miRTarBase - #MIRT266189


—
pre-miRNA Information
pre-miRNA hsa-mir-4476   
Genomic Coordinates chr9: 36893462 - 36893531
Description Homo sapiens miR-4476 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4476
Sequence 45| CAGGAAGGAUUUAGGGACAGGC |66
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 6 9 - 36893482 29233923 MiREDiBase
A-to-I 9 9 - 36893479 29233923 MiREDiBase
A-to-I 13 9 - 36893475 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs978640498 3 dbSNP
rs1019792440 6 dbSNP
rs1008364367 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TXNIP   
Synonyms ARRDC6, EST01027, HHCPA78, THIF, VDUP1
Description thioredoxin interacting protein
Transcript NM_006472   
Expression
Putative miRNA Targets on TXNIP
3'UTR of TXNIP
(miRNA target sites are highlighted)		 
>TXNIP|NM_006472|3'UTR
   1 GCATGTGGAAGAAAAGAAGCAGCTTTACCTACTTGTTTCTTTTTGTCTCTCTTCCTGGACACTCACTTTTTCAGAGACTC
  81 AACAGTCTCTGCAATGGAGTGTGGGTCCACCTTAGCCTCTGACTTCCTAATGTAGGAGGTGGTCAGCAGGCAATCTCCTG
 161 GGCCTTAAAGGATGCGGACTCATCCTCAGCCAGCGCCCATGTTGTGATACAGGGGTGTTTGTTGGATGGGTTTAAAAATA
 241 ACTAGAAAAACTCAGGCCCATCCATTTTCTCAGATCTCCTTGAAAATTGAGGCCTTTTCGATAGTTTCGGGTCAGGTAAA
 321 AATGGCCTCCTGGCGTAAGCTTTTCAAGGTTTTTTGGAGGCTTTTTGTAAATTGTGATAGGAACTTTGGACCTTGAACTT
 401 ACGTATCATGTGGAGAAGAGCCAATTTAACAAACTAGGAAGATGAAAAGGGAAATTGTGGCCAAAACTTTGGGAAAAGGA
 481 GGTTCTTAAAATCAGTGTTTCCCCTTTGTGCACTTGTAGAAAAAAAAGAAAAACCTTCTAGAGCTGATTTGATGGACAAT
 561 GGAGAGAGCTTTCCCTGTGATTATAAAAAAGGAAGCTAGCTGCTCTACGGTCATCTTTGCTTAGAGTATACTTTAACCTG
 641 GCTTTTAAAGCAGTAGTAACTGCCCCACCAAAGGTCTTAAAAGCCATTTTTGGAGCCTATTGCACTGTGTTCTCCTACTG
 721 CAAATATTTTCATATGGGAGGATGGTTTTCTCTTCATGTAAGTCCTTGGAATTGATTCTAAGGTGATGTTCTTAGCACTT
 801 TAATTCCTGTCAAATTTTTTGTTCTCCCCTTCTGCCATCTTAAATGTAAGCTGAAACTGGTCTACTGTGTCTCTAGGGTT
 881 AAGCCAAAAGACAAAAAAAATTTTACTACTTTTGAGATTGCCCCAATGTACAGAATTATATAATTCTAACGCTTAAATCA
 961 TGTGAAAGGGTTGCTGCTGTCAGCCTTGCCCACTGTGACTTCAAACCCAAGGAGGAACTCTTGATCAAGATGCCCAACCC
1041 TGTGATCAGAACCTCCAAATACTGCCATGAGAAACTAGAGGGCAGGTCTTCATAAAAGCCCTTTGAACCCCCTTCCTGCC
1121 CTGTGTTAGGAGATAGGGATATTGGCCCCTCACTGCAGCTGCCAGCACTTGGTCAGTCACTCTCAGCCATAGCACTTTGT
1201 TCACTGTCCTGTGTCAGAGCACTGAGCTCCACCCTTTTCTGAGAGTTATTACAGCCAGAAAGTGTGGGCTGAAGATGGTT
1281 GGTTTCATGTTTTTGTATTATGTATCTTTTTGTATGGTAAAGACTATATTTTGTACTTAACCAGATATATTTTTACCCCA
1361 GATGGGGATATTCTTTGTAAAAAATGAAAATAAAGTTTTTTTAATGGAAAAAAAAATGTCTGTGAAAAAAAAAAAAAAAA
1441 AA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cggacaGGGAUUU--AGGAAGGAc 5'
                |::|:||   ||||||| 
Target 5' aaagccCTTTGAACCCCCTTCCTg 3'
 1095 - 1118 150.00 -18.90
2 
miRNA  3' cgGACAGGGAUUUAGGAAGGAc 5'
            :||||:|     :|||||| 
Target 5' ttTTGTCTC-----TCTTCCTg 3'
 41 - 57 135.00 -18.60
3 
miRNA  3' cggaCAGGGAUUUAGGAAGGAc 5'
              | |:||:|   |||||| 
Target 5' cttaGCCTCTGA---CTTCCTa 3'
 111 - 129 126.00 -10.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31613608 26 COSMIC
COSN23013884 29 COSMIC
COSN30498918 54 COSMIC
COSN26345387 86 COSMIC
COSN31518012 87 COSMIC
COSN31544793 97 COSMIC
COSN13465511 153 COSMIC
COSN30168748 176 COSMIC
COSN22854620 212 COSMIC
COSN32082653 300 COSMIC
COSN20215506 357 COSMIC
COSN25793126 567 COSMIC
COSN31481257 609 COSMIC
COSN28929309 699 COSMIC
COSN31487417 731 COSMIC
COSN8319264 786 COSMIC
COSN7175900 895 COSMIC
COSN16130546 903 COSMIC
COSN31541469 950 COSMIC
COSN1404851 989 COSMIC
COSN31566757 1020 COSMIC
COSN30175504 1198 COSMIC
COSN28813251 1210 COSMIC
COSN31563457 1215 COSMIC
COSN17255712 1341 COSMIC
COSN8635856 1344 COSMIC
COSN16130598 1349 COSMIC
COSN8319265 1407 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs782324253 5 dbSNP
rs781922861 6 dbSNP
rs782164728 10 dbSNP
rs1042196726 11 dbSNP
rs1378865015 12 dbSNP
rs1238192616 14 dbSNP
rs1322340577 17 dbSNP
rs1223844421 20 dbSNP
rs782412186 20 dbSNP
rs782011331 23 dbSNP
rs1263824209 27 dbSNP
rs775233794 27 dbSNP
rs782126186 28 dbSNP
rs371598136 29 dbSNP
rs781829085 35 dbSNP
rs1179845309 39 dbSNP
rs762566229 45 dbSNP
rs187591491 47 dbSNP
rs782695925 49 dbSNP
rs1438233194 53 dbSNP
rs1176339594 56 dbSNP
rs1406774368 58 dbSNP
rs1405664156 61 dbSNP
rs371239177 62 dbSNP
rs763445640 66 dbSNP
rs191199120 68 dbSNP
rs1331993431 80 dbSNP
rs926556698 85 dbSNP
rs980068913 86 dbSNP
rs942069156 94 dbSNP
rs1380153984 102 dbSNP
rs1230279460 103 dbSNP
rs1310607527 110 dbSNP
rs1321232464 111 dbSNP
rs1199751130 115 dbSNP
rs1260570451 117 dbSNP
rs782040268 123 dbSNP
rs782156144 126 dbSNP
rs1198407308 128 dbSNP
rs1238455155 128 dbSNP
rs1472910620 134 dbSNP
rs1183259112 139 dbSNP
rs1410937390 144 dbSNP
rs1474596615 150 dbSNP
rs1171229323 157 dbSNP
rs1402347354 160 dbSNP
rs1464057644 161 dbSNP
rs1327900605 164 dbSNP
rs1359573889 167 dbSNP
rs983462122 171 dbSNP
rs1450421426 172 dbSNP
rs782151618 175 dbSNP
rs782730266 176 dbSNP
rs1219316893 182 dbSNP
rs751580661 189 dbSNP
rs1316562673 194 dbSNP
rs757127542 195 dbSNP
rs1279726855 196 dbSNP
rs782458723 199 dbSNP
rs1444522337 202 dbSNP
rs964973982 214 dbSNP
rs1018315568 215 dbSNP
rs1211711784 216 dbSNP
rs1235396722 239 dbSNP
rs1485173889 242 dbSNP
rs1193744753 246 dbSNP
rs1425196792 247 dbSNP
rs1000527363 251 dbSNP
rs782095422 264 dbSNP
rs782735059 269 dbSNP
rs1425527728 277 dbSNP
rs1415978448 281 dbSNP
rs1020648610 286 dbSNP
rs1375066981 292 dbSNP
rs182339054 293 dbSNP
rs896250928 294 dbSNP
rs1430590223 300 dbSNP
rs186992970 307 dbSNP
rs587669942 308 dbSNP
rs1280146264 309 dbSNP
rs1346661958 315 dbSNP
rs1216943737 318 dbSNP
rs1264644353 325 dbSNP
rs372245117 327 dbSNP
rs1247206460 328 dbSNP
rs1479008383 331 dbSNP
rs905099575 334 dbSNP
rs1394305473 335 dbSNP
rs1420489469 337 dbSNP
rs587633419 347 dbSNP
rs1358627658 351 dbSNP
rs1400205301 353 dbSNP
rs1324348440 357 dbSNP
rs587688547 366 dbSNP
rs880001759 372 dbSNP
rs1434993978 373 dbSNP
rs1303097894 380 dbSNP
rs1240339979 388 dbSNP
rs1378137080 388 dbSNP
rs1287737864 397 dbSNP
rs1348176239 402 dbSNP
rs7211 402 dbSNP
rs909194389 403 dbSNP
rs1252106635 405 dbSNP
rs139816793 405 dbSNP
rs983429530 408 dbSNP
rs1180677079 410 dbSNP
rs11537988 416 dbSNP
rs1378681121 420 dbSNP
rs1469875254 421 dbSNP
rs1163879673 425 dbSNP
rs1393031655 431 dbSNP
rs929395114 432 dbSNP
rs1325860264 434 dbSNP
rs1401411327 444 dbSNP
rs782760634 447 dbSNP
rs1449452453 451 dbSNP
rs1307615133 453 dbSNP
