>CHAC1|NM_001142776|3'UTR
   1 GGGGCTGAGCCCCTGCGGGGAGTGCTCATGTGGACATCAGGGCCAGACACCCACTCCAGTGCACAAGACAGACTTGCGAC
  81 CGCTTGAGCCCACTGAGCAGATATGGTGGGTGGCTGGAGGCTTCTCTTTCTCAGTCCCTGCCTGTCTGCCAGCCTGCAGC
 161 TCTCCTGCTTGACACTGACTTACTACTTGAAACTTTATTTATTGCACCATGTTGGTGTGGTGGGCAGGTGGAGGGCCTGC
 241 CCTGGACACAGGGGCCCTGCTGAGCAGTGGCCCCATCCTGGAACTTGACCAGATTCCCCCCAGTGCTGCTGCTAACCCCA
 321 CACCACCCAGGCCTCCACCTCCCCAGGGAGTCTCCAAGAGCCTCGATCCTCTGCTCACTCAGCCCAGCCATCCATAGCCC
 401 TGGGAATTCCACCTGCCAAGGATCCCAGCAGGCTGGATGAGGGATAGTAGGGCATGAGGAGAAGGAGCCCTGTAAGGACT
 481 GAGGCCCCGGCCAGCCCTTCTCCTCCACCAGTTCCCCAGAGCAGAGCTGGAGCTGATGCCTGGACACAGCTGCTGAGCCT
 561 GGCCTGGGCCTCTTACCCACTTGGTTGTTTTCTTGTCCCTCTGTCTGTCTGTCTATCTACTTGTCTGTCTGGGCCACTCC
 641 TGCCTGTGTGTTGGTCTATTCCTGGGAAGCTCATCACTACAGGCCCTGGCAACCTTCCCAGTCTGTCCCATACTGTTACC
 721 CATAAAACTATCTCTTTATCTGTGCAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' cgGAGUCUCCGUCGACGAa 5' | ::|| |||||||| Target 5' tgCCTGGACACAGCTGCTg 3'	537 - 555	153.00	-17.80
2	miRNA 3' cgGAGUCUCCGUCGACGAa 5' | ||| || |||||| Target 5' ccCCCAG-TGCTGCTGCTa 3'	297 - 314	124.00	-15.80
3	miRNA 3' cgGAGUCUCCG--UCGACgaa 5' | |||| || ||||| Target 5' tcCCCAGA-GCAGAGCTGgag 3'	513 - 532	114.00	-14.82

Mutant ID	Mutant Position	Mutant Source
COSN24305105	20	COSMIC
COSN30108918	39	COSMIC
COSN30541619	114	COSMIC
COSN30540770	169	COSMIC
COSN8743975	373	COSMIC
COSN26573801	388	COSMIC
COSN28162898	453	COSMIC
COSN21701408	711	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs774494219	4	dbSNP
rs548243212	5	dbSNP
rs1378418737	7	dbSNP
rs767630197	12	dbSNP
rs1284929085	15	dbSNP
rs753182576	17	dbSNP
rs1231749220	18	dbSNP
rs1457625710	19	dbSNP
rs1260047954	26	dbSNP
rs761220425	28	dbSNP
rs764461658	29	dbSNP
rs754287627	30	dbSNP
rs374995600	31	dbSNP
rs1444427697	32	dbSNP
rs1055802199	37	dbSNP
rs1438092602	39	dbSNP
rs766143019	39	dbSNP
rs1188677551	40	dbSNP
rs1237329499	41	dbSNP
rs112478522	42	dbSNP
rs1472249612	45	dbSNP
rs751248149	52	dbSNP
rs1425097208	53	dbSNP
rs1042292017	54	dbSNP
rs903327686	56	dbSNP
rs947506927	57	dbSNP
rs1035808170	58	dbSNP
rs1043510403	78	dbSNP
rs1259620386	79	dbSNP
rs770071687	82	dbSNP
rs1325369330	83	dbSNP
rs1387313212	100	dbSNP
rs1187429535	107	dbSNP
rs1383910592	113	dbSNP
rs903687252	114	dbSNP
rs1156646796	125	dbSNP
rs1418061621	127	dbSNP
rs1382468589	128	dbSNP
rs139980363	138	dbSNP
rs1453810826	139	dbSNP
rs1245055588	145	dbSNP
rs1201589234	148	dbSNP
rs999280977	162	dbSNP
rs577755279	165	dbSNP
rs193276361	166	dbSNP
rs1411941395	175	dbSNP
rs1452712378	176	dbSNP
rs1261440525	206	dbSNP
rs1214994675	209	dbSNP
rs1403361587	221	dbSNP
rs1012923707	226	dbSNP
rs1052333515	240	dbSNP
rs1026953493	241	dbSNP
rs1276130576	252	dbSNP
rs113689186	255	dbSNP
rs566702383	256	dbSNP
rs982694781	257	dbSNP
rs908434449	266	dbSNP
rs1401675482	270	dbSNP
rs965267955	273	dbSNP
rs773605823	274	dbSNP
rs1298955770	276	dbSNP
rs1434366909	285	dbSNP
rs1296273485	297	dbSNP
rs1007870817	298	dbSNP
rs1017924912	301	dbSNP
rs1478642141	322	dbSNP
rs899469574	327	dbSNP
rs759163821	328	dbSNP
rs1414894602	329	dbSNP
rs1124516	333	dbSNP
rs558910310	334	dbSNP
rs1192147909	340	dbSNP
rs976981926	353	dbSNP
rs951587794	365	dbSNP
rs1225818301	366	dbSNP
rs1280091185	367	dbSNP
rs982941156	377	dbSNP
rs1200600618	379	dbSNP
rs1423760259	382	dbSNP
rs1308243532	384	dbSNP
rs1276161890	396	dbSNP
rs1220397647	399	dbSNP
rs1353438103	405	dbSNP
rs568835213	412	dbSNP
rs1340849262	413	dbSNP
rs1292468509	414	dbSNP
rs1215009510	417	dbSNP
rs1035986360	421	dbSNP
rs960261550	431	dbSNP
rs1414372436	432	dbSNP
rs1357683497	434	dbSNP
rs144776380	435	dbSNP
rs553819402	436	dbSNP
rs1395874671	438	dbSNP
rs932366652	440	dbSNP
rs1053394667	452	dbSNP
rs914881751	468	dbSNP
rs947336807	482	dbSNP
rs947657720	486	dbSNP
rs1187830527	489	dbSNP
rs752163569	490	dbSNP
rs1041996823	495	dbSNP
rs1178727322	498	dbSNP
rs1200401766	500	dbSNP
rs148563443	506	dbSNP
rs760107673	507	dbSNP
rs1408360624	508	dbSNP
rs764034891	530	dbSNP
rs903421290	535	dbSNP
rs938901927	536	dbSNP
rs1449073196	541	dbSNP
rs1335200214	548	dbSNP
rs1438867638	553	dbSNP
rs764660926	575	dbSNP
rs753709363	584	dbSNP
rs879140772	587	dbSNP
rs1156714818	600	dbSNP
rs757290569	601	dbSNP
rs574581008	604	dbSNP
rs1401750288	606	dbSNP
rs765096368	612	dbSNP
rs1164640359	617	dbSNP
rs894571708	620	dbSNP
rs750295162	637	dbSNP
rs1416413122	638	dbSNP
rs540363172	647	dbSNP
rs375601632	654	dbSNP
rs891068905	659	dbSNP
rs1235804147	661	dbSNP
rs1180012448	669	dbSNP
rs184803428	671	dbSNP
rs943973178	678	dbSNP
rs546152592	682	dbSNP
rs1357068003	684	dbSNP
rs1323244984	685	dbSNP
rs1443835152	689	dbSNP
rs758651106	691	dbSNP
rs1290355821	693	dbSNP
rs144026361	698	dbSNP
rs1353315439	701	dbSNP
rs1307177185	710	dbSNP
rs531918016	714	dbSNP
rs888469303	715	dbSNP
rs1293383084	722	dbSNP
rs995548701	723	dbSNP
rs1026769342	730	dbSNP
rs965673879	731	dbSNP
rs976616900	731	dbSNP
rs1378169161	732	dbSNP
rs1160102365	737	dbSNP

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.