pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4677 |
Genomic Coordinates | chr1: 243346176 - 243346255 |
Description | Homo sapiens miR-4677 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4677-5p | |||||||||
Sequence | 13| UUGUUCUUUGGUCUUUCAGCCA |34 | |||||||||
Evidence | Experimental | |||||||||
Experiments | Illumina | DRVs in miRNA |
|
|||||||
SNPs in miRNA |
|
|||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | RPS24 | ||||||||||||||||||||
Synonyms | DBA3, S24 | ||||||||||||||||||||
Description | ribosomal protein S24 | ||||||||||||||||||||
Transcript | NM_001142285 | ||||||||||||||||||||
Other Transcripts | NM_001026 , NM_001142282 , NM_001142284 , NM_001142283 , NM_033022 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on RPS24 | |||||||||||||||||||||
3'UTR of RPS24 (miRNA target sites are highlighted) |
>RPS24|NM_001142285|3'UTR 1 TGTCACTGCCATGGCCGCCTTGCTGCATTTCTGAGGATGCTTCATCTCTCCACCTTCTTCTCCACTCAGCAGCCAGCAGG 81 GCACTGTGGAAATCGGAGTCACATGAGCTGGCACCTCTGTTCAGAACCCTCCAGGGCTCCACATCTCTCTCACCCAAATG 161 CCAAAGACCTCCCCACGCCCCCACAATCCCCCACGACCTGGCCACTGGCCTCCCACCACCTTCCAGCTCCAGCGGCTCCT 241 ACCACATTTAAGGCTTTCCTTCCTAGTTTTAATTTTTCCTCGTCAGCAGTTGATTTTATTATTTTCTTGTTTATTGGTAT 321 TTTCCCACTAGAAATGAAGCTGCGTGAAGTTAGAGATTTTTTTTTTTGGTCTGTGTTCCTAATTAGCTCATTGCTATACC 401 CCTGGCGCCCAGAACAATGCCTTGGACACAGTACGCAGTAGACTAAATAAATACTTGTTGAATGACTGACTGACGGAATG 481 ACGGCTGTGTGGGGAGTGGATTGGGTCGTGAGGCAGAGGCTGCGGTGGAAACTCAGGCAGGAGGTGATGGTGGTTCTTGG 561 GGCTGCGGAATGCCAAGTTTAGAAGCTCTTCCTCTGCTGTGGCACATGAACCGGTCACTCGAGAAGGCTTTTAGATTTAC 641 TTTGCCTAATCCCCTCTTAGTGCATGTGGGGAAACTGAGGTACACAAAAGGAATTCCCCACCAAGTTAGGGGCAGAACCT 721 AGCCCCCTTGTCTCCCAGATGGATATCTTCTTTTTTTTTTGAGACGGAGTCTTGCTCTGTTGCCCAGGCTGGAGTGCAGT 801 GGTACCATCTTGGCTCACTGCAACCTCTGCTTCCCAGGTTCAAGCGATTCTCCTGCCTCAGCCTCCTGAGTGTCTGCGAT 881 TACAGGTGCACACAACCACGCCTGGCTAATTTTTGTATTTTTAGTAGAGACGGGGTTTCACCGTGTTGGTCAGGGTGACC 961 TCAAACTCCTGACCTCATGATCCACCCAGCTCAGCCTCCCAACGTGCTGGGATTACAGGCATGAGCCACCGTGCCTGGCT 1041 GGACATCTTGTTATTAAAGCTTCTTCTCTCTTTGTAGGGGAGGGGGAGATGCCTCTGGTGGAGAAGACCAGTGTGGCAGT 1121 GACTGTGTCTGTTAGTGAACCTGGTGGCTGGTTGAGGGTCTGTCGTGGTGACTGAGGACACATACAAAGTGCTTTTCTCA 1201 GTGGTCACCTTGGTGTTGGTGAATAAGGGTCAGAAGATGGCTCCTGTCCTAGGGCACTGCCAGTCGGTTTGGAAGCTGAA 1281 ATGCCTGCTTAGCAGTTTGAGGAAACACAGACCTTGGAGGATCTTCTGGTTGCCTCTTCAAGAATTCATTCTATTCCCCT 1361 TCTGCTCCCCAAATTTGCTTTTCTTGGGGTGGGTCTTGGTTGGCCTAAGCCAAGAAAGTATGGCATCTACTCCTTCCATA 1441 GCAATAGCTCAGGAATAGGCAGTGACCCAGACCTGAACCAATCAGTGCATGGAATTACCCCTGGCCAAAGTGGTTGATTG 1521 AGGCTGGGTGCAAGCAGAGTTGTGAGAAGGCTCCCATTTGGTGGTTGGAGAGATCGCACTTGCTCCAGAGGTCATAATGT 1601 GCAGATCTGAGGCTTGGAACTGCTGCAGACATTTTGCTACCACAAGTGAAGCCACCCTGACGACACAGTTGACAATTTGG 1681 AGCAGGGCAGAGCTGAGAGAACAGCAGGGAAACAGCCAGAGTCTTGCTCAAGCCTCCCTGAAGTATCTATACCCCTGGAC 1761 TCTAGTTATGGGGGCTAATAAATGTTATATACTGTTTAAGGTAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Hela |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control
... - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell. |
Article |
- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al. - Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | Prostate Tissue | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760639. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_A
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
