>FJX1|NM_014344|3'UTR
   1 TGTCACCGGGAGGAAAAGAGAGAGATCTGGGGCTGGGGTATGGATGATGGGGGGAAGGGCGGTCGCCTCTGCCACTGTCA
  81 GGGACCAGCCGGCCAACGCCCACCCGCAAAGGTGTCTAAAAACTTCAGCTTTTCACCCACCTGCCCCTTTCTTTCAATCC
 161 CACGCTGTTTCCTTTCAAAGTTCTGGGAGGACGAACTCACCGAGGCGAGAAGTGTAACATTCTCTCCACCCAGCTTATAA
 241 AAGGATTCTTTACTGTGCCAGCACGGGGATTGGATCCGAAGAAACTGGCTACTGGGGTTTGGCCCCCGAGTGGCCGTCCC
 321 TGTGGGAGATGCACCCCATTCTTGGGCCCCCCCTCATTCCCTTTCCGAAAAAGGAAAACTTGCGTTTGAGCCGTTGAGCT
 401 AATTCTGCAATTTTCTACCAAACAGAGCGCTGGTGGCCCCGGAGCAGGGCTGTGACATTGGCTGGTGGAGCCCCCTTCCT
 481 GTGTTCTCCCTTTGTTCCAGCGCCGCGATGGTGAGATCACTGTTCCAAGCAGGGGGACGGCTCGCGATAGGACAAAGAGA
 561 GCAGGACCTCCAGACTCTGGGGAGCCCTGCAGACCTTGACAATTTGCCTGACTCATTCCTGACCTCTTGTCATTTTGGCC
 641 TGAAGGCTACAAATTCAGGGTCAGCTGTATGCACTAAGTCAAATAATGAATTTCTTCCTCCCTCTCGCAACCGACCAAAA
 721 TTTTGACAACGATGATGTTCACCAGAAGGAAAAAAAAAAATCAGTTTTATGCACTTTATTTTGTTTTGATTTTCATTTTT
 801 TATTAAGAAAAAATTTTATTTTACAGAATTTACCTTCTCTGTATATATGTGCATAAAGTGTGGTGTAAATATACTAAACA
 881 AACTTATATTTCAATAAAAGGGAGTTTAAAATTTATAATTTAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' uuuucauuaaugUCAAAAA----- 5' |||| | Target 5' gtttcctttcaaAGTTCTGGGAGG 3'	167 - 190	72.00	-7.10

Mutant ID	Mutant Position	Mutant Source
COSN31534729	25	COSMIC
COSN31532698	50	COSMIC
COSN31541805	66	COSMIC
COSN30128179	92	COSMIC
COSN30126168	99	COSMIC
COSN31550342	103	COSMIC
COSN8641570	107	COSMIC
COSN30141545	113	COSMIC
COSN5826294	167	COSMIC
COSN26642597	208	COSMIC
COSN15624069	210	COSMIC
COSN15624070	306	COSMIC
COSN30144088	315	COSMIC
COSN26957823	331	COSMIC
COSN30139416	347	COSMIC
COSN20108155	354	COSMIC
COSN30133350	380	COSMIC
COSN30113721	445	COSMIC
COSN31661302	467	COSMIC
COSN30123280	509	COSMIC
COSN30114617	518	COSMIC
COSN1530055	588	COSMIC
COSN30512599	590	COSMIC
COSN31593400	616	COSMIC
COSN30112044	714	COSMIC
COSN8443372	722	COSMIC
COSN30136534	731	COSMIC
COSN20108158	760	COSMIC
COSN20108156	761	COSMIC
COSN23266947	794	COSMIC
COSN30130205	809	COSMIC
COSN31548396	817	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs936013183	5	dbSNP
rs1196460566	8	dbSNP
rs779030205	9	dbSNP
rs1286819380	14	dbSNP
rs777076057	17	dbSNP
rs913518318	19	dbSNP
rs1038461737	21	dbSNP
rs747078192	27	dbSNP
rs768911636	28	dbSNP
rs946193193	33	dbSNP
rs1198216803	34	dbSNP
rs1274581327	35	dbSNP
rs368400572	39	dbSNP
rs1308295422	43	dbSNP
rs1349217693	49	dbSNP
rs906915925	49	dbSNP
rs769940544	51	dbSNP
rs1220981853	52	dbSNP
rs1371842182	54	dbSNP
rs56272465	55	dbSNP
rs1266084304	57	dbSNP
rs1490698809	59	dbSNP
rs1013073600	65	dbSNP
rs768233361	66	dbSNP
rs1363188103	68	dbSNP
rs780119678	75	dbSNP
rs971650913	80	dbSNP
rs1266861441	81	dbSNP
rs999517148	100	dbSNP
rs1490579636	104	dbSNP
rs1055440232	105	dbSNP
rs545848130	113	dbSNP
rs957030615	118	dbSNP
rs1172262617	128	dbSNP
rs1230738448	129	dbSNP
rs1351868149	130	dbSNP
rs1280789130	137	dbSNP
rs898136944	140	dbSNP
rs995168509	148	dbSNP
rs1457293116	162	dbSNP
rs1025513674	163	dbSNP
rs964441932	171	dbSNP
rs975916249	201	dbSNP
rs542038856	207	dbSNP
rs1007982332	215	dbSNP
rs1427046739	218	dbSNP
rs1198800593	224	dbSNP
rs1480783452	232	dbSNP
rs1248700712	239	dbSNP
rs181014960	244	dbSNP
rs1297711395	246	dbSNP
rs115615963	262	dbSNP
rs909168704	265	dbSNP
rs941324510	266	dbSNP
rs1262990786	270	dbSNP
rs1038409992	271	dbSNP
rs1345047830	275	dbSNP
rs894535820	278	dbSNP
rs1325701850	290	dbSNP
rs1258904060	293	dbSNP
rs966132485	295	dbSNP
rs1013438901	299	dbSNP
rs373923019	330	dbSNP
rs1244338683	335	dbSNP
rs1029110603	347	dbSNP
rs1175562473	347	dbSNP
rs3832737	347	dbSNP
rs397848192	347	dbSNP
rs530783386	348	dbSNP
rs1166435874	350	dbSNP
rs1360920230	351	dbSNP
rs550594296	352	dbSNP
rs1242855351	354	dbSNP
rs913444891	362	dbSNP
rs1190912127	371	dbSNP
rs967629149	380	dbSNP
rs1460228204	384	dbSNP
rs1241079438	392	dbSNP
rs999069577	394	dbSNP
rs981604111	408	dbSNP
rs1442561327	420	dbSNP
rs1280111648	424	dbSNP
rs928813053	437	dbSNP
rs1338351589	450	dbSNP
rs1484679677	451	dbSNP
rs572670063	453	dbSNP
rs1055937600	463	dbSNP
rs1043299303	467	dbSNP
rs1187913412	468	dbSNP
rs1336050531	479	dbSNP
rs1262080524	481	dbSNP
rs1443811363	482	dbSNP
rs570449800	496	dbSNP
rs1326946635	500	dbSNP
rs1267813402	506	dbSNP
rs1161544627	516	dbSNP
rs1031863483	518	dbSNP
rs919716638	519	dbSNP
rs532351769	523	dbSNP
rs1425264884	539	dbSNP
rs1046723592	540	dbSNP
rs886998483	544	dbSNP
rs1184812949	547	dbSNP
rs552177811	548	dbSNP
rs565803156	550	dbSNP
rs1289671051	558	dbSNP
rs1040992425	560	dbSNP
rs534819080	562	dbSNP
rs1436677928	569	dbSNP
rs546482890	579	dbSNP
rs555099166	583	dbSNP
rs1357091604	592	dbSNP
rs1029486939	593	dbSNP
rs1450946582	599	dbSNP
rs1317673772	603	dbSNP
rs1381255441	606	dbSNP
rs950602513	616	dbSNP
rs1441592092	620	dbSNP
rs1371220118	621	dbSNP
rs1310131887	625	dbSNP
rs957443489	626	dbSNP
rs983328768	631	dbSNP
rs1240131499	634	dbSNP
rs1165936643	635	dbSNP
rs909116295	645	dbSNP
rs1406457878	646	dbSNP
rs941941570	647	dbSNP
rs1251908568	652	dbSNP
rs974047336	657	dbSNP
rs1217439416	664	dbSNP
rs1290494348	670	dbSNP
rs1011548172	674	dbSNP
rs1222066539	675	dbSNP
rs915918577	688	dbSNP
rs1460634608	705	dbSNP
rs948800535	707	dbSNP
rs751400447	708	dbSNP
rs761571806	714	dbSNP
rs1445156397	716	dbSNP
rs934810274	726	dbSNP
rs766384072	731	dbSNP
rs112527179	732	dbSNP
rs1159106990	734	dbSNP
rs1405797451	745	dbSNP
rs893364208	749	dbSNP
rs1160745429	750	dbSNP
rs1414754191	750	dbSNP
rs201586899	750	dbSNP
rs3834431	750	dbSNP
rs532787003	750	dbSNP
rs796451426	750	dbSNP
rs1420993970	756	dbSNP
rs1011786090	761	dbSNP
rs1160046186	762	dbSNP
rs185251380	766	dbSNP
rs10551096	775	dbSNP
rs142112053	775	dbSNP
rs557671217	775	dbSNP
rs191145130	779	dbSNP
rs1221790919	780	dbSNP
rs1322891039	789	dbSNP
rs1302296093	795	dbSNP
rs1468473414	800	dbSNP
rs1360393412	805	dbSNP
rs1288666102	808	dbSNP
rs1339088157	816	dbSNP
rs1407311660	824	dbSNP
rs1391506221	827	dbSNP
rs997230465	835	dbSNP
rs1467817922	838	dbSNP
rs1376542917	840	dbSNP
rs1446606365	848	dbSNP
rs991676001	854	dbSNP
rs1168284084	858	dbSNP
rs1416867735	859	dbSNP
rs1030477004	860	dbSNP
rs1374854265	863	dbSNP
rs866528178	864	dbSNP
rs1465143256	870	dbSNP
rs1370476417	884	dbSNP
rs1224944489	885	dbSNP
rs1307134516	888	dbSNP
rs919642929	895	dbSNP
rs1201453016	904	dbSNP
rs1235445702	905	dbSNP
rs931076036	908	dbSNP
rs1295078468	914	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Genes & development, 2013

When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.