 1281 ATCCTTTGGTCGGGTTCTCCCAAATTCTTTTGAGGTGTCCATGGTCAACTGCTTCAGCTTTGTTTTGGCAACCCCCTGCC 1361 CGAAGTCGCATATAGGCTGTTCTTCACCTTGTTTCCAAGGCTGAGGAACAGAAAGTAGCCTCTGTTTTGAGGAGGTGGAA 1441 GTTAAGTATACATTTATTTTTTACTGTGACTTGTTCAGGACCACATTTTACAAAATGCCTTGTTTCCTTCATTGTTTCTG 1521 GAAAGGAAAGTTCTATTAATATTGTTTTACTTTGAATATAGAATAGTTTTTTTAATTAGGGCTTATTTTGAAAAATTCTG 1601 AGTTTAATTCAAATGTATGCCAATACCTTCCAAAGTAAGGTAATATTCAGAGACAGTTGTTGTGATCAGATGGCTTAGAG 1681 AAATTTCTGGAATATTCACATTCGAAGATTCCTTATTAATGAATGTCTTTGACTTAAATCTAACCAAAAACTGCAACATT 1761 ATTCTTTGTACATTTTCATTATATAGTGTTAACAAGCTTAGTTGCAAACAAATAAAATACTTAAGCTATTTGTTTACCTT 1841 GCCTTCTTAATACTGTGATAATGTTTATTAATTCAAATAACTTATGTGAGAGCTGCTATAACCATTTCCCCAGTTCAACA 1921 TTGCATTGAAAATTTATGGACCTTTAAAAAAAAAAGCCCAACAGTGATTTTTTTTTAATAATTAAAGAATGATTTTACTT 2001 TGTATTTGAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 79647.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | TZM-bl |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MCF7 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
| Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
| CLIP-seq Support 1 for dataset GSM545214 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO3 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000432648.3 | 3UTR | CCUUCUUAAUACUGUGAUA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM714644 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000432648.3 | 3UTR | UACCUUGCCUUCUUAAUACUGUGAUAAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset SRR1045082 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | MCF7 / Untreated |
| Location of target site | ENST00000432648.3 | 3UTR | CCUUCUUAAUACUGUGAUAAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 24398324 / SRX388831 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM1462574 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000432648.3 | 3UTR | UUUGUUUACCUUGCCUUCUUAAUACUGUGAUAAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
134 hsa-miR-4477a Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT055843 | PLEKHA1 | pleckstrin homology domain containing A1 |  |
|
2 | 10 | ||||||
| MIRT061259 | AMOTL1 | angiomotin like 1 | |
|
2 | 4 | ||||||
| MIRT071895 | BTF3L4 | basic transcription factor 3 like 4 | |
|
2 | 6 | ||||||
| MIRT076933 | MLLT6 | MLLT6, PHD finger containing | |
|
2 | 2 | ||||||
| MIRT078652 | ICT1 | mitochondrial ribosomal protein L58 | |
|
2 | 2 | ||||||
| MIRT083633 | PRNP | prion protein | |
|
2 | 2 | ||||||
| MIRT091629 | RPL15 | ribosomal protein L15 | |
|
2 | 4 | ||||||
| MIRT107076 | PPP6C | protein phosphatase 6 catalytic subunit | |
|
2 | 2 | ||||||
| MIRT111191 | TRIM33 | tripartite motif containing 33 | |
|
2 | 2 | ||||||
| MIRT114515 | ARF6 | ADP ribosylation factor 6 | |
|
2 | 2 | ||||||
| MIRT175250 | PSAT1 | phosphoserine aminotransferase 1 | |
|
2 | 4 | ||||||
| MIRT175430 | ACSL4 | acyl-CoA synthetase long chain family member 4 | |
|
2 | 2 | ||||||
| MIRT178687 | FAM102B | family with sequence similarity 102 member B | |
|
2 | 2 | ||||||
| MIRT189771 | CDADC1 | cytidine and dCMP deaminase domain containing 1 | |
|
2 | 2 | ||||||
| MIRT229450 | RPL10 | ribosomal protein L10 | |
|
2 | 2 | ||||||
| MIRT244899 | PHF6 | PHD finger protein 6 | |
|
2 | 2 | ||||||
| MIRT249189 | AKIRIN1 | akirin 1 | |
|
2 | 8 | ||||||
| MIRT261134 | TRIM8 | tripartite motif containing 8 | |
|
2 | 2 | ||||||
| MIRT275561 | ZIC5 | Zic family member 5 | |
|
2 | 4 | ||||||
| MIRT275652 | ABHD13 | abhydrolase domain containing 13 | |
|
2 | 2 | ||||||
| MIRT288082 | UTP18 | UTP18, small subunit processome component | |
|
2 | 2 | ||||||
| MIRT303605 | MTHFD2 | methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase | |
|
2 | 2 | ||||||
| MIRT307924 | ARL8B | ADP ribosylation factor like GTPase 8B | |
|
2 | 2 | ||||||
| MIRT316787 | FOXC1 | forkhead box C1 | |
|
2 | 2 | ||||||
| MIRT326910 | SCML2 | Scm polycomb group protein like 2 | |
|
2 | 2 | ||||||
| MIRT327713 | SPIN4 | spindlin family member 4 | |
|
2 | 2 | ||||||
| MIRT331632 | AASDHPPT | aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase | |
|
2 | 2 | ||||||
| MIRT342506 | TMOD3 | tropomodulin 3 | |
|
2 | 4 | ||||||
| MIRT354470 | LRRC58 | leucine rich repeat containing 58 | |
|
2 | 2 | ||||||
| MIRT378711 | TRIM24 | tripartite motif containing 24 | |
|
2 | 2 | ||||||
| MIRT407462 | YDJC | YdjC chitooligosaccharide deacetylase homolog | |
|
2 | 2 | ||||||
| MIRT408226 | SMAD5 | SMAD family member 5 | |
|
2 | 4 | ||||||
| MIRT441824 | ALG14 | ALG14, UDP-N-acetylglucosaminyltransferase subunit | |
|
2 | 2 | ||||||
| MIRT442783 | CHD8 | chromodomain helicase DNA binding protein 8 | |
|
2 | 2 | ||||||
| MIRT443184 | NHS | NHS actin remodeling regulator | |
|
2 | 4 | ||||||
| MIRT447615 | CUL3 | cullin 3 | |
|
2 | 2 | ||||||
| MIRT450156 | DSEL | dermatan sulfate epimerase-like | |
|
2 | 2 | ||||||
| MIRT454801 | NEDD9 | neural precursor cell expressed, developmentally down-regulated 9 | |
|
2 | 2 | ||||||
| MIRT463050 | ZNF644 | zinc finger protein 644 | |
|
2 | 2 | ||||||
| MIRT467400 | SOCS3 | suppressor of cytokine signaling 3 | |
|
2 | 2 | ||||||
| MIRT468174 | SGMS1 | sphingomyelin synthase 1 | |
|
2 | 2 | ||||||
| MIRT468949 | RPS14 | ribosomal protein S14 | |
|
2 | 6 | ||||||
| MIRT469835 | R3HDM4 | R3H domain containing 4 | |
|
2 | 2 | ||||||
| MIRT470724 | POFUT1 | protein O-fucosyltransferase 1 | |
|
2 | 2 | ||||||
| MIRT470902 | PLIN3 | perilipin 3 | |
|
2 | 2 | ||||||
| MIRT472467 | NAPG | NSF attachment protein gamma | |
|
2 | 12 | ||||||
| MIRT472602 | NAA50 | N(alpha)-acetyltransferase 50, NatE catalytic subunit | |
|
2 | 2 | ||||||
| MIRT492350 | SEMA7A | semaphorin 7A (John Milton Hagen blood group) | |
|
2 | 2 | ||||||
| MIRT493840 | FOXN3 | forkhead box N3 | |
|
2 | 4 | ||||||
| MIRT496318 | DOCK9 | dedicator of cytokinesis 9 | |
|
2 | 2 | ||||||
| MIRT500159 | CLEC2D | C-type lectin domain family 2 member D | |
|
2 | 8 | ||||||
| MIRT500535 | XPO4 | exportin 4 | |
|
2 | 4 | ||||||
| MIRT503916 | FBXL13 | F-box and leucine rich repeat protein 13 | |
|
2 | 4 | ||||||
| MIRT504003 | SAT1 | spermidine/spermine N1-acetyltransferase 1 | |
|
2 | 4 | ||||||
| MIRT505647 | SHMT1 | serine hydroxymethyltransferase 1 | |
|
2 | 4 | ||||||
| MIRT506574 | MIER3 | MIER family member 3 | |
|
2 | 4 | ||||||
| MIRT506945 | HS3ST3B1 | heparan sulfate-glucosamine 3-sulfotransferase 3B1 | |
|
2 | 4 | ||||||
| MIRT508196 | RPS19 | ribosomal protein S19 | |
|
2 | 6 | ||||||
| MIRT511417 | HSPA13 | heat shock protein family A (Hsp70) member 13 | |
|
2 | 4 | ||||||
| MIRT512326 | ACTB | actin beta | |
|
2 | 4 | ||||||
| MIRT515376 | RPL7 | ribosomal protein L7 | |
|
2 | 2 | ||||||
| MIRT520422 | TUBG1 | tubulin gamma 1 | |
|
2 | 4 | ||||||
| MIRT524844 | ARPP19 | cAMP regulated phosphoprotein 19 | |
|
2 | 2 | ||||||
| MIRT526320 | UGT2A1 | UDP glucuronosyltransferase family 2 member A1 complex locus | |
|
2 | 2 | ||||||
| MIRT526561 | UGT2A2 | UDP glucuronosyltransferase family 2 member A2 | |
|
2 | 2 | ||||||
| MIRT528027 | FEZ2 | fasciculation and elongation protein zeta 2 | |
|
2 | 2 | ||||||
| MIRT529874 | RBM43 | RNA binding motif protein 43 | |
|
2 | 2 | ||||||
| MIRT530826 | CLEC4D | C-type lectin domain family 4 member D | |
|
2 | 2 | ||||||
| MIRT531334 | GDPD1 | glycerophosphodiester phosphodiesterase domain containing 1 | |
|
2 | 2 | ||||||
| MIRT532068 | CCNB1 | cyclin B1 | |
|
2 | 4 | ||||||
| MIRT532870 | ZNF566 | zinc finger protein 566 | |
|
2 | 2 | ||||||
| MIRT535580 | NUP35 | nucleoporin 35 | |
|
2 | 2 | ||||||
| MIRT537644 | ERGIC2 | ERGIC and golgi 2 | |
|
2 | 4 | ||||||
| MIRT537725 | ELAVL2 | ELAV like RNA binding protein 2 | |
|
2 | 2 | ||||||
| MIRT538894 | BRI3BP | BRI3 binding protein | |
|
2 | 2 | ||||||
| MIRT538945 | BMP2K | BMP2 inducible kinase | |
|
2 | 2 | ||||||
| MIRT540703 | PDPK1 | 3-phosphoinositide dependent protein kinase 1 | |
|
2 | 4 | ||||||
| MIRT543210 | TMEM117 | transmembrane protein 117 | |
|
2 | 3 | ||||||
| MIRT543357 | LYRM2 | LYR motif containing 2 | |
|
2 | 2 | ||||||
| MIRT544905 | CLSPN | claspin | |
|
2 | 2 | ||||||
| MIRT545532 | ARF3 | ADP ribosylation factor 3 | |
|
2 | 2 | ||||||
| MIRT546446 | SMOC1 | SPARC related modular calcium binding 1 | |
|
2 | 2 | ||||||
| MIRT546882 | PURB | purine rich element binding protein B | |
|
2 | 4 | ||||||
| MIRT547440 | MED13 | mediator complex subunit 13 | |
|
2 | 2 | ||||||
| MIRT548027 | GOLIM4 | golgi integral membrane protein 4 | |
|
2 | 2 | ||||||
| MIRT548673 | CRNKL1 | crooked neck pre-mRNA splicing factor 1 | |
|
2 | 2 | ||||||
| MIRT550435 | LLGL2 | LLGL2, scribble cell polarity complex component | |
|
2 | 2 | ||||||
| MIRT551850 | RPS3 | ribosomal protein S3 | |
|
2 | 2 | ||||||
| MIRT556072 | MRFAP1 | Morf4 family associated protein 1 | |
|
2 | 2 | ||||||
| MIRT556554 | LIMS1 | LIM zinc finger domain containing 1 | |
|
2 | 2 | ||||||
| MIRT557132 | HOXA13 | homeobox A13 | |
|
2 | 2 | ||||||
| MIRT557875 | FEM1B | fem-1 homolog B | |
|
2 | 4 | ||||||
| MIRT558146 | ELK4 | ELK4, ETS transcription factor | |
|
2 | 2 | ||||||
| MIRT558862 | CD2AP | CD2 associated protein | |
|
2 | 2 | ||||||
| MIRT558884 | CCNE1 | cyclin E1 | |
|
2 | 4 | ||||||
| MIRT558907 | CBX5 | chromobox 5 | |
|
2 | 2 | ||||||
| MIRT559175 | BRAP | BRCA1 associated protein | |
|
2 | 2 | ||||||
| MIRT560860 | GAL3ST3 | galactose-3-O-sulfotransferase 3 | |
|
2 | 2 | ||||||
| MIRT561729 | PPIF | peptidylprolyl isomerase F | |
|
2 | 2 | ||||||
| MIRT564024 | CEBPB | CCAAT/enhancer binding protein beta | |
|
2 | 2 | ||||||
| MIRT564366 | TRMT5 | tRNA methyltransferase 5 | |
|
2 | 2 | ||||||
| MIRT564609 | ZNF703 | zinc finger protein 703 | |
|
2 | 2 | ||||||
| MIRT565494 | AZF1 | azoospermia factor 1 | |
|
2 | 2 | ||||||
| MIRT565577 | SLC6A8 | solute carrier family 6 member 8 | |
|
2 | 2 | ||||||
| MIRT566947 | LEPROT | leptin receptor overlapping transcript | |
|
2 | 2 | ||||||
| MIRT567293 | HNRNPA2B1 | heterogeneous nuclear ribonucleoprotein A2/B1 | |
|
2 | 2 | ||||||
| MIRT567308 | HMGN2 | high mobility group nucleosomal binding domain 2 | |
|
2 | 2 | ||||||
| MIRT568048 | CHSY1 | chondroitin sulfate synthase 1 | |
|
2 | 2 | ||||||
| MIRT571807 | PHF19 | PHD finger protein 19 | |
|
2 | 2 | ||||||
| MIRT609234 | RBM23 | RNA binding motif protein 23 | |
|
2 | 2 | ||||||
| MIRT610328 | SSX5 | SSX family member 5 | |
|
2 | 2 | ||||||
| MIRT611428 | UGT8 | UDP glycosyltransferase 8 | |
|
2 | 4 | ||||||
| MIRT611709 | SLFN13 | schlafen family member 13 | |
|
2 | 2 | ||||||
| MIRT612069 | CEP135 | centrosomal protein 135 | |
|
2 | 4 | ||||||
| MIRT617676 | JRKL | JRK like | |
|
2 | 2 | ||||||
| MIRT623684 | HNRNPA1 | heterogeneous nuclear ribonucleoprotein A1 | |
|
2 | 2 | ||||||
| MIRT635634 | PRR15L | proline rich 15 like | |
|
2 | 2 | ||||||
| MIRT636422 | MBOAT2 | membrane bound O-acyltransferase domain containing 2 | |
|
2 | 2 | ||||||
| MIRT637011 | GPATCH11 | G-patch domain containing 11 | |
|
2 | 2 | ||||||
| MIRT644150 | C4orf3 | chromosome 4 open reading frame 3 | |
|
2 | 2 | ||||||
| MIRT648562 | MEMO1 | mediator of cell motility 1 | |
|
2 | 2 | ||||||
| MIRT650752 | WNT16 | Wnt family member 16 | |
|
2 | 2 | ||||||
| MIRT651914 | UEVLD | UEV and lactate/malate dehyrogenase domains | |
|
2 | 2 | ||||||
| MIRT653556 | SLC38A7 | solute carrier family 38 member 7 | |
|
2 | 2 | ||||||
| MIRT692277 | XRN2 | 5'-3' exoribonuclease 2 | |
|
2 | 2 | ||||||
| MIRT697650 | WNK1 | WNK lysine deficient protein kinase 1 | |
|
2 | 2 | ||||||
| MIRT703876 | ERCC6 | ERCC excision repair 6, chromatin remodeling factor | |
|
2 | 2 | ||||||
| MIRT704615 | CLIP1 | CAP-Gly domain containing linker protein 1 | |
|
2 | 2 | ||||||
| MIRT708562 | BBOX1 | gamma-butyrobetaine hydroxylase 1 | |
|
2 | 2 | ||||||
| MIRT709614 | KBTBD6 | kelch repeat and BTB domain containing 6 | |
|
2 | 2 | ||||||
| MIRT712955 | SGCD | sarcoglycan delta | |
|
2 | 2 | ||||||
| MIRT713502 | DCAF17 | DDB1 and CUL4 associated factor 17 | |
|
2 | 2 | ||||||
| MIRT720239 | GPBP1 | GC-rich promoter binding protein 1 | |
|
2 | 2 | ||||||
| MIRT724255 | GLUD1 | glutamate dehydrogenase 1 | |
|
2 | 2 | ||||||
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|