CLIP-seq Support 1 for dataset GSM1048187 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | Hela / Hela_AGO2_CLIP_control |
Location of target site | ENST00000435275.1 | 3UTR | GGAGAUUGGAUCACAGccgaaggaguaaAGGUGCUGCAAUGAUGUUAGCUGUGGCCACUGUGGAUUUUUCGCAAGA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23313552 / GSE42701 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
84 hsa-miR-4677-5p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT080553 | PMAIP1 | phorbol-12-myristate-13-acetate-induced protein 1 | 2 | 2 | ||||||||
MIRT089446 | STAMBP | STAM binding protein | 2 | 2 | ||||||||
MIRT135057 | ADSS | adenylosuccinate synthase | 2 | 4 | ||||||||
MIRT263519 | RPS24 | ribosomal protein S24 | 2 | 2 | ||||||||
MIRT357966 | GRPEL2 | GrpE like 2, mitochondrial | 2 | 2 | ||||||||
MIRT384298 | GOLT1B | golgi transport 1B | 2 | 2 | ||||||||
MIRT407003 | CEBPB | CCAAT/enhancer binding protein beta | 2 | 2 | ||||||||
MIRT442312 | UBE2Q1 | ubiquitin conjugating enzyme E2 Q1 | 2 | 2 | ||||||||
MIRT443782 | ST13 | ST13, Hsp70 interacting protein | 2 | 2 | ||||||||
MIRT446864 | NBPF3 | NBPF member 3 | 2 | 2 | ||||||||
MIRT447642 | RAB3GAP1 | RAB3 GTPase activating protein catalytic subunit 1 | 2 | 2 | ||||||||
MIRT448464 | SLC45A4 | solute carrier family 45 member 4 | 2 | 2 | ||||||||
MIRT449117 | XRRA1 | X-ray radiation resistance associated 1 | 2 | 2 | ||||||||
MIRT450240 | TRIM66 | tripartite motif containing 66 | 2 | 2 | ||||||||
MIRT450265 | F2RL2 | coagulation factor II thrombin receptor like 2 | 2 | 2 | ||||||||
MIRT450682 | RPN2 | ribophorin II | 2 | 2 | ||||||||
MIRT465594 | TNRC6A | trinucleotide repeat containing 6A | 2 | 2 | ||||||||
MIRT481118 | AZIN1 | antizyme inhibitor 1 | 2 | 4 | ||||||||
MIRT497203 | CDH7 | cadherin 7 | 2 | 4 | ||||||||
MIRT502954 | CCNT2 | cyclin T2 | 2 | 2 | ||||||||
MIRT506337 | NUP54 | nucleoporin 54 | 2 | 4 | ||||||||
MIRT509224 | KIF14 | kinesin family member 14 | 2 | 6 | ||||||||
MIRT514595 | NDUFA12 | NADH:ubiquinone oxidoreductase subunit A12 | 2 | 4 | ||||||||
MIRT515392 | ARHGAP21 | Rho GTPase activating protein 21 | 2 | 4 | ||||||||
MIRT525555 | MTRNR2L7 | MT-RNR2-like 7 | 2 | 6 | ||||||||
MIRT525604 | MTRNR2L3 | MT-RNR2-like 3 | 2 | 4 | ||||||||
MIRT533249 | VCAM1 | vascular cell adhesion molecule 1 | 2 | 2 | ||||||||
MIRT535778 | MTRNR2L11 | MT-RNR2-like 11 | 2 | 6 | ||||||||
MIRT535799 | MTRNR2L10 | MT-RNR2-like 10 | 2 | 4 | ||||||||
MIRT552784 | YAF2 | YY1 associated factor 2 | 2 | 2 | ||||||||
MIRT556213 | MB21D2 | Mab-21 domain containing 2 | 2 | 2 | ||||||||
MIRT558192 | EIF2S1 | eukaryotic translation initiation factor 2 subunit alpha | 2 | 4 | ||||||||
MIRT565809 | SDCCAG3 | serologically defined colon cancer antigen 3 | 2 | 2 | ||||||||
MIRT566341 | POLDIP2 | DNA polymerase delta interacting protein 2 | 2 | 2 | ||||||||
MIRT567792 | DEK | DEK proto-oncogene | 2 | 2 | ||||||||
MIRT572455 | ZNF516 | zinc finger protein 516 | 2 | 2 | ||||||||
MIRT572582 | HGFAC | HGF activator | 2 | 2 | ||||||||
MIRT573357 | PDE3A | phosphodiesterase 3A | 2 | 2 | ||||||||
MIRT574649 | LMAN2 | lectin, mannose binding 2 | 2 | 2 | ||||||||
MIRT608164 | ERBB2 | erb-b2 receptor tyrosine kinase 2 | 2 | 2 | ||||||||
MIRT610690 | FAM89A | family with sequence similarity 89 member A | 2 | 2 | ||||||||
MIRT618457 | TMCO1 | transmembrane and coiled-coil domains 1 | 2 | 2 | ||||||||
MIRT621924 | SYAP1 | synapse associated protein 1 | 2 | 4 | ||||||||
MIRT622279 | SH3TC2 | SH3 domain and tetratricopeptide repeats 2 | 2 | 2 | ||||||||
MIRT624610 | B3GALT5 | beta-1,3-galactosyltransferase 5 | 2 | 2 | ||||||||
MIRT631040 | TAS2R30 | taste 2 receptor member 30 | 2 | 2 | ||||||||
MIRT636153 | TRPS1 | transcriptional repressor GATA binding 1 | 2 | 2 | ||||||||
MIRT638255 | SIX1 | SIX homeobox 1 | 2 | 2 | ||||||||
MIRT638330 | RCAN1 | regulator of calcineurin 1 | 2 | 2 | ||||||||
MIRT641621 | KIAA1244 | ARFGEF family member 3 | 3 | 3 | ||||||||
MIRT644556 | SPOP | speckle type BTB/POZ protein | 2 | 2 | ||||||||
MIRT645900 | LRIF1 | ligand dependent nuclear receptor interacting factor 1 | 2 | 2 | ||||||||
MIRT649115 | SRD5A1 | steroid 5 alpha-reductase 1 | 2 | 2 | ||||||||
MIRT652244 | TPI1 | triosephosphate isomerase 1 | 2 | 2 | ||||||||
MIRT657249 | ICOSLG | inducible T-cell costimulator ligand | 2 | 2 | ||||||||
MIRT659857 | CAPRIN1 | cell cycle associated protein 1 | 2 | 4 | ||||||||
MIRT665369 | XIAP | X-linked inhibitor of apoptosis | 2 | 2 | ||||||||
MIRT669214 | CAND1 | cullin associated and neddylation dissociated 1 | 2 | 2 | ||||||||
MIRT682579 | CPA4 | carboxypeptidase A4 | 2 | 2 | ||||||||
MIRT698725 | STX6 | syntaxin 6 | 2 | 4 | ||||||||
MIRT699788 | SEC24A | SEC24 homolog A, COPII coat complex component | 2 | 2 | ||||||||
MIRT700290 | RABGEF1 | RAB guanine nucleotide exchange factor 1 | 2 | 2 | ||||||||
MIRT710374 | LMBR1 | limb development membrane protein 1 | 2 | 2 | ||||||||
MIRT710407 | YTHDC1 | YTH domain containing 1 | 2 | 2 | ||||||||
MIRT710569 | TNPO1 | transportin 1 | 2 | 2 | ||||||||
MIRT711384 | PLEKHG4B | pleckstrin homology and RhoGEF domain containing G4B | 2 | 2 | ||||||||
MIRT712042 | STYK1 | serine/threonine/tyrosine kinase 1 | 2 | 2 | ||||||||
MIRT712717 | NCAPG2 | non-SMC condensin II complex subunit G2 | 2 | 2 | ||||||||
MIRT713288 | ADAMTS20 | ADAM metallopeptidase with thrombospondin type 1 motif 20 | 2 | 2 | ||||||||
MIRT715649 | USP6NL | USP6 N-terminal like | 2 | 2 | ||||||||
MIRT716167 | FAM71F2 | family with sequence similarity 71 member F2 | 2 | 2 | ||||||||
MIRT716756 | TRABD2A | TraB domain containing 2A | 2 | 2 | ||||||||
MIRT718209 | TNRC6C | trinucleotide repeat containing 6C | 2 | 2 | ||||||||
MIRT718361 | SOX1 | SRY-box 1 | 2 | 2 | ||||||||
MIRT718806 | SLC25A33 | solute carrier family 25 member 33 | 2 | 2 | ||||||||
MIRT719339 | VGLL4 | vestigial like family member 4 | 2 | 2 | ||||||||
MIRT719671 | SPDYE1 | speedy/RINGO cell cycle regulator family member E1 | 2 | 2 | ||||||||
MIRT720827 | C1orf52 | chromosome 1 open reading frame 52 | 2 | 2 | ||||||||
MIRT722184 | DNAJC9 | DnaJ heat shock protein family (Hsp40) member C9 | 2 | 2 | ||||||||
MIRT722398 | BCAS2 | BCAS2, pre-mRNA processing factor | 2 | 2 | ||||||||
MIRT723460 | ST8SIA3 | ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 | 2 | 2 | ||||||||
MIRT724072 | NCKAP1L | NCK associated protein 1 like | 2 | 2 | ||||||||
MIRT724594 | AP3B1 | adaptor related protein complex 3 beta 1 subunit | 2 | 2 | ||||||||
MIRT725234 | PDE1B | phosphodiesterase 1B | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|