miRTarBase - #MIRT267010


—
pre-miRNA Information
pre-miRNA hsa-mir-656   
Genomic Coordinates chr14: 101066724 - 101066801
Synonyms MIRN656, hsa-mir-656, MIR656
Description Homo sapiens miR-656 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-656-3p
Sequence 43| AAUAUUAUACAGUCAACCUCU |63
Evidence Experimental
Experiments Microarray
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs774217405 2 dbSNP
rs761669303 7 dbSNP
rs767470396 8 dbSNP
rs563910660 14 dbSNP
rs1289907362 17 dbSNP
rs1329300008 19 dbSNP
rs375626394 20 dbSNP
rs185468172 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ZDHHC5   
Synonyms DHHC5, ZNF375
Description zinc finger DHHC-type containing 5
Transcript NM_015457   
Expression
Putative miRNA Targets on ZDHHC5
3'UTR of ZDHHC5
(miRNA target sites are highlighted)		 
>ZDHHC5|NM_015457|3'UTR
   1 GCCTTCGGCACCTCCCCTCCCCAACGCCTCTGCGCCTACACCAAAGGGCCCCAGGTGGCCACCTTCCTTCCCTCAAGGGG
  81 CTCCCCTCCCGTGCATGGACATTTTTTAAACCACCGATTCCAAGAGGATGAGGAGTGTTTTCTAAAATGCAGTAGGCTTG
 161 GGGAGTCGGAGAGTTGGGGCCCTGAGACTGGGGTAGCAACCCCCCCTTTTATCTTTTAAGACCTTCCCTTCCTTGATCCC
 241 TGGACCAGACTCAGTGGACATTTGTGCAATTGCTCGCCCTGGAGGGAACCAGATCATTTTTAAACCAGAAATAATTTTTT
 321 TTATTATTGTTACGGATTCTATTTTTTTCCTCTTCTGCGTTACCAGGTGTGTGTGTACATATAATATATATATATATATA
 401 TTATAAATATCAAAGAAATTATATATCTATCCTGGGATGGGAAAATGAGGGAGGGATACATATACGGAGGGGGATCTTