>XRCC6|NM_001469|3'UTR
   1 CCAGAGGCCGCGCGTCCAGCTGCCCTTCCGCAGTGTGGCCAGGCTGCCTGGCCTTGTCCTCAGCCAGTTAAAATGTGTTT
  81 CTCCTGAGCTAGGAAGAGTCTACCCGACATAAGTCGAGGGACTTTATGTTTTTGAGGCTTTCTGTTGCCATGGTGATGGT
 161 GTAGCCCTCCCACTTTGCTGTTCCTTACTTTACTGCCTGAATAAAGAGCCCTAAGTTTGTACTATATACTGTTAAAAAAA
 241 AAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' aauucauuGUGGAA----GGACUUAu 5' :||:|| ||||||| Target 5' ctgttcctTACTTTACTGCCTGAATa 3'	178 - 203	148.00	-11.10
2	miRNA 3' aaUUCAUUGUGGA-----AGGACUUau 5' |: ||| |: | ||||||: Target 5' ccAGTTAAAATGTGTTTCTCCTGAGct 3'	64 - 90	116.00	-9.70
3	miRNA 3' aauuCAUUG--UGGAAGGACUuau 5' ||::| : || ||||: Target 5' cagtGTGGCCAGGCTGCCTGGcct 3'	31 - 54	96.00	-11.90

Mutant ID	Mutant Position	Mutant Source
COSN27005362	8	COSMIC
COSN5993004	12	COSMIC
COSN30500400	13	COSMIC
COSN31583987	15	COSMIC
COSN30109390	17	COSMIC
COSN30109371	18	COSMIC
COSN30450500	29	COSMIC
COSN30450495	30	COSMIC
COSN31604919	31	COSMIC
COSN30190507	33	COSMIC
COSN30512543	134	COSMIC
COSN30511297	199	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1425841031	6	dbSNP
rs28384786	10	dbSNP
rs372012239	11	dbSNP
rs547334988	12	dbSNP
rs551060392	13	dbSNP
rs759887906	14	dbSNP
rs376378849	15	dbSNP
rs1372393386	16	dbSNP
rs1446235281	17	dbSNP
rs776304269	18	dbSNP
rs1181658568	20	dbSNP
rs761339453	27	dbSNP
rs1232270473	29	dbSNP
rs764989290	30	dbSNP
rs9653842	31	dbSNP
rs762512379	33	dbSNP
rs766234760	34	dbSNP
rs751508425	35	dbSNP
rs55843518	36	dbSNP
rs759323088	42	dbSNP
rs920798038	42	dbSNP
rs780821385	49	dbSNP
rs1451995916	51	dbSNP
rs1158143478	63	dbSNP
rs559437035	67	dbSNP
rs1429559996	70	dbSNP
rs1285566122	85	dbSNP
rs950623698	88	dbSNP
rs1170321568	89	dbSNP
rs950942872	91	dbSNP
rs983770234	102	dbSNP
rs532921229	106	dbSNP
rs1455423827	109	dbSNP
rs963529698	110	dbSNP
rs1330208830	112	dbSNP
rs1352858848	116	dbSNP
rs974174228	117	dbSNP
rs544806676	123	dbSNP
rs1178290342	124	dbSNP
rs201363162	125	dbSNP
rs56092626	125	dbSNP
rs1324560308	127	dbSNP
rs1266610889	129	dbSNP
rs1235657332	133	dbSNP
rs866547858	139	dbSNP
rs559189965	144	dbSNP
rs986760702	149	dbSNP
rs1248100791	151	dbSNP
rs1344429259	154	dbSNP
rs563188813	156	dbSNP
rs1265431274	168	dbSNP
rs944347133	180	dbSNP
rs1234448690	188	dbSNP
rs1038698714	189	dbSNP
rs530704688	193	dbSNP
rs751329317	197	dbSNP
rs1384416255	207	dbSNP
rs1183016362	208	dbSNP
rs1362823858	211	dbSNP
rs113911488	213	dbSNP
rs934965157	216	dbSNP
rs1433225471	224	dbSNP
rs1337577337	225	dbSNP
rs1408619832	225	dbSNP
rs1275032620	227	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.