rs1333591721 454 dbSNP
rs923375748 455 dbSNP
rs587595014 458 dbSNP
rs144336702 461 dbSNP
rs587721930 462 dbSNP
rs979655270 466 dbSNP
rs1272484245 470 dbSNP
rs968300777 475 dbSNP
rs1458201715 478 dbSNP
rs782603988 483 dbSNP
rs1200297110 486 dbSNP
rs1248193527 499 dbSNP
rs1437439441 507 dbSNP
rs1188533701 516 dbSNP
rs1370225266 517 dbSNP
rs1020617601 518 dbSNP
rs1164375997 528 dbSNP
rs1471852789 528 dbSNP
rs1424966048 530 dbSNP
rs60016427 532 dbSNP
rs1329704935 535 dbSNP
rs1396260982 536 dbSNP
rs1390424829 537 dbSNP
rs1334409691 538 dbSNP
rs1341676501 540 dbSNP
rs1230906272 543 dbSNP
rs1009258927 547 dbSNP
rs960484146 549 dbSNP
rs1292204396 555 dbSNP
rs1318464304 556 dbSNP
rs1220448927 559 dbSNP
rs1249351897 560 dbSNP
rs1480204605 573 dbSNP
rs1201181041 578 dbSNP
rs17221751 580 dbSNP
rs1001967957 584 dbSNP
rs904984593 585 dbSNP
rs1491098482 591 dbSNP
rs1491237619 592 dbSNP
rs1479063432 600 dbSNP
rs1169206620 603 dbSNP
rs1372803185 604 dbSNP
rs1466890670 605 dbSNP
rs1038185991 606 dbSNP
rs1174735186 608 dbSNP
rs1005396171 609 dbSNP
rs887055645 610 dbSNP
rs1412581170 612 dbSNP
rs1311718841 614 dbSNP
rs1173796060 624 dbSNP
rs1293355589 625 dbSNP
rs1401723505 625 dbSNP
rs1306645745 627 dbSNP
rs1233700693 636 dbSNP
rs587625832 637 dbSNP
rs1210470225 640 dbSNP
rs1286782430 651 dbSNP
rs782317952 663 dbSNP
rs1489316693 676 dbSNP
rs929338953 678 dbSNP
rs923374357 680 dbSNP
rs1261621694 686 dbSNP
rs1434316789 688 dbSNP
rs1201416620 696 dbSNP
rs1393705612 697 dbSNP
rs1432427649 700 dbSNP
rs1172659571 707 dbSNP
rs1360531020 709 dbSNP
rs587680878 712 dbSNP
rs1361150127 715 dbSNP
rs1387331419 717 dbSNP
rs1303074471 720 dbSNP
rs755859477 720 dbSNP
rs1368560706 732 dbSNP
rs943471171 734 dbSNP
rs1287031216 735 dbSNP
rs1356195735 736 dbSNP
rs184403951 757 dbSNP
rs1260255804 760 dbSNP
rs1489078465 762 dbSNP
rs979622524 764 dbSNP
rs879951227 765 dbSNP
rs587616307 768 dbSNP
rs968269660 772 dbSNP
rs1380513567 778 dbSNP
rs914194992 783 dbSNP
rs1420548122 786 dbSNP
rs987815665 789 dbSNP
rs587697781 795 dbSNP
rs1327851862 797 dbSNP
rs1391945520 798 dbSNP
rs587738475 799 dbSNP
rs1439880342 802 dbSNP
rs188801165 813 dbSNP
rs1034694017 814 dbSNP
rs1222326818 816 dbSNP
rs1306316807 824 dbSNP
rs1002338477 826 dbSNP
rs1322437540 827 dbSNP
rs17215345 829 dbSNP
rs1247537919 846 dbSNP
rs1271839122 855 dbSNP
rs969178468 869 dbSNP
rs1199631976 871 dbSNP
rs1240471150 871 dbSNP
rs1481382993 872 dbSNP
rs1175151496 877 dbSNP
rs1406527116 881 dbSNP
rs1166547639 886 dbSNP
rs879991460 893 dbSNP
rs1491067549 894 dbSNP
rs17215338 897 dbSNP
rs1331759889 899 dbSNP
rs1016711766 900 dbSNP
rs1297825524 901 dbSNP
rs1356080896 901 dbSNP
rs1440237012 901 dbSNP
rs1379912358 908 dbSNP
rs1230086645 914 dbSNP
rs1005366474 922 dbSNP
rs887026030 924 dbSNP
rs1334743209 928 dbSNP
rs199827526 932 dbSNP
rs998124411 939 dbSNP
rs1201940875 940 dbSNP
rs1231944411 943 dbSNP
rs587637170 946 dbSNP
rs901803859 949 dbSNP
rs193055505 950 dbSNP
rs587754573 951 dbSNP
rs11537987 952 dbSNP
rs943433626 954 dbSNP
rs1408014581 959 dbSNP
rs1169551439 961 dbSNP
rs1359958985 962 dbSNP
rs1416911570 974 dbSNP
rs1311094732 979 dbSNP
