miRTarBase - #MIRT253117


—
pre-miRNA Information
pre-miRNA hsa-mir-4436b-1   
Genomic Coordinates chr2: 110086433 - 110086523
Description Homo sapiens miR-4436b-1 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-4436b-2   
Genomic Coordinates chr2: 110284853 - 110284943
Description Homo sapiens miR-4436b-2 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4436b-3p
Sequence 60| CAGGGCAGGAAGAAGUGGACAA |81
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs760150076 9 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol BCL2L12   
Synonyms -
Description BCL2 like 12
Transcript NM_001040668   
Other Transcripts NM_138639   
Expression
Putative miRNA Targets on BCL2L12
3'UTR of BCL2L12
(miRNA target sites are highlighted)		 
>BCL2L12|NM_001040668|3'UTR
   1 GCTCTTTCTCAGAAGCTGCTACAAGATGACACCTCATGTCCCTGCCCTCTTCGTGTGCTTTTCCAAGTCTTCCTATTCCA
  81 CTCAGGGCTGTGGGGTGGTGGTTGCCCTACCTGTTTTTGCCAAAAATAAATTGTTTAAAACTTTTCTTATTAAAAACGTT
 161 ACAAAGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aacaGGUGAAGAAGGACGGGAc 5'
              || | | | |||||||| 
Target 5' gacaCCTCATGTCCCTGCCCTc 3'
 28 - 49 158.00 -16.80
2 
miRNA  3' aacaggugaagaagGACGGGAc 5'
                        :|||||| 
Target 5' ctgtggggtggtggTTGCCCTa 3'
 88 - 109 124.00 -10.00
3 
miRNA  3' aacagGUGAAGAAG-----GACGGgac 5'
               | |||: ||     ||||:   
Target 5' ----gCTCTTTCTCAGAAGCTGCTaca 3'
 1 - 23 93.00 -6.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN28726153 5 COSMIC
COSN31553583 46 COSMIC
COSN7447841 50 COSMIC
COSN5761462 64 COSMIC
COSN31573789 147 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs753253708 2 dbSNP
rs756653688 3 dbSNP
rs1233846034 5 dbSNP
rs778921466 7 dbSNP
rs766395175 13 dbSNP
rs758241660 15 dbSNP
rs779789710 19 dbSNP
rs1446238373 22 dbSNP
rs748413916 23 dbSNP
rs1246368064 26 dbSNP
rs114037016 34 dbSNP
rs754470390 37 dbSNP
rs777908313 40 dbSNP
rs369487854 46 dbSNP
rs1311606624 47 dbSNP
rs1420940539 52 dbSNP
rs532189332 53 dbSNP
rs774954639 54 dbSNP
rs1332777091 64 dbSNP
rs759929754 68 dbSNP
rs1326029332 73 dbSNP
rs772614154 74 dbSNP
rs112953697 76 dbSNP
rs569057792 77 dbSNP
rs1403384741 80 dbSNP
rs1288457995 84 dbSNP
rs1288614832 87 dbSNP
rs1418758816 88 dbSNP
rs1004265041 90 dbSNP
rs1159997392 92 dbSNP
rs1367309355 96 dbSNP
rs1382573684 109 dbSNP
rs1015607484 121 dbSNP
rs963075486 127 dbSNP
rs1318971299 134 dbSNP
rs1215585553 141 dbSNP
rs1370135541 144 dbSNP
rs536338370 151 dbSNP
rs974095991 157 dbSNP
rs1231915546 158 dbSNP
rs949000704 159 dbSNP
rs367715574 162 dbSNP
rs1239007810 164 dbSNP
rs907367148 165 dbSNP
rs3745469 167 dbSNP
rs1358310179 168 dbSNP
rs1299662064 169 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aacaGGUGAAGAAGGACGGGAc 5'
              || |||| |  |||::| 
Target 5' ---cCCUCUUCGU-GUGCUUUu 3'
 		1 - 18
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000246784.3 | 3UTR | CCCUCUUCGUGUGCUUUUCCAAGUCUUCCUAUUCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
87 hsa-miR-4436b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT066957 ATXN7L3B ataxin 7 like 3B 2 8
MIRT119284 NABP1 nucleic acid binding protein 1 2 6
MIRT128915 KMT2A lysine methyltransferase 2A 2 2
MIRT150116 MIDN midnolin 2 2
MIRT173040 YTHDF3 YTH N6-methyladenosine RNA binding protein 3 2 2
MIRT253117 BCL2L12 BCL2 like 12 2 2
MIRT256997 RGMB repulsive guidance molecule family member b 2 2
MIRT259746 SNX12 sorting nexin 12 2 2
MIRT267278 TMEM109 transmembrane protein 109 2 2
MIRT441934 C1orf109 chromosome 1 open reading frame 109 2 2
MIRT443625 CPSF2 cleavage and polyadenylation specific factor 2 2 2
MIRT445757 AGO1 argonaute 1, RISC catalytic component 2 2
MIRT447835 CTIF cap binding complex dependent translation initiation factor 2 2
MIRT451230 ZNF444 zinc finger protein 444 2 2
MIRT451966 TMPRSS5 transmembrane protease, serine 5 2 2
MIRT453127 HOXC4 homeobox C4 2 2
MIRT454604 RPL13A ribosomal protein L13a 2 2
MIRT455176 SUV39H1 suppressor of variegation 3-9 homolog 1 2 2
MIRT455547 GJB1 gap junction protein beta 1 2 2
MIRT458197 ATP6V0A2 ATPase H+ transporting V0 subunit a2 2 2
MIRT458356 NOC2L NOC2 like nucleolar associated transcriptional repressor 2 2
MIRT458923 DNM2 dynamin 2 2 2
MIRT461013 SYT7 synaptotagmin 7 2 2
MIRT461643 ZSWIM4 zinc finger SWIM-type containing 4 2 2
MIRT461997 PACSIN1 protein kinase C and casein kinase substrate in neurons 1 2 2
MIRT462367 BCL7B BCL tumor suppressor 7B 2 2
MIRT464915 TXNIP thioredoxin interacting protein 2 2
MIRT466311 TIMM22 translocase of inner mitochondrial membrane 22 2 2
MIRT466591 TBC1D2B TBC1 domain family member 2B 2 2
MIRT467045 SRSF1 serine and arginine rich splicing factor 1 2 2
MIRT468750 SDC2 syndecan 2 2 2
MIRT468943 RPS24 ribosomal protein S24 2 2
MIRT469474 REEP5 receptor accessory protein 5 2 2
MIRT469913 PTRF caveolae associated protein 1 2 2
MIRT473325 MEX3A mex-3 RNA binding family member A 2 2
MIRT473643 MARK2 microtubule affinity regulating kinase 2 2 2
MIRT474064 LMNB2 lamin B2 2 2
MIRT474357 KMT2D lysine methyltransferase 2D 2 2
MIRT475394 ICMT isoprenylcysteine carboxyl methyltransferase 2 4
MIRT476335 GLTSCR1L BRD4 interacting chromatin remodeling complex associated protein like 2 2
MIRT478651 CTDNEP1 CTD nuclear envelope phosphatase 1 2 2
MIRT479585 CDC42SE1 CDC42 small effector 1 2 2
MIRT479943 CBX5 chromobox 5 2 2
MIRT482001 AMOTL2 angiomotin like 2 2 2
MIRT482043 AMER1 APC membrane recruitment protein 1 2 2
MIRT483070 EXT2 exostosin glycosyltransferase 2 2 6
MIRT484323 KCNH1 potassium voltage-gated channel subfamily H member 1 2 4
MIRT487528 GXYLT2 glucoside xylosyltransferase 2 2 2
MIRT489636 ALS2CL ALS2 C-terminal like 2 2
MIRT490693 SSTR1 somatostatin receptor 1 2 2
MIRT490871 UPK2 uroplakin 2 2 2
MIRT492582 PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L 2 2
MIRT492945 NEUROD2 neuronal differentiation 2 2 2
MIRT498675 SOD2 superoxide dismutase 2 2 4
MIRT499349 RAB25 RAB25, member RAS oncogene family 2 2
MIRT502338 GIGYF1 GRB10 interacting GYF protein 1 2 4
MIRT502976 CCNL1 cyclin L1 2 8
MIRT503706 NUP62 nucleoporin 62 2 2
MIRT505567 SMUG1 single-strand-selective monofunctional uracil-DNA glycosylase 1 2 2
MIRT507808 CDKN1B cyclin dependent kinase inhibitor 1B 2 2
MIRT513242 FBXO41 F-box protein 41 2 6
MIRT513586 EVX1 even-skipped homeobox 1 2 2
MIRT525036 FRK fyn related Src family tyrosine kinase 2 2
MIRT531035 TDGF1P3 teratocarcinoma-derived growth factor 1 pseudogene 3 2 2
MIRT531939 RBMS2 RNA binding motif single stranded interacting protein 2 2 2
MIRT534912 PUM2 pumilio RNA binding family member 2 2 2
MIRT535717 N4BP1 NEDD4 binding protein 1 2 2
MIRT540498 ZMAT4 zinc finger matrin-type 4 2 4
MIRT541465 AURKA aurora kinase A 2 2
MIRT554328 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 2
MIRT561572 SLC6A9 solute carrier family 6 member 9 2 2
MIRT564715 ZNF322P1 zinc finger protein 322 pseudogene 1 2 2
MIRT576176 Hmox1 heme oxygenase 1 2 2
MIRT629712 XKR4 XK related 4 2 2
MIRT636182 THBD thrombomodulin 2 2
MIRT646315 MPHOSPH8 M-phase phosphoprotein 8 2 2
MIRT649174 IQSEC1 IQ motif and Sec7 domain 1 2 2
MIRT666945 PMEPA1 prostate transmembrane protein, androgen induced 1 2 2
MIRT684057 FOLR1 folate receptor 1 2 2
MIRT687585 MAU2 MAU2 sister chromatid cohesion factor 2 2
MIRT689953 ZNF185 zinc finger protein 185 with LIM domain 2 2
MIRT704071 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT704327 DCUN1D5 defective in cullin neddylation 1 domain containing 5 2 2
MIRT705406 ATP1B3 ATPase Na+/K+ transporting subunit beta 3 2 2
MIRT710488 CDH5 cadherin 5 2 2
MIRT718241 LCE1A late cornified envelope 1A 2 2
MIRT723182 CDCA4 cell division cycle associated 4 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4436b-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-4436b-3p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission