miRTarBase - #MIRT265634


—
pre-miRNA Information
pre-miRNA hsa-mir-4524b   
Genomic Coordinates chr17: 69099542 - 69099656
Description Homo sapiens miR-4524b stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4524b-3p
Sequence 66| GAGACAGGUUCAUGCUGCUA |85
Evidence Experimental
Experiments SOLiD
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1263495678 1 dbSNP
rs1350790266 9 dbSNP
rs1322445998 14 dbSNP
Putative Targets

Gene Information
Gene Symbol LDHA   
Synonyms GSD11, HEL-S-133P, LDHM, PIG19
Description lactate dehydrogenase A
Transcript NM_001165416   
Other Transcripts NM_001165414 , NM_001165415 , NM_001135239 , NM_005566   
Expression
Putative miRNA Targets on LDHA
3'UTR of LDHA
(miRNA target sites are highlighted)		 
>LDHA|NM_001165416|3'UTR
   1 AGGATGATGTCTTCCTTAGTGTTCCTTGCATTTTGGGACAGAATGGAATCTCAGACCTTGTGAAGGTGACTCTGACTTCT
  81 GAGGAAGAGGCCCGTTTGAAGAAGAGTGCAGATACACTTTGGGGGATCCAAAAGGAGCTGCAATTTTAAAGTCTTCTGAT
 161 GTCATATCATTTCACTGTCTAGGCTACAACAGGATTCTAGGTGGAGGTTGTGCATGTTGTCCTTTTTATCTGATCTGTGA
 241 TTAAAGCAGTAATATTTTAAGATGGACTGGGAAAAACATCAACTCCTGAAGTTAGAAATAAGAATGGTTTGTAAAATCCA
 321 CAGCTATATCCTGATGCTGGATGGTATTAATCTTGTGTAGTCTTCAACTGGTTAGTGTGAAATAGTTCTGCCACCTCTGA
 401 CGCACCACTGCCAATGCTGTACGTACTGCATTTGCCCCTTGAGCCAGGTGGATGTTTACCGTGTGTTATATAACTTCCTG
 481 GCTCCTTCACTGAACATGCCTAGTCCAACATTTTTTCCCAGTGAGTCACATCCTGGGATCCAGTGTATAAATCCAATATC
 561 ATGTCTTGTGCATAATTCTTCCAAAGGATCTTATTTTGTGAACTATATCAGTAGTGTACATTACCATATAATGTAAAAAG
 641 ATCTACATACAAACAATGCAACCAACTATCCAAGTGTTATACCAACTAAAACCCCCAATAAACCTTGAACAGTGACTACT
 721 TTGGTTAATTCATTATATTAAGATATAAAGTCATAAAGCTGCTAGTTATTATATTAATTTGGAAATATTAGGCTATTCTT
 801 GGGCAACCCTGCAACGATTTTTTCTAACAGGGATATTATTGACTAATAGCAGAGGATGTAATAGTCAACTGAGTTGTATT
 881 GGTACCACTTCCATTGTAAGTCCCAAAGTATTATATATTTGATAATAATGCTAATCATAATTGGAAAGTAACATTCTATA
 961 TGTAAATGTAAAATTTATTTGCCAACTGAATATAGGCAATGATAGTGTGTCACTATAGGGAACACAGATTTTTGAGATCT
1041 TGTCCTCTGGAAGCTGGTAACAATTAAAAACAATCTTAAGGCAGGGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aucgucguacuugGACAGAg 5'
                       |||||| 
Target 5' tcatatcatttcaCTGTCTa 3'
 162 - 181 120.00 -9.00
2 
miRNA  3' aucgucGUACUUGGACAGAg 5'
                ||  | | ||||| 
Target 5' taaatcCAATATCATGTCTt 3'
 548 - 567 114.00 -5.80
3 
miRNA  3' aucgucguaCUUGGACAGag 5'
                   || |:||||  
Target 5' gatttttgaGATCTTGTCct 3'
 1027 - 1046 111.00 -6.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1006351 95 ClinVar
303917 102 ClinVar
426816 109 ClinVar
1006226 126 ClinVar
877892 135 ClinVar
14567 136 ClinVar
391029 165 ClinVar
878056 168 ClinVar
878057 198 ClinVar
878058 202 ClinVar
380934 239 ClinVar
878059 279 ClinVar
303918 325 ClinVar
878060 378 ClinVar
303919 393 ClinVar
303920 403 ClinVar
303921 461 ClinVar
879519 462 ClinVar
303922 651 ClinVar
303923 732 ClinVar
303924 736 ClinVar
879520 754 ClinVar
303925 772 ClinVar
303926 789 ClinVar
303927 810 ClinVar
879886 816 ClinVar
879887 844 ClinVar
303928 856 ClinVar
303929 870 ClinVar
303930 875 ClinVar
303931 895 ClinVar
877949 912 ClinVar
303932 967 ClinVar
303933 985 ClinVar
877950 1064 ClinVar
COSM7984811 25 COSMIC
COSM2155071 40 COSMIC
COSM8220518 42 COSMIC
COSM6487968 49 COSMIC
COSM4974663 55 COSMIC
COSM4031909 69 COSMIC
COSM6337106 79 COSMIC
COSM3808925 82 COSMIC
COSM925635 95 COSMIC
COSM9160208 102 COSMIC
COSM6998033 108 COSMIC
COSM7737818 112 COSMIC
COSM6336526 135 COSMIC
COSM1627904 160 COSMIC
COSM9295480 169 COSMIC
COSM8317792 185 COSMIC
COSM925637 198 COSMIC
COSM7287013 233 COSMIC
COSM8193095 238 COSMIC
COSM8945181 239 COSMIC
COSN31556369 253 COSMIC
COSN26646569 284 COSMIC
COSN13315175 296 COSMIC
COSN26646059 302 COSMIC
COSN8863310 325 COSMIC
COSN31576582 353 COSMIC
COSN28807317 393 COSMIC
COSN31485182 398 COSMIC
COSN31611890 418 COSMIC
COSN31489645 437 COSMIC
COSN31602956 461 COSMIC
COSN26671778 464 COSMIC
COSN30157847 504 COSMIC
COSN31551558 517 COSMIC
COSN4896914 1105 COSMIC
COSN25033613 1205 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs147520495 5 dbSNP
rs781123152 12 dbSNP
rs752750333 16 dbSNP
rs1351386042 28 dbSNP
rs1180818057 30 dbSNP
rs1456601311 33 dbSNP
rs1257600663 38 dbSNP
rs776605053 39 dbSNP
rs201721233 43 dbSNP
rs777517739 58 dbSNP
rs748856517 61 dbSNP
rs753349051 68 dbSNP
rs368105451 70 dbSNP
rs778574836 84 dbSNP
rs1314357532 93 dbSNP
rs200093825 94 dbSNP
rs140090654 95 dbSNP
rs961008215 97 dbSNP
rs775823378 101 dbSNP
rs145889467 102 dbSNP
rs12790695 105 dbSNP
rs1085307812 109 dbSNP
rs200019907 112 dbSNP
rs200908475 113 dbSNP
rs776953904 115 dbSNP
rs761982670 116 dbSNP
rs765211774 117 dbSNP
rs756045998 118 dbSNP
rs1366763139 123 dbSNP
rs1375711742 124 dbSNP
rs201842179 125 dbSNP
rs121912479 136 dbSNP
rs558872434 141 dbSNP
rs763264028 142 dbSNP
rs766641807 144 dbSNP
rs1463808788 148 dbSNP
rs1323734449 152 dbSNP
rs752558359 154 dbSNP
rs1400832360 160 dbSNP
rs1448523064 163 dbSNP
rs780014361 164 dbSNP
rs200383424 165 dbSNP
rs777800299 166 dbSNP
rs749248612 170 dbSNP
rs753690566 175 dbSNP
rs756838417 178 dbSNP
rs1257817708 180 dbSNP
rs1458525448 186 dbSNP
rs377516196 191 dbSNP
rs768402299 200 dbSNP
rs778685360 206 dbSNP
rs577114710 207 dbSNP
rs771712815 208 dbSNP
rs1437828889 220 dbSNP
rs747740938 223 dbSNP
rs946581513 223 dbSNP
rs779623625 227 dbSNP
rs1199785484 231 dbSNP
rs200810272 234 dbSNP
rs138352370 236 dbSNP
rs562694907 238 dbSNP
rs200441639 239 dbSNP
rs770066988 241 dbSNP
rs1396038279 248 dbSNP
rs201713804 251 dbSNP
rs199526012 252 dbSNP
rs1288007465 253 dbSNP
rs1337848828 253 dbSNP
rs1398660568 254 dbSNP
rs200389286 256 dbSNP
rs201359330 264 dbSNP
rs1009275105 265 dbSNP
rs771684587 272 dbSNP
rs1254420107 273 dbSNP
rs763068850 274 dbSNP
rs199722017 279 dbSNP
rs574899342 280 dbSNP
rs1234935573 281 dbSNP
rs200833510 286 dbSNP
rs1321971504 289 dbSNP
rs750464017 302 dbSNP
rs900538425 319 dbSNP
rs1487370116 320 dbSNP
rs1159427443 322 dbSNP
rs772778240 322 dbSNP
rs886048089 325 dbSNP
rs774677714 327 dbSNP
rs1478656534 334 dbSNP
rs1196486136 338 dbSNP
rs1376658620 341 dbSNP
rs11553862 342 dbSNP
rs928802169 342 dbSNP
rs1407319204 345 dbSNP
rs1173417810 347 dbSNP
rs1479128469 348 dbSNP
rs1375781172 353 dbSNP
rs1466219296 358 dbSNP
rs1197927165 365 dbSNP
rs778945997 368 dbSNP
rs201661015 371 dbSNP
rs1358049701 375 dbSNP
rs1418587825 376 dbSNP
rs1298084537 377 dbSNP
rs1341687956 378 dbSNP
rs1028348627 382 dbSNP
rs952160174 383 dbSNP
rs1005072842 386 dbSNP
rs1384221214 389 dbSNP
rs76818137 393 dbSNP
rs763771927 396 dbSNP
rs961123148 398 dbSNP
rs1383463724 399 dbSNP
rs1055876153 402 dbSNP
rs758268446 403 dbSNP
rs200774396 405 dbSNP
rs1286565012 409 dbSNP
rs560554983 411 dbSNP
rs1489237398 412 dbSNP
rs765088560 413 dbSNP
rs1266403734 417 dbSNP
rs1433609075 418 dbSNP
rs527511756 422 dbSNP
rs202048658 423 dbSNP
rs200172020 424 dbSNP
rs1223307426 426 dbSNP
rs1158735675 427 dbSNP
rs1269680707 428 dbSNP
rs1341462265 433 dbSNP
rs200772587 438 dbSNP
rs1455797029 449 dbSNP
rs1292337003 452 dbSNP
rs1344757761 453 dbSNP
rs1390442074 454 dbSNP
rs1334911806 455 dbSNP
rs1416191139 457 dbSNP
rs201495225 460 dbSNP
rs200079157 461 dbSNP
rs200982215 462 dbSNP
rs779816426 468 dbSNP
rs1305854018 469 dbSNP
rs1475034551 470 dbSNP
rs201933139 471 dbSNP
rs200397839 472 dbSNP
rs963902168 475 dbSNP
rs1440157601 476 dbSNP
rs746544029 477 dbSNP
rs1318882068 484 dbSNP
rs1418631695 497 dbSNP
rs997048353 498 dbSNP
rs201101330 501 dbSNP
rs1260395304 506 dbSNP
rs1217402316 511 dbSNP
rs1488661304 515 dbSNP
rs14790 518 dbSNP
rs1215337566 524 dbSNP
rs1414509898 526 dbSNP
rs202218269 529 dbSNP
rs1450334426 530 dbSNP
rs531589202 538 dbSNP
rs1467990582 541 dbSNP
rs1457029423 546 dbSNP
rs1336379555 551 dbSNP
rs915174269 557 dbSNP
rs1175454189 565 dbSNP
rs1381588024 566 dbSNP
rs14789 572 dbSNP
rs549767576 579 dbSNP
rs1032177946 581 dbSNP
rs1421600218 588 dbSNP
rs1163235721 589 dbSNP
rs957750587 591 dbSNP
rs1414486175 594 dbSNP
rs1368431820 603 dbSNP
rs200436948 604 dbSNP
rs201297054 606 dbSNP
rs1328364047 608 dbSNP
rs1398634329 610 dbSNP
rs199655216 616 dbSNP
rs1178937061 620 dbSNP
rs748478809 621 dbSNP
rs1235919881 625 dbSNP
rs1375561407 626 dbSNP
rs977899013 628 dbSNP
rs567926833 629 dbSNP
rs200335252 634 dbSNP
rs201742561 637 dbSNP
rs1322269085 638 dbSNP
rs1235118658 641 dbSNP
rs1255909699 644 dbSNP
rs1457181879 646 dbSNP
rs1236225719 648 dbSNP
rs886048090 651 dbSNP
rs199522034 657 dbSNP
rs1481968210 658 dbSNP
rs1180780916 660 dbSNP
rs1256002964 662 dbSNP
rs1314462894 666 dbSNP
rs1391503322 669 dbSNP
rs1447531620 670 dbSNP
rs944804514 672 dbSNP
rs772267121 673 dbSNP
rs200727123 679 dbSNP
rs201419761 681 dbSNP
rs199757663 683 dbSNP
rs981715541 685 dbSNP
rs1350228797 686 dbSNP
rs1040881631 689 dbSNP
rs1403530219 692 dbSNP
rs773810823 693 dbSNP
rs1384134723 696 dbSNP
rs1221995773 699 dbSNP
rs200718851 704 dbSNP
rs776728029 706 dbSNP
rs1356496655 711 dbSNP
rs1049318520 712 dbSNP
rs1445837280 726 dbSNP
rs144317385 732 dbSNP
rs886048091 736 dbSNP
rs1005019034 737 dbSNP
rs1212835293 738 dbSNP
rs199957616 741 dbSNP
rs774686615 747 dbSNP
rs1276278950 748 dbSNP
rs759661874 751 dbSNP
rs148774730 754 dbSNP
rs1274599709 756 dbSNP
rs773828138 758 dbSNP
rs143493256 759 dbSNP
rs1307409209 765 dbSNP
rs3758681 772 dbSNP
rs959041727 777 dbSNP
rs1486390298 787 dbSNP
rs3758682 789 dbSNP
rs1022131191 794 dbSNP
rs1261695564 799 dbSNP
rs1477661225 803 dbSNP
rs1187483896 808 dbSNP
rs1422164120 809 dbSNP
rs765180823 810 dbSNP
rs978014841 813 dbSNP
rs750319408 815 dbSNP
rs923756666 816 dbSNP
rs1436689094 817 dbSNP
rs1421011198 818 dbSNP
rs957884983 818 dbSNP
rs1339769202 819 dbSNP
rs1157975658 820 dbSNP
rs1400323708 829 dbSNP
rs1433409344 829 dbSNP
rs1271702857 833 dbSNP
rs1365311547 834 dbSNP
rs1009303106 836 dbSNP
rs570815637 842 dbSNP
rs1479636754 844 dbSNP
rs1218246988 846 dbSNP
rs1278954062 848 dbSNP
rs1349367665 855 dbSNP
rs757942016 856 dbSNP
rs1284428858 863 dbSNP
rs3758683 870 dbSNP
rs976161945 871 dbSNP
rs753218262 875 dbSNP
rs1244160282 878 dbSNP
rs982151470 883 dbSNP
rs556537577 891 dbSNP
rs931961766 894 dbSNP
rs867222703 895 dbSNP
rs763799905 906 dbSNP
rs59010595 909 dbSNP
rs796339494 909 dbSNP
rs1303435781 911 dbSNP
rs189063205 912 dbSNP
rs879282175 915 dbSNP
rs1360046970 916 dbSNP
rs920083001 924 dbSNP
rs1320255551 925 dbSNP
rs1401738446 926 dbSNP
rs1347881466 930 dbSNP
rs780840340 931 dbSNP
rs1275007575 933 dbSNP
rs1358154651 933 dbSNP
rs1372741076 934 dbSNP
rs1466042633 938 dbSNP
rs1237580094 949 dbSNP
rs1360567022 951 dbSNP
rs1173453743 956 dbSNP
rs940919032 959 dbSNP
rs748483881 964 dbSNP
rs1353843095 965 dbSNP
rs527401531 967 dbSNP
rs1286977062 973 dbSNP
rs1195116448 975 dbSNP
rs1294001953 976 dbSNP
rs886048092 985 dbSNP
rs764635575 989 dbSNP
rs1253804486 993 dbSNP
rs1229143919 1004 dbSNP
rs1469985284 1005 dbSNP
rs1186010540 1006 dbSNP
rs1177080864 1008 dbSNP
rs1276857220 1010 dbSNP
rs542186612 1014 dbSNP
rs1379737388 1016 dbSNP
rs907357362 1017 dbSNP
rs1160178759 1019 dbSNP
rs1322604240 1022 dbSNP
rs1003466400 1036 dbSNP
rs1411540398 1043 dbSNP
rs1221995151 1044 dbSNP
rs1404487221 1046 dbSNP
rs1034752873 1048 dbSNP
rs908597180 1055 dbSNP
rs944137119 1057 dbSNP
rs147174554 1064 dbSNP
rs1041419995 1068 dbSNP
rs1330319633 1071 dbSNP
rs778468175 1074 dbSNP
rs566458890 1076 dbSNP
rs1240595407 1077 dbSNP
rs1281719651 1078 dbSNP
rs899843097 1081 dbSNP
rs1405882118 1084 dbSNP
rs1228313886 1087 dbSNP
rs1171845935 1089 dbSNP
rs533734216 1090 dbSNP
rs1337459364 1092 dbSNP
rs1011835216 1093 dbSNP
rs1237824182 1094 dbSNP
rs1438428321 1095 dbSNP
rs1184092971 1096 dbSNP
rs1021910654 1097 dbSNP
rs1170302594 1099 dbSNP
rs1472422888 1101 dbSNP
rs967709499 1102 dbSNP
rs977964028 1105 dbSNP
rs1463886519 1111 dbSNP
rs771190916 1112 dbSNP
rs1396770432 1115 dbSNP
rs1200339144 1121 dbSNP
rs1337145615 1123 dbSNP
rs1392570196 1125 dbSNP
rs1250734519 1126 dbSNP
rs1331611306 1127 dbSNP
rs1339439000 1128 dbSNP
rs1245383482 1129 dbSNP
rs1414675146 1132 dbSNP
rs1294493821 1136 dbSNP
rs1312262032 1142 dbSNP
rs965880928 1158 dbSNP
rs1332909973 1166 dbSNP
rs1393525681 1178 dbSNP
rs1158098547 1187 dbSNP
rs1009437495 1198 dbSNP
rs1020808895 1198 dbSNP
rs1298146045 1198 dbSNP
rs368761893 1201 dbSNP
rs538903350 1201 dbSNP
rs572530918 1201 dbSNP
rs777910482 1202 dbSNP
rs1003314029 1203 dbSNP
rs1246476600 1206 dbSNP
rs1180718237 1211 dbSNP
rs1435903114 1211 dbSNP
rs922004893 1212 dbSNP
rs1210419249 1213 dbSNP
rs1244641413 1217 dbSNP
rs1289420480 1217 dbSNP
rs193282587 1217 dbSNP
rs1353741920 1223 dbSNP
rs1311064910 1225 dbSNP
rs758200347 1228 dbSNP
rs184854190 1233 dbSNP
rs909194847 1241 dbSNP
rs1387651798 1251 dbSNP
rs1027225344 1261 dbSNP
rs4757653 1262 dbSNP
rs982873141 1264 dbSNP
rs1036588178 1265 dbSNP
rs745344957 1265 dbSNP
rs543384332 1266 dbSNP
rs1357597587 1270 dbSNP
rs938826703 1272 dbSNP
rs1432932725 1278 dbSNP
rs1199309278 1280 dbSNP
rs1434645889 1285 dbSNP
rs1266715288 1289 dbSNP
rs781443075 1290 dbSNP
rs760036461 1291 dbSNP
rs561993066 1292 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aucgucguacuugGACAGAg 5'
                       |||||| 
Target 5' ucauaucauuucaCUGUCUa 3'
 		1 - 20
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000227157.4 | 3UTR | ucauaucauuucacugucuag
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
175 hsa-miR-4524b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT064889 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT075345 SF3B3 splicing factor 3b subunit 3 2 2
MIRT094174 PCGF3 polycomb group ring finger 3 2 6
MIRT100109 ABT1 activator of basal transcription 1 2 8
MIRT102242 HBP1 HMG-box transcription factor 1 2 2
MIRT124918 HCCS holocytochrome c synthase 2 2
MIRT140195 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT193891 HACD3 3-hydroxyacyl-CoA dehydratase 3 2 2
MIRT265634 LDHA lactate dehydrogenase A 2 2
MIRT303878 VAMP8 vesicle associated membrane protein 8 2 2
MIRT409756 CRTAP cartilage associated protein 2 4
MIRT441503 SPG20 spartin 2 6
MIRT446882 ZNF554 zinc finger protein 554 2 2
MIRT447093 COPRS coordinator of PRMT5 and differentiation stimulator 2 2
MIRT449987 AEN apoptosis enhancing nuclease 2 2
MIRT452116 IFITM1 interferon induced transmembrane protein 1 2 2
MIRT452654 ZNF33A zinc finger protein 33A 2 2
MIRT453886 IFRD1 interferon related developmental regulator 1 2 12
MIRT454143 FOXRED2 FAD dependent oxidoreductase domain containing 2 2 2
MIRT454501 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 2
MIRT456633 ARMCX6 armadillo repeat containing, X-linked 6 2 2
MIRT457021 ACADSB acyl-CoA dehydrogenase, short/branched chain 2 2
MIRT457055 NEGR1 neuronal growth regulator 1 2 2
MIRT457335 REG4 regenerating family member 4 2 2
MIRT457421 CASC5 kinetochore scaffold 1 2 2
MIRT457940 LCE1A late cornified envelope 1A 2 2
MIRT458486 RMI1 RecQ mediated genome instability 1 2 10
MIRT458662 PAGR1 PAXIP1 associated glutamate rich protein 1 2 12
MIRT459784 IDH3A isocitrate dehydrogenase 3 (NAD(+)) alpha 2 2
MIRT459864 SVOP SV2 related protein 2 2
MIRT460575 FEM1A fem-1 homolog A 2 2
MIRT460987 STK17B serine/threonine kinase 17b 2 2
MIRT462315 TMEM109 transmembrane protein 109 2 2
MIRT464407 URM1 ubiquitin related modifier 1 2 2
MIRT465148 TSC22D2 TSC22 domain family member 2 2 2
MIRT466312 TIMM22 translocase of inner mitochondrial membrane 22 2 2
MIRT466718 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT468258 SFXN4 sideroflexin 4 2 2
MIRT469140 RNF126 ring finger protein 126 2 2
MIRT471783 NUP153 nucleoporin 153 2 2
MIRT472506 NACC2 NACC family member 2 2 2
MIRT474588 KLF6 Kruppel like factor 6 2 2
MIRT475049 JOSD1 Josephin domain containing 1 2 2
MIRT476900 FBXO21 F-box protein 21 2 2
MIRT476972 FAM83G family with sequence similarity 83 member G 2 4
MIRT477433 EMP1 epithelial membrane protein 1 2 2
MIRT480334 C5orf51 chromosome 5 open reading frame 51 2 10
MIRT481179 AVL9 AVL9 cell migration associated 2 6
MIRT481693 AR androgen receptor 2 2
MIRT483280 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 2 4
MIRT485775 B4GALT5 beta-1,4-galactosyltransferase 5 2 2
MIRT487424 CACNB1 calcium voltage-gated channel auxiliary subunit beta 1 2 2
MIRT488002 RXRB retinoid X receptor beta 2 2
MIRT488259 DNLZ DNL-type zinc finger 2 4
MIRT490360 DPYSL5 dihydropyrimidinase like 5 2 2
MIRT491593 USB1 U6 snRNA biogenesis phosphodiesterase 1 2 2
MIRT495269 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 2 4
MIRT495619 ZNF736 zinc finger protein 736 2 2
MIRT496167 ELP3 elongator acetyltransferase complex subunit 3 2 2
MIRT496250 GJB2 gap junction protein beta 2 2 2
MIRT496915 RTKN rhotekin 2 2
MIRT498713 PGAM5 PGAM family member 5, mitochondrial serine/threonine protein phosphatase 2 10
MIRT501106 SLC5A6 solute carrier family 5 member 6 2 4
MIRT501831 NCOA3 nuclear receptor coactivator 3 2 2
MIRT507142 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT510991 PER1 period circadian clock 1 2 4
MIRT512283 ARHGDIA Rho GDP dissociation inhibitor alpha 2 6
MIRT513152 CSDC2 cold shock domain containing C2 2 2
MIRT513327 KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 2 6
MIRT515090 FAM120AOS family with sequence similarity 120A opposite strand 2 2
MIRT516113 OARD1 O-acyl-ADP-ribose deacylase 1 2 8
MIRT516657 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT516892 PLEKHS1 pleckstrin homology domain containing S1 2 2
MIRT517966 ZMIZ2 zinc finger MIZ-type containing 2 2 4
MIRT519492 PNPLA3 patatin like phospholipase domain containing 3 2 2
MIRT519799 ZNF226 zinc finger protein 226 2 2
MIRT524309 CTC1 CST telomere replication complex component 1 2 8
MIRT524425 CNKSR3 CNKSR family member 3 2 2
MIRT525927 KIAA0391 KIAA0391 2 2
MIRT528022 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT528227 METTL8 methyltransferase like 8 2 2
MIRT528686 CEP57L1 centrosomal protein 57 like 1 2 2
MIRT528774 CD1D CD1d molecule 2 2
MIRT529935 P2RX7 purinergic receptor P2X 7 2 2
MIRT530642 PPIC peptidylprolyl isomerase C 2 4
MIRT530683 CHRNB1 cholinergic receptor nicotinic beta 1 subunit 2 4
MIRT531922 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT532181 SEC14L5 SEC14 like lipid binding 5 2 4
MIRT534996 PRR11 proline rich 11 2 6
MIRT535452 PDCL phosducin like 2 4
MIRT544682 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT553757 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 4
MIRT560724 ZNF749 zinc finger protein 749 2 2
MIRT561518 SPTY2D1 SPT2 chromatin protein domain containing 1 2 2
MIRT561578 SLC30A1 solute carrier family 30 member 1 2 2
MIRT562483 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT565039 VAV2 vav guanine nucleotide exchange factor 2 2 2
MIRT565348 TMED4 transmembrane p24 trafficking protein 4 2 2
MIRT567104 KANSL1 KAT8 regulatory NSL complex subunit 1 2 2
MIRT568879 LY6H lymphocyte antigen 6 family member H 2 2
MIRT569141 NAP1L4 nucleosome assembly protein 1 like 4 2 2
MIRT569199 LRRC3C leucine rich repeat containing 3C 2 2
MIRT573559 TMEM120B transmembrane protein 120B 2 2
MIRT575931 Mrrf mitochondrial ribosome recycling factor 2 6
MIRT607035 MRRF mitochondrial ribosome recycling factor 2 9
MIRT607194 SPRY4 sprouty RTK signaling antagonist 4 2 2
MIRT609682 TMEM213 transmembrane protein 213 2 2
MIRT611227 ZNF274 zinc finger protein 274 2 2
MIRT611370 PLXDC1 plexin domain containing 1 2 4
MIRT611640 SCRG1 stimulator of chondrogenesis 1 2 2
MIRT613011 GABRB1 gamma-aminobutyric acid type A receptor beta1 subunit 2 2
MIRT613532 GTSE1 G2 and S-phase expressed 1 2 2
MIRT614459 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT616492 CD300E CD300e molecule 2 2
MIRT617288 GTF2H3 general transcription factor IIH subunit 3 2 2
MIRT618356 CDKL1 cyclin dependent kinase like 1 2 2
MIRT619529 ZNF74 zinc finger protein 74 2 2
MIRT619990 ZSCAN22 zinc finger and SCAN domain containing 22 2 2
MIRT621286 ATP5E ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit 2 2
MIRT621482 GPKOW G-patch domain and KOW motifs 2 2
MIRT625456 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT626757 NDUFA9 NADH:ubiquinone oxidoreductase subunit A9 2 2
MIRT629138 CTCFL CCCTC-binding factor like 2 2
MIRT630092 DCAF10 DDB1 and CUL4 associated factor 10 2 2
MIRT633501 RNF14 ring finger protein 14 2 2
MIRT633604 APCDD1 APC down-regulated 1 2 2
MIRT633772 F2 coagulation factor II, thrombin 2 2
MIRT635605 ADAT1 adenosine deaminase, tRNA specific 1 2 2
MIRT637422 EPB41L3 erythrocyte membrane protein band 4.1 like 3 2 2
MIRT637822 PLA2G7 phospholipase A2 group VII 2 2
MIRT637978 RRP36 ribosomal RNA processing 36 2 2
MIRT638385 RABL3 RAB, member of RAS oncogene family like 3 2 2
MIRT638547 KIAA1549 KIAA1549 2 2
MIRT642019 NCKIPSD NCK interacting protein with SH3 domain 2 2
MIRT643342 MICA MHC class I polypeptide-related sequence A 2 2
MIRT644281 LRRC57 leucine rich repeat containing 57 2 2
MIRT646818 COX19 COX19, cytochrome c oxidase assembly factor 2 2
MIRT646839 TLDC1 TBC/LysM-associated domain containing 1 2 2
MIRT646976 CYP2W1 cytochrome P450 family 2 subfamily W member 1 2 2
MIRT647735 CXCR2 C-X-C motif chemokine receptor 2 2 2
MIRT648598 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT649843 LIPG lipase G, endothelial type 2 2
MIRT650031 VHL von Hippel-Lindau tumor suppressor 2 2
MIRT652082 TSPAN14 tetraspanin 14 2 2
MIRT652103 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT652902 SYNPO2L synaptopodin 2 like 2 2
MIRT653549 SLC38A7 solute carrier family 38 member 7 2 2
MIRT653981 SEMA6B semaphorin 6B 2 2
MIRT654287 RCAN1 regulator of calcineurin 1 2 2
MIRT658372 FAM63B MINDY lysine 48 deubiquitinase 2 2 2
MIRT660321 BDP1 B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB 2 2
MIRT663063 LRIF1 ligand dependent nuclear receptor interacting factor 1 2 2
MIRT663269 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 2 2
MIRT664076 ZNF417 zinc finger protein 417 2 2
MIRT664193 MYOZ2 myozenin 2 2 2
MIRT664512 POLR3K RNA polymerase III subunit K 2 2
MIRT667025 PDF peptide deformylase, mitochondrial 2 2
MIRT669621 ACSL6 acyl-CoA synthetase long chain family member 6 2 2
MIRT670530 MLLT6 MLLT6, PHD finger containing 2 2
MIRT673050 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT683339 ZNF581 zinc finger protein 581 2 2
MIRT689264 WDR83OS WD repeat domain 83 opposite strand 2 2
MIRT690902 TOP2A DNA topoisomerase II alpha 2 2
MIRT699196 SLX4IP SLX4 interacting protein 2 2
MIRT702223 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT707053 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT707080 MED29 mediator complex subunit 29 2 2
MIRT712347 NLN neurolysin 2 2
MIRT714715 KIT KIT proto-oncogene receptor tyrosine kinase 2 2
MIRT715963 CES4A carboxylesterase 4A 2 2
MIRT718224 DEFB105B defensin beta 105B 2 2
MIRT718244 DEFB105A defensin beta 105A 2 2
MIRT721960 GCK glucokinase 2 2
MIRT723098 SERINC3 serine incorporator 3 2 2
MIRT725207 PTPRT protein tyrosine phosphatase, receptor type T 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4524b Tripterygium wilfordii Hook F resistant tissue
hsa-miR-4524b-3p Tamoxifen 2733525 NSC180973 approved sensitive cell line (LCC2)

Error report submission