rs1354936972 981 dbSNP
rs1401073154 982 dbSNP
rs910662203 984 dbSNP
rs1272447258 992 dbSNP
rs1360566475 1002 dbSNP
rs1214348658 1006 dbSNP
rs1279834666 1011 dbSNP
rs587707558 1017 dbSNP
rs1312385871 1018 dbSNP
rs1212604008 1026 dbSNP
rs1277515542 1027 dbSNP
rs778849135 1031 dbSNP
rs587631368 1033 dbSNP
rs946900640 1034 dbSNP
rs7212 1035 dbSNP
rs1474423371 1037 dbSNP
rs1185681179 1038 dbSNP
rs1425637740 1040 dbSNP
rs185869681 1044 dbSNP
rs4755 1045 dbSNP
rs11537984 1056 dbSNP
rs782111820 1062 dbSNP
rs747400980 1067 dbSNP
rs939637061 1072 dbSNP
rs1374865849 1074 dbSNP
rs782357128 1081 dbSNP
rs587663814 1082 dbSNP
rs1320449964 1086 dbSNP
rs1325170860 1087 dbSNP
rs587731065 1088 dbSNP
rs1275758715 1100 dbSNP
rs781954705 1102 dbSNP
rs1235949373 1103 dbSNP
rs148808239 1104 dbSNP
rs1300821227 1105 dbSNP
rs1346774785 1107 dbSNP
rs1216697503 1109 dbSNP
rs13340 1112 dbSNP
rs969092902 1115 dbSNP
rs75291601 1117 dbSNP
rs1445163633 1118 dbSNP
rs1215023304 1120 dbSNP
rs1247001755 1121 dbSNP
rs587742862 1123 dbSNP
rs1455432809 1128 dbSNP
rs1191582395 1133 dbSNP
rs587632424 1134 dbSNP
rs1440595578 1137 dbSNP
rs1025436781 1138 dbSNP
rs782067883 1143 dbSNP
rs1382907398 1146 dbSNP
rs1324782358 1149 dbSNP
rs1397061837 1152 dbSNP
rs1439140528 1153 dbSNP
rs901116218 1156 dbSNP
rs1369745291 1160 dbSNP
rs1239380532 1162 dbSNP
rs1280747961 1164 dbSNP
rs13203 1168 dbSNP
rs1223087601 1173 dbSNP
rs1469822683 1180 dbSNP
rs73004671 1181 dbSNP
rs1252203121 1182 dbSNP
rs1458344032 1184 dbSNP
rs1184283201 1185 dbSNP
rs1362065982 1186 dbSNP
rs1163966506 1192 dbSNP
rs1469702544 1192 dbSNP
rs889195041 1193 dbSNP
rs1043797905 1203 dbSNP
rs1460375002 1209 dbSNP
rs1325623390 1223 dbSNP
rs782809435 1224 dbSNP
rs1391541737 1226 dbSNP
rs946785983 1234 dbSNP
rs1060179 1239 dbSNP
rs1333683268 1246 dbSNP
rs1293420506 1248 dbSNP
rs1440836776 1248 dbSNP
rs782123605 1249 dbSNP
rs1231405845 1251 dbSNP
rs1272265404 1251 dbSNP
rs1339831652 1252 dbSNP
rs781886945 1256 dbSNP
rs1248667835 1268 dbSNP
rs939585610 1269 dbSNP
rs1188706047 1271 dbSNP
rs928262975 1274 dbSNP
rs1259759524 1279 dbSNP
rs1474484411 1285 dbSNP
rs980844449 1286 dbSNP
rs1164841981 1288 dbSNP
rs1424714665 1290 dbSNP
rs1463841426 1293 dbSNP
rs1166587935 1295 dbSNP
rs1393839142 1298 dbSNP
rs587744932 1301 dbSNP
rs17215352 1304 dbSNP
rs1356845442 1312 dbSNP
rs587697405 1314 dbSNP
rs1292610322 1315 dbSNP
rs951155166 1319 dbSNP
rs782761667 1326 dbSNP
rs1327009960 1328 dbSNP
rs1229331365 1330 dbSNP
rs1249443048 1334 dbSNP
rs587759329 1341 dbSNP
rs1211893044 1348 dbSNP
rs1484739763 1356 dbSNP
rs1282482732 1357 dbSNP
rs139537792 1359 dbSNP
rs1263042191 1360 dbSNP
rs587711312 1362 dbSNP
rs1430853212 1367 dbSNP
rs965670628 1373 dbSNP
rs1191461016 1379 dbSNP
rs1372896149 1381 dbSNP
rs1474856821 1384 dbSNP
rs1173878766 1385 dbSNP
rs1376677555 1390 dbSNP
rs1432309416 1391 dbSNP
rs1311815383 1395 dbSNP
rs1385539659 1402 dbSNP
rs1383900622 1403 dbSNP
rs1293116545 1404 dbSNP
rs1325670923 1411 dbSNP
rs1018223865 1413 dbSNP
rs1210215430 1417 dbSNP
rs1305882263 1417 dbSNP
rs143469330 1417 dbSNP
rs79787359 1417 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cggacaGGGAUUU--AGGAAGGAc 5'
                |::|:||   ||||||| 
Target 5' aaagccCUUUGAACCCCCUUCCUg 3'
 		17 - 40
2 
miRNA  3' cggacagggauUUAGGAAGGAc 5'
                     |: :|||| | 
Target 5' ------agggcAGGUCUUCAUa 3'
 		1 - 16
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM4903825
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / PID14_NS
Location of target site NM_006472 | 3UTR | AAACCCAAGGAGGAACUCUUGAUCAAGAUGCCGAACCCUGUGUUCAGAACCUCCAAAUACUGCCAUGAGAAACUAGAGGGCAGGUCUUCAUAAAAGCCCUUUGAACCCCCUUCCUGCCCUGUGUUAGGAGAUAGGGAUAUUGGCCCCUCACUGCAGCUGCCAGCACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161237
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903826
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / PID21_NS
Location of target site NM_006472 | 3UTR | AAACCCAAGGAGGAACUCUUGAUCAAGAUGCCGAACCCUGUGUUCAGAACCUCCAAAUACUGCCAUGAGAAACUAGAGGGCAGGUCUUCAUAAAAGCCCUUUGAACCCCCUUCCUGCCCUGUGUUAGGAGAUAGGGAUAUUGGCCCCUCACUGCAGCUGCCAGCACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161237
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903827
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / PID14_9124
Location of target site NM_006472 | 3UTR | AAAAGCCCUUUGAACCCCCUUCCUGCCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161237
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903828
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / PID21_9124
Location of target site NM_006472 | 3UTR | AAAAGCCCUUUGAACCCCCUUCCUGCCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161237
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_006472 | 3UTR | CCCUGUGUUCAGAACCUCCAAAUACUGCCAUGAGAAACUAGAGGGCAGGUCUUCAUAAAAGCCCUUUGAACCCCCUUCCUGCCCUGUGUUAGGAGAUAGGGAUAUUGGCCCCUCACUGCAGCUGCCAGCACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_006472 | 3UTR | CCUGUGUUCAGAACCUCCAAAUACUGCCAUGAGAAACUAGAGGGCAGGUCUUCAUAAAAGCCCUUUGAACCCCCUUCCUGCCCUGUGUUAGGAGAUAGGGAUAUUGGCCCCUCACUGCAGCUGCCAGCACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_006472 | 3UTR | CAGAACCUCCAAAUACUGCCAUGAGAAACUAGAGGGCAGGUCUUCAUAAAAGCCCUUUGAACCCCCUUCCUGCCCUGUGUUAGGAGAUAGGGAUAUUGGCCCCUCACUGCAGCUGCCAGCACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_006472 | 3UTR | UGUUCAGAACCUCCAAAUACUGCCAUGAGAAACUAGAGGGCAGGUCUUCAUAAAAGCCCUUUGAACCCCCUUCCUGCCCUGUGUUAGGAGAUAGGGAUAUUGGCCCCUCACUGCAGCUGCCAGCACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_006472 | 3UTR | AGAACCUCCAAAUACUGCCAUGAGAAACUAGAGGGCAGGUCUUCAUAAAAGCCCUUUGAACCCCCUUCCUGCCCUGUGUUAGGAGAUAGGGAUAUUGGCCCCUCACUGCAGCUGCCAGCACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_006472 | 3UTR | GUUCAGAACCUCCAAAUACUGCCAUGAGAAACUAGAGGGCAGGUCUUCAUAAAAGCCCUUUGAACCCCCUUCCUGCCCUGUGUUAGGAGAUAGGGAUAUUGGCCCCUCACUGCAGCUGCCAGCACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000369317.4 | 3UTR | UCCACCUUAGCCUCUGACUUCCUAAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
CLIP-seq Support 12 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000369317.4 | 3UTR | AGGGCAGGUCUUCAUAAAAGCCCUUUGAACCCCCUUCCUGCCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
152 hsa-miR-4476 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT065631 CLIC4 chloride intracellular channel 4 2 2
MIRT076187 GID4 GID complex subunit 4 homolog 2 4
MIRT086304 HOXD8 homeobox D8 2 6
MIRT110644 ARID5B AT-rich interaction domain 5B 2 2
MIRT144337 NFAT5 nuclear factor of activated T-cells 5 2 2
MIRT196634 TAOK1 TAO kinase 1 2 6
MIRT227655 SET SET nuclear proto-oncogene 2 2
MIRT263546 PPIF peptidylprolyl isomerase F 2 4
MIRT266189 TXNIP thioredoxin interacting protein 2 4
MIRT266815 SLC25A44 solute carrier family 25 member 44 2 2
MIRT285538 CDT1 chromatin licensing and DNA replication factor 1 2 2
MIRT295094 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT300906 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT304110 CNNM4 cyclin and CBS domain divalent metal cation transport mediator 4 2 6
MIRT314891 RGMB repulsive guidance molecule family member b 2 2
MIRT364225 ANP32B acidic nuclear phosphoprotein 32 family member B 2 2
MIRT366237 VMA21 VMA21, vacuolar ATPase assembly factor 2 2
MIRT405440 RAB5B RAB5B, member RAS oncogene family 2 2
MIRT443613 OR2D2 olfactory receptor family 2 subfamily D member 2 2 2
MIRT445947 SCML4 Scm polycomb group protein like 4 2 2
MIRT445957 MLLT11 MLLT11, transcription factor 7 cofactor 2 2
MIRT445970 IKZF5 IKAROS family zinc finger 5 2 2
MIRT448066 MMP15 matrix metallopeptidase 15 2 2
MIRT449498 ZBTB4 zinc finger and BTB domain containing 4 2 2
MIRT450831 IFFO1 intermediate filament family orphan 1 2 2
MIRT451270 NDUFA11 NADH:ubiquinone oxidoreductase subunit A11 2 2
MIRT451318 LGALS3BP galectin 3 binding protein 2 2
MIRT451403 FARSA phenylalanyl-tRNA synthetase alpha subunit 2 2
MIRT451941 TMPRSS5 transmembrane protease, serine 5 2 2
MIRT452028 NLRP6 NLR family pyrin domain containing 6 2 2
MIRT452503 HMGXB3 HMG-box containing 3 2 2
MIRT453852 SDK1 sidekick cell adhesion molecule 1 2 2
MIRT454523 ZFYVE27 zinc finger FYVE-type containing 27 2 2
MIRT455402 PLA2G2F phospholipase A2 group IIF 2 2
MIRT455442 ID3 inhibitor of DNA binding 3, HLH protein 2 2
MIRT456983 MANEA mannosidase endo-alpha 2 2
MIRT457610 IDS iduronate 2-sulfatase 2 2
MIRT458319 TNFAIP8L3 TNF alpha induced protein 8 like 3 2 2
MIRT458756 CES2 carboxylesterase 2 2 2
MIRT458960 SAMD4B sterile alpha motif domain containing 4B 2 2
MIRT460403 GPHA2 glycoprotein hormone alpha 2 2 2
MIRT460632 IGFBP4 insulin like growth factor binding protein 4 2 2
MIRT461760 DDX11 DEAD/H-box helicase 11 2 2
MIRT461924 NECAB3 N-terminal EF-hand calcium binding protein 3 2 2
MIRT461977 PACSIN1 protein kinase C and casein kinase substrate in neurons 1 2 2
MIRT462271 TPI1 triosephosphate isomerase 1 2 2
MIRT462304 PPM1H protein phosphatase, Mg2+/Mn2+ dependent 1H 2 2
MIRT462725 SEMA4G semaphorin 4G 2 2
MIRT463414 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT463525 ZBTB7B zinc finger and BTB domain containing 7B 2 2
MIRT464089 VPS4A vacuolar protein sorting 4 homolog A 2 2
MIRT464623 UBE4B ubiquitination factor E4B 2 2
MIRT465030 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT465562 TOB2 transducer of ERBB2, 2 2 2
MIRT465890 TMEM43 transmembrane protein 43 2 2
MIRT466428 TFAP2A transcription factor AP-2 alpha 2 8
MIRT466593 TBC1D2B TBC1 domain family member 2B 2 2
MIRT467623 SLC7A5 solute carrier family 7 member 5 2 2
MIRT468511 SESN2 sestrin 2 2 2
MIRT468649 SEH1L SEH1 like nucleoporin 2 2
MIRT468737 SDC4 syndecan 4 2 2
MIRT468752 SDC2 syndecan 2 2 2
MIRT469182 RNF111 ring finger protein 111 2 2
MIRT469476 REEP5 receptor accessory protein 5 2 2
MIRT472078 NOVA2 NOVA alternative splicing regulator 2 2 2
MIRT472093 NOLC1 nucleolar and coiled-body phosphoprotein 1 2 2
MIRT472194 NHP2L1 small nuclear ribonucleoprotein 13 2 2
MIRT472453 NAV2 neuron navigator 2 2 6
MIRT474493 KLHDC8B kelch domain containing 8B 2 2
MIRT475174 IP6K1 inositol hexakisphosphate kinase 1 2 2
MIRT475350 IFNLR1 interferon lambda receptor 1 2 2
MIRT476474 GATAD2B GATA zinc finger domain containing 2B 2 2
MIRT477094 FAM168A family with sequence similarity 168 member A 2 2
MIRT477179 F3 coagulation factor III, tissue factor 2 6
MIRT478026 DNAJC8 DnaJ heat shock protein family (Hsp40) member C8 2 2
MIRT479587 CDC42SE1 CDC42 small effector 1 2 2
MIRT480117 CALR calreticulin 2 2
MIRT480465 C11orf84 chromosome 11 open reading frame 84 2 2
MIRT480803 BLOC1S2 biogenesis of lysosomal organelles complex 1 subunit 2 2 6
MIRT481076 B4GALT1 beta-1,4-galactosyltransferase 1 2 2
MIRT482576 ABHD2 abhydrolase domain containing 2 2 2
MIRT482690 NXN nucleoredoxin 2 4
MIRT483599 SLC26A9 solute carrier family 26 member 9 2 2
MIRT485011 TNRC6B trinucleotide repeat containing 6B 2 4
MIRT488051 PABPC1L2B poly(A) binding protein cytoplasmic 1 like 2B 2 2
MIRT488067 PABPC1L2A poly(A) binding protein cytoplasmic 1 like 2A 2 2
MIRT488176 PRRC2B proline rich coiled-coil 2B 2 4
MIRT488859 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT489074 STARD3 StAR related lipid transfer domain containing 3 2 2
MIRT489181 ANKRD45 ankyrin repeat domain 45 2 2
MIRT489981 DDB1 damage specific DNA binding protein 1 2 2
MIRT490225 WRN Werner syndrome RecQ like helicase 2 2
MIRT491084 HILPDA hypoxia inducible lipid droplet associated 2 2
MIRT491540 HDAC5 histone deacetylase 5 2 2
MIRT492540 PSMD11 proteasome 26S subunit, non-ATPase 11 2 2
MIRT499034 MAG myelin associated glycoprotein 2 2
MIRT499420 PLCG2 phospholipase C gamma 2 2 4
MIRT499820 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT500046 SDE2 SDE2 telomere maintenance homolog 2 6
MIRT500844 SYPL1 synaptophysin like 1 2 4
MIRT504518 PPP1R9B protein phosphatase 1 regulatory subunit 9B 2 2
MIRT505622 SLC25A37 solute carrier family 25 member 37 2 2
MIRT509134 STK4 serine/threonine kinase 4 2 2
MIRT509219 BUB3 BUB3, mitotic checkpoint protein 2 4
MIRT510752 SLC7A1 solute carrier family 7 member 1 2 2
MIRT512115 CREBZF CREB/ATF bZIP transcription factor 2 2
MIRT512317 ACTR2 ARP2 actin related protein 2 homolog 2 6
MIRT517395 BGN biglycan 2 4
MIRT518412 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 2 4
MIRT521362 RPL35A ribosomal protein L35a 2 2
MIRT525072 FRK fyn related Src family tyrosine kinase 2 2
MIRT525800 SOD2 superoxide dismutase 2 2 2
MIRT530430 SULT1B1 sulfotransferase family 1B member 1 2 2
MIRT541467 AURKA aurora kinase A 2 2
MIRT544303 TSPYL1 TSPY like 1 2 2
MIRT546415 SPRED3 sprouty related EVH1 domain containing 3 2 2
MIRT546582 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT548764 CNN3 calponin 3 2 2
MIRT549809 KIAA0391 KIAA0391 2 2
MIRT550611 MTHFR methylenetetrahydrofolate reductase 2 2
MIRT552227 FIG4 FIG4 phosphoinositide 5-phosphatase 2 4
MIRT554008 SPTLC1 serine palmitoyltransferase long chain base subunit 1 2 2
MIRT554116 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 2 2
MIRT555100 PURB purine rich element binding protein B 2 2
MIRT560290 HRH2 histamine receptor H2 2 2
MIRT560381 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT560800 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT560978 IWS1 IWS1, SUPT6H interacting protein 2 2
MIRT561161 BCL2L12 BCL2 like 12 2 2
MIRT562389 EN2 engrailed homeobox 2 2 2
MIRT562482 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT567784 DGAT2 diacylglycerol O-acyltransferase 2 2 2
MIRT568831 TRIM67 tripartite motif containing 67 2 2
MIRT569555 UNC119B unc-119 lipid binding chaperone B 2 2
MIRT572382 ATOX1 antioxidant 1 copper chaperone 2 2
MIRT575792 Tnfrsf10b tumor necrosis factor receptor superfamily, member 10b 2 2
MIRT610505 CTBS chitobiase 2 4
MIRT616605 PAPD5 poly(A) RNA polymerase D5, non-canonical 2 2
MIRT621780 TMEM87B transmembrane protein 87B 2 2
MIRT634217 TMEM192 transmembrane protein 192 2 2
MIRT639651 WHAMM WAS protein homolog associated with actin, golgi membranes and microtubules 2 2
MIRT642500 ALDOA aldolase, fructose-bisphosphate A 2 2
MIRT643217 TYW3 tRNA-yW synthesizing protein 3 homolog 2 4
MIRT674822 KCNJ10 potassium voltage-gated channel subfamily J member 10 2 2
MIRT697356 ZNF426 zinc finger protein 426 2 2
MIRT704675 CHTOP chromatin target of PRMT1 2 2
MIRT708704 TFDP2 transcription factor Dp-2 2 2
MIRT709660 DFFB DNA fragmentation factor subunit beta 2 2
MIRT711280 SDR9C7 short chain dehydrogenase/reductase family 9C member 7 2 2
MIRT713733 SUCO SUN domain containing ossification factor 2 2
MIRT715006 TSPAN11 tetraspanin 11 2 2
MIRT718400 ALDH1A3 aldehyde dehydrogenase 1 family member A3 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miR-4476 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4476 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-4476 Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-4476 Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-4476 Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-mir-4476 Androstenedione 6128 NSC9563 resistant cell line (MCF-7)
hsa-mir-4476 Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-4476 Androstenedione+Letrozole resistant cell line (MCF-7)
hsa-miR-4476 Temozolomide 5394 NSC362856 approved sensitive cell line (U251)
hsa-miR-4476 Paclitaxel 36314 NSC125973 approved sensitive cell line (HS578T)
hsa-miR-4476 Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-4476 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-4476 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4476 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-4476 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission