miRTarBase - #MIRT252052


—
pre-miRNA Information
pre-miRNA hsa-mir-433   
Genomic Coordinates chr14: 100881886 - 100881978
Synonyms MIRN433, hsa-mir-433, miRNA433, MIR433
Description Homo sapiens miR-433 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-433-3p
Sequence 64| AUCAUGAUGGGCUCCUCGGUGU |85
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSM8969374 10 COSMIC
COSM6770363 11 COSMIC
COSM381402 17 COSMIC
COSM8924941 18 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs757633556 8 dbSNP
rs781425496 17 dbSNP
rs1261819806 18 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol WDR45B   
Synonyms WDR45L, WIPI-3, WIPI3
Description WD repeat domain 45B
Transcript NM_019613   
Expression
Putative miRNA Targets on WDR45B
3'UTR of WDR45B
(miRNA target sites are highlighted)		 
>WDR45B|NM_019613|3'UTR
   1 CTCCAGCTGGGGGCGCCACAGCACCCACCACCTGCCGCCTTCAGACTCTCGGGGCTGGTGCCAGTGCCCCAGGGGCCTCC
  81 TGGGCCACGGGCTGGAGGGGCTGCCCAGGGACCTTGGTCTCGAAGCCATACGTGGTTGTCTGCTTTCCTAAGGACTCCCA
 161 TTTCCAGTATTAAAGAGAGAATCATCATCAAGGCACCGTAGGTAACTCAGTGGCTGTGACCAGCTCGACTGGCGGCCACT
 241 GGCTGTTCCCATGAGTTCAGCTGTGACGTTAGCTTCAGTGGCTCCGCCGCATCCTCACACTGACGGGGGCTCCATACGGA
 321 CCTGGGGACTGGGCTGAGAGGGTGGACGAGTTCAGGTTTGTTTTTGCAGCAGATTCCGTCGTTCTTACTGAGTCTGCAGC
 401 GGGGGAGTGAACAAGTGTGCAGATGTAAGTTCTTACATGATAAGCAGATTGAATACAACACCAGCAGCTTGCCTTAGAAA
 481 AGGAGAAAGGAATTCCTTTTCCCGCCCGAACATGAAGAAAAATGACCTGACCCTGTAGAGAGAACACAGTGTGAATGTTT
 561 CCCCTCGTGTGAGCCCAGCCTGTGGTCTTCTCCGTACCCGCAACGTGGTCATCTGTGCCCGTGACGTCACCTGTGCCCGT
 641 GCGTGGCGTCCCCGTCTCCGTTGGGGCCATTAGAATGAGGCAGACACCAGGCCACTCTAGAAGCCGAGCCGTCACACCTC
 721 AGGCGTGTGCGGGGCGGGGACGGGGGGTCTCCTGGTTACATTTTGGATTAAACCTGTTTCCCGGTTATGTGTAGGGAACA
 801 GCAGAGTGATGCACGAACTTTGAACATTCGTTATGGGGAAAACATCCTTTAACTTCGGGGTCGTCTGCCAGAGCAGGGTC
 881 TGGGAGGGTCCATGCAGTTCCCGCTGGTGTGGAGGGAAATGCCCTGGTCTGGCCTCCGAGCCCCCAGGTCCACCGTCTCC
 961 CCTCCCCTCATTTGTAAGAATAGCTACACACTAACATTTTGGGAAGGAGAGGCACATAACTTTTTTTAACATTTGGTAAC
1041 TAGGTTATGGGCTCTACATTGTCAGCTACTTGGGATATATATTTAATTTTCTTAAATTCCCGTTAAACTCTATTTTATGG
1121 TTTTGATTTCAGATTGCAAACATGTAAAACCTGCATAGCAGCGAGTTCTCGGTTTTGCCGGTTTCTTTAGTTCTTTACTG
1201 TCACTGTCATGTAATCAGCTAATTCTCTGTGGATGTTGCTGTAAAGTATGCATGTTCCTTTCATGTGTATTTAATCATGA
1281 TGTTTAATTTTGCACACTTATTTGTAATGTTTCTTTTAAATAAAAGTGACTAATTTTGTTGTAGTCTGGACCTGTAAAAA
1361 AAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugugGCUCCUCGGGUAGUACUa 5'
              :| | | :: ||||||| 
Target 5' ttcaTGTGTATTTAATCATGAt 3'
 1260 - 1281 146.00 -7.99
2 
miRNA  3' uguggCUCCUCGGGUAGUACUa 5'
               ||| :  :|||||| | 
Target 5' ttaaaGAGAGAATCATCATCAa 3'
 170 - 191 121.00 -9.12
3 
miRNA  3' uguggcuccuCGGG-UAGUACUa 5'
                    |||| | ||||| 
Target 5' tccttttcccGCCCGAACATGAa 3'
 494 - 516 120.00 -11.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30154905 44 COSMIC
COSN20243996 88 COSMIC
COSN26573848 151 COSMIC
COSN15107839 166 COSMIC
COSN28882107 226 COSMIC
COSN18720417 523 COSMIC
COSN27865940 621 COSMIC
COSN26723579 1163 COSMIC
COSN25930762 1208 COSMIC
COSN30544031 1219 COSMIC
COSN31522500 1275 COSMIC
COSN31537399 1325 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs374132539 3 dbSNP
rs750229843 5 dbSNP
rs1391908126 6 dbSNP
rs1295723725 9 dbSNP
rs35771102 9 dbSNP
rs1423116453 10 dbSNP
rs756901861 14 dbSNP
rs751217188 15 dbSNP
rs1419808713 17 dbSNP
rs1166930459 25 dbSNP
rs1237101239 27 dbSNP
rs1280454293 34 dbSNP
rs1352267738 36 dbSNP
rs763622863 37 dbSNP
rs1179584320 41 dbSNP
rs1418503840 46 dbSNP
rs958213169 48 dbSNP
rs1190459707 49 dbSNP
rs1267961338 50 dbSNP
rs1030901248 51 dbSNP
rs769265465 51 dbSNP
rs1174130291 58 dbSNP
rs1481990430 61 dbSNP
rs375733922 64 dbSNP
rs575987190 66 dbSNP
rs559170477 70 dbSNP
rs967363279 75 dbSNP
rs1199222860 83 dbSNP
rs1029790540 88 dbSNP
rs1319983849 89 dbSNP
rs373175181 106 dbSNP
rs143181998 110 dbSNP
rs3764356 114 dbSNP
rs554853620 117 dbSNP
rs1313721702 121 dbSNP
rs1221637090 126 dbSNP
rs1005692970 128 dbSNP
rs536846498 129 dbSNP
rs569327333 132 dbSNP
rs551113557 135 dbSNP
rs1469602951 141 dbSNP
rs1194192978 142 dbSNP
rs532511722 143 dbSNP
rs929685891 144 dbSNP
rs906212399 145 dbSNP
rs1466570940 165 dbSNP
rs1403169994 169 dbSNP
rs1401532712 175 dbSNP
rs879040768 175 dbSNP
rs1392750765 177 dbSNP
rs1463278241 178 dbSNP
rs1326986742 179 dbSNP
rs1335740442 180 dbSNP
rs1321413464 181 dbSNP
rs1440611465 181 dbSNP
rs1280816874 187 dbSNP
rs143476986 189 dbSNP
rs947821755 193 dbSNP
rs1290987765 197 dbSNP
rs546999198 198 dbSNP
rs989743689 200 dbSNP
rs936505797 206 dbSNP
rs1436047322 211 dbSNP
rs1206487961 213 dbSNP
rs377447982 217 dbSNP
rs1234692734 222 dbSNP
rs1470518287 223 dbSNP
rs527590066 224 dbSNP
rs1421494046 226 dbSNP
rs923889280 227 dbSNP
rs1310596898 229 dbSNP
rs1416040434 231 dbSNP
rs978030859 233 dbSNP
rs954570796 234 dbSNP
rs1459031483 239 dbSNP
rs560440632 240 dbSNP
rs1331394874 245 dbSNP
rs976720284 248 dbSNP
rs547944505 252 dbSNP
rs964141274 253 dbSNP
rs1290890106 258 dbSNP
rs1194959577 261 dbSNP
rs376296533 263 dbSNP
rs1233490516 264 dbSNP
rs1356796715 267 dbSNP
rs866696822 268 dbSNP
rs1216267035 270 dbSNP
rs1266222157 271 dbSNP
rs1485299502 277 dbSNP
rs1210327656 278 dbSNP
rs1255454808 279 dbSNP
rs1486795832 282 dbSNP
rs866239700 285 dbSNP
rs1372884664 288 dbSNP
rs529844783 289 dbSNP
rs1170003072 296 dbSNP
rs181412836 299 dbSNP
rs1434617978 303 dbSNP
rs1447681558 304 dbSNP
rs189863129 305 dbSNP
rs1415040701 306 dbSNP
rs1317123277 312 dbSNP
rs1324470596 314 dbSNP
rs994389447 317 dbSNP
rs1329912211 318 dbSNP
rs1347115051 318 dbSNP
rs1391138723 320 dbSNP
rs1391929486 323 dbSNP
rs1165413642 327 dbSNP
rs113693233 329 dbSNP
rs1384298032 344 dbSNP
rs1261380118 347 dbSNP
rs184413649 348 dbSNP
rs1195843060 367 dbSNP
rs1249001494 368 dbSNP
rs540262839 375 dbSNP
rs1236221974 377 dbSNP
rs1011850035 380 dbSNP
rs1181040459 381 dbSNP
rs750683641 383 dbSNP
rs1434721889 385 dbSNP
rs1157473913 389 dbSNP
rs1452156658 390 dbSNP
rs894918576 400 dbSNP
rs1269161634 401 dbSNP
rs1318766126 404 dbSNP
rs1369914264 407 dbSNP
rs1438643831 408 dbSNP
rs117959151 416 dbSNP
rs1371634669 420 dbSNP
rs1489916079 427 dbSNP
rs936539420 443 dbSNP
rs1291335234 444 dbSNP
rs1348861364 446 dbSNP
rs1240878221 456 dbSNP
rs1355984666 458 dbSNP
rs1468270682 472 dbSNP
rs561453851 477 dbSNP
rs34065574 482 dbSNP
rs1434242085 488 dbSNP
rs148851513 490 dbSNP
rs370510870 499 dbSNP
rs759787719 503 dbSNP
rs1455046700 504 dbSNP
rs368006360 505 dbSNP
rs1325939275 507 dbSNP
rs1385511381 508 dbSNP
rs1459742339 512 dbSNP
rs1327655241 518 dbSNP
rs9271 523 dbSNP
rs1390718090 527 dbSNP
rs976770831 533 dbSNP
rs1334004301 534 dbSNP
rs557620024 540 dbSNP
rs764140174 546 dbSNP
rs539111634 548 dbSNP
rs1289145166 549 dbSNP
rs1334433099 551 dbSNP
rs547159438 566 dbSNP
rs1275410280 567 dbSNP
rs1489113527 578 dbSNP
rs746717779 578 dbSNP
rs181631118 579 dbSNP
rs1420286642 582 dbSNP
rs984226932 583 dbSNP
rs952873992 588 dbSNP
rs1478311021 592 dbSNP
rs189268125 593 dbSNP
rs760144790 594 dbSNP
rs1394422532 595 dbSNP
rs1393280707 597 dbSNP
rs994274907 598 dbSNP
rs1355112791 599 dbSNP
rs1231646314 600 dbSNP
rs1196405361 603 dbSNP
rs1490126401 604 dbSNP
rs1227352437 605 dbSNP
rs566606272 613 dbSNP
rs1481900351 614 dbSNP
rs1217648905 616 dbSNP
rs970977568 617 dbSNP
rs770962813 620 dbSNP
rs1484503518 621 dbSNP
rs1282207935 626 dbSNP
rs1414273142 628 dbSNP
rs1427633518 631 dbSNP
rs1204698964 638 dbSNP
rs184847878 639 dbSNP
rs1430301995 641 dbSNP
rs1011903900 642 dbSNP
rs1169347057 642 dbSNP
rs1413187055 643 dbSNP
rs752163190 647 dbSNP
rs529806124 648 dbSNP
rs1222001463 650 dbSNP
rs1345315304 652 dbSNP
rs1278383050 653 dbSNP
rs1000628198 654 dbSNP
rs1343136572 660 dbSNP
rs1345042257 678 dbSNP
rs957366706 686 dbSNP
rs902232259 698 dbSNP
rs1042262927 699 dbSNP
rs933120023 704 dbSNP
rs923211279 705 dbSNP
rs767034802 706 dbSNP
rs1404179948 707 dbSNP
rs1192870956 710 dbSNP
rs1394564539 711 dbSNP
rs1170777387 719 dbSNP
rs776514247 724 dbSNP
rs562328883 725 dbSNP
rs1453285125 730 dbSNP
rs1287519694 731 dbSNP
rs550390800 731 dbSNP
rs746727716 734 dbSNP
rs145454991 735 dbSNP
rs911234843 738 dbSNP
rs984501626 741 dbSNP
rs565001175 742 dbSNP
rs1278682386 743 dbSNP
rs1240639134 745 dbSNP
rs1316005762 747 dbSNP
rs1213159804 748 dbSNP
rs952847030 748 dbSNP
rs539796565 751 dbSNP
rs918648841 753 dbSNP
rs1192773208 756 dbSNP
rs1251130518 758 dbSNP
rs572818521 760 dbSNP
rs1455515840 761 dbSNP
rs972904036 764 dbSNP
rs779886810 767 dbSNP
rs1418743388 772 dbSNP
rs1157117938 773 dbSNP
rs1025220340 780 dbSNP
rs1443083991 782 dbSNP
rs758055325 783 dbSNP
rs192144125 785 dbSNP
rs1392974568 788 dbSNP
rs113245692 802 dbSNP
rs551652596 814 dbSNP
rs1323510562 815 dbSNP
rs1259102359 817 dbSNP
rs1289907319 829 dbSNP
rs1032019649 830 dbSNP
rs1212891082 831 dbSNP
rs1000914745 833 dbSNP
rs1222155537 839 dbSNP
rs902281183 839 dbSNP
rs1247377789 843 dbSNP
rs1020700847 846 dbSNP
rs1175551812 848 dbSNP
rs1414537637 850 dbSNP
rs1359353880 854 dbSNP
rs1269229540 856 dbSNP
rs576033908 857 dbSNP
rs901672213 859 dbSNP
rs1366355206 860 dbSNP
rs531551170 862 dbSNP
rs371303215 863 dbSNP
rs34577073 867 dbSNP
rs1048416676 868 dbSNP
rs1350771831 869 dbSNP
rs931293087 871 dbSNP
rs1463880941 874 dbSNP
rs1291236963 886 dbSNP
rs1417554940 891 dbSNP
rs1186182964 892 dbSNP
rs1228821854 895 dbSNP
rs918705418 896 dbSNP
rs1435995008 900 dbSNP
rs972789894 902 dbSNP
rs754426842 903 dbSNP
rs949433391 903 dbSNP
rs1181892247 909 dbSNP
rs1483521272 914 dbSNP
rs1187428448 920 dbSNP
rs1255856435 921 dbSNP
rs1474017887 923 dbSNP
rs1164190098 926 dbSNP
rs578005451 932 dbSNP
rs553437679 934 dbSNP
rs1169969840 936 dbSNP
rs918091845 937 dbSNP
rs991366286 938 dbSNP
rs1341887195 953 dbSNP
rs534684743 954 dbSNP
rs567667255 955 dbSNP
rs979147275 957 dbSNP
rs549001399 959 dbSNP
rs1276889132 961 dbSNP
rs1020754744 962 dbSNP
rs187897828 970 dbSNP
rs997276531 970 dbSNP
rs901567145 982 dbSNP
rs1358075797 985 dbSNP
rs1312275159 988 dbSNP
rs1017470041 992 dbSNP
rs1188735798 992 dbSNP
rs1474726744 992 dbSNP
rs1190999628 993 dbSNP
rs1390257235 998 dbSNP
rs1433630661 1001 dbSNP
rs1171185234 1003 dbSNP
rs1403966869 1013 dbSNP
rs1451357343 1015 dbSNP
rs1317410969 1016 dbSNP
rs1324417557 1023 dbSNP
rs1437203184 1027 dbSNP
rs1298327201 1028 dbSNP
rs1370142593 1028 dbSNP
rs1233731014 1031 dbSNP
rs1377475260 1033 dbSNP
rs1333289733 1048 dbSNP
rs776984709 1052 dbSNP
rs1439707637 1057 dbSNP
rs1007789557 1058 dbSNP
rs1353734454 1065 dbSNP
rs1201201065 1066 dbSNP
rs1165282942 1069 dbSNP
rs887729310 1077 dbSNP
rs1049444430 1079 dbSNP
rs568852122 1080 dbSNP
rs1406142567 1083 dbSNP
rs1387375598 1101 dbSNP
rs1161684700 1102 dbSNP
rs1454201338 1106 dbSNP
rs550319353 1110 dbSNP
rs1378817913 1112 dbSNP
rs1478162712 1112 dbSNP
rs576731192 1114 dbSNP
rs1382513128 1115 dbSNP
rs897166132 1117 dbSNP
rs1381425825 1144 dbSNP
rs1393699026 1156 dbSNP
rs141091288 1162 dbSNP
rs1299310863 1163 dbSNP
rs1059672 1167 dbSNP
rs917976754 1171 dbSNP
rs1232632869 1177 dbSNP
rs1222855306 1179 dbSNP
rs1327322837 1180 dbSNP
rs1230676652 1196 dbSNP
rs3200457 1203 dbSNP
rs556582146 1204 dbSNP
rs1289159833 1214 dbSNP
rs1468449497 1225 dbSNP
rs1268854495 1240 dbSNP
rs1244518097 1243 dbSNP
rs1451611540 1252 dbSNP
rs1353837956 1259 dbSNP
rs991026818 1260 dbSNP
rs1473352850 1263 dbSNP
rs938162290 1263 dbSNP
rs1416836403 1269 dbSNP
rs546688042 1270 dbSNP
rs528206254 1272 dbSNP
rs1372577986 1283 dbSNP
rs779082006 1285 dbSNP
rs1328241487 1287 dbSNP
rs536849433 1292 dbSNP
rs1230420295 1297 dbSNP
rs1289392961 1298 dbSNP
rs1334540765 1301 dbSNP
rs1243255614 1302 dbSNP
rs1267821709 1306 dbSNP
rs756514384 1308 dbSNP
rs550203622 1313 dbSNP
rs966910574 1320 dbSNP
rs753057808 1332 dbSNP
rs1248940178 1341 dbSNP
rs1048128644 1349 dbSNP
rs1182379298 1353 dbSNP
rs1367606339 1354 dbSNP
rs1020646824 1357 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uguggcuccUCGGGUAGUACUa 5'
                   | :: ||||||| 
Target 5' --------uAUUUAAUCAUGAu 3'
 		1 - 14
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000392325.4 | 3UTR | UAUUUAAUCAUGAUGUUUAAUUUUGCACACUUAUUUGUAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
75 hsa-miR-433-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT001201 GRB2 growth factor receptor bound protein 2 3 1
MIRT001741 FGF20 fibroblast growth factor 20 3 1
MIRT007225 RUNX2 runt related transcription factor 2 1 1
MIRT007361 CFTR cystic fibrosis transmembrane conductance regulator 1 1
MIRT016630 HDAC6 histone deacetylase 6 1 1
MIRT053561 KRAS KRAS proto-oncogene, GTPase 3 1
MIRT082022 COX6B1 cytochrome c oxidase subunit 6B1 2 4
MIRT086929 CREB1 cAMP responsive element binding protein 1 3 1
MIRT096407 C5ORF22 chromosome 5 open reading frame 22 2 2
MIRT135569 SPRYD4 SPRY domain containing 4 2 2
MIRT143520 CHD9 chromodomain helicase DNA binding protein 9 2 2
MIRT167706 HIVEP1 human immunodeficiency virus type I enhancer binding protein 1 2 8
MIRT207568 STARD7 StAR related lipid transfer domain containing 7 2 4
MIRT252052 WDR45B WD repeat domain 45B 2 2
MIRT327787 YIPF6 Yip1 domain family member 6 2 2
MIRT406144 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT437355 GBP2 guanylate binding protein 2 3 1
MIRT438242 TYMS thymidylate synthetase 3 1
MIRT438553 AZIN1 antizyme inhibitor 1 4 1
MIRT444186 SCAMP1 secretory carrier membrane protein 1 2 2
MIRT477737 EDN1 endothelin 1 2 2
MIRT483052 SMU1 DNA replication regulator and spliceosomal factor 2 2
MIRT485778 ATXN1 ataxin 1 2 2
MIRT498142 FKBP1C FK506 binding protein 1C 2 4
MIRT499050 SSC5D scavenger receptor cysteine rich family member with 5 domains 2 8
MIRT501959 MAPK8 mitogen-activated protein kinase 8 2 2
MIRT503281 TMEM229B transmembrane protein 229B 2 4
MIRT503597 ZNF780A zinc finger protein 780A 2 2
MIRT504577 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 4
MIRT506727 LONRF2 LON peptidase N-terminal domain and ring finger 2 2 2
MIRT523130 HSP90B1 heat shock protein 90 beta family member 1 2 4
MIRT531338 TGIF2LX TGFB induced factor homeobox 2 like, X-linked 2 2
MIRT534928 PTPLAD1 3-hydroxyacyl-CoA dehydratase 3 1 1
MIRT536233 LRIG3 leucine rich repeats and immunoglobulin like domains 3 2 2
MIRT537092 GPR135 G protein-coupled receptor 135 2 2
MIRT548286 FAM3C family with sequence similarity 3 member C 2 4
MIRT549143 BRWD1 bromodomain and WD repeat domain containing 1 2 2
MIRT556354 MAFK MAF bZIP transcription factor K 2 2
MIRT557839 FKBP1A FK506 binding protein 1A 2 2
MIRT564080 NSA2 NSA2, ribosome biogenesis homolog 2 2
MIRT566382 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT573110 ERBB2IP erbb2 interacting protein 2 2
MIRT574403 TFAP2A transcription factor AP-2 alpha 2 2
MIRT576063 Poteg POTE ankyrin domain family, member G 2 2
MIRT619449 TCF20 transcription factor 20 2 2
MIRT632928 FGF9 fibroblast growth factor 9 2 2
MIRT633216 ZNF584 zinc finger protein 584 2 2
MIRT633654 SLC28A1 solute carrier family 28 member 1 2 2
MIRT637198 KLHL4 kelch like family member 4 2 2
MIRT646480 SPATS2L spermatogenesis associated serine rich 2 like 2 2
MIRT648314 SCNN1G sodium channel epithelial 1 gamma subunit 2 2
MIRT648631 LEMD2 LEM domain containing 2 2 2
MIRT655902 NEK9 NIMA related kinase 9 2 2
MIRT667805 ITIH5 inter-alpha-trypsin inhibitor heavy chain family member 5 2 2
MIRT675464 NUBPL nucleotide binding protein like 2 2
MIRT675974 FAM126B family with sequence similarity 126 member B 2 2
MIRT676145 ALDOA aldolase, fructose-bisphosphate A 2 2
MIRT676895 GABPB1 GA binding protein transcription factor beta subunit 1 2 2
MIRT677459 PDLIM3 PDZ and LIM domain 3 2 2
MIRT677533 TM4SF5 transmembrane 4 L six family member 5 2 2
MIRT677641 HAUS2 HAUS augmin like complex subunit 2 2 2
MIRT678806 HRH4 histamine receptor H4 2 2
MIRT679693 SLC1A5 solute carrier family 1 member 5 2 4
MIRT679707 RPL24 ribosomal protein L24 2 2
MIRT698822 STK38 serine/threonine kinase 38 2 2
MIRT701796 MRPS25 mitochondrial ribosomal protein S25 2 2
MIRT702220 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT706095 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT706502 MTMR9 myotubularin related protein 9 2 2
MIRT709780 NINJ1 ninjurin 1 2 2
MIRT713859 MBNL1 muscleblind like splicing regulator 1 2 2
MIRT715807 BBS2 Bardet-Biedl syndrome 2 2 2
MIRT724229 DGKE diacylglycerol kinase epsilon 2 2
MIRT731338 MET MET proto-oncogene, receptor tyrosine kinase 1 1
MIRT731849 HIF1A hypoxia inducible factor 1 alpha subunit 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-433 ACTH approved 16132265 Microarray adrenal gland 22128032 2012 down-regulated
miR-433 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-433 Glucose NULL 5793 Microarray endothelial cells 24394957 2014 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-433-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-433-3p Paclitaxel 36314 NSC125973 approved resistant Low Serous Epithelial Ovarian Cancer cell line (A2780)
hsa-miR-433-3p Fluorouracil 3385 NSC19893 approved sensitive Low Cervical Cancer cell line (Hela)
hsa-miR-433-3p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-433-3p Paclitaxel 36314 NSC125973 approved resistant Low Ovarian Cancer cell line (A2780, PEO1, PEO4)
hsa-miR-433-3p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer tissue
hsa-miR-433-3p Aromatase Inhibitor resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-433-3p Temozolomide 5394 NSC362856 approved sensitive Low Glioma cell line (U251, U87)
hsa-miR-433-3p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (M14) (500nM)
hsa-miR-433-3p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (M14) (500nM)
hsa-miR-433-3p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (M14) (1uM)
hsa-miR-433-3p Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (M14) (1uM)
hsa-miR-433-3p Cisplatin 5460033 NSC119875 approved sensitive Low Gastric Cancer cell line (MGC803)
hsa-miR-433-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Ductal Adenocarcinoma tissue
hsa-miR-433-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-433-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-433-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-433-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-433-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-433-3p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-433-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-433-3p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-433-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-433-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-433-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-433-3p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-433-3p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-433-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-433-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-433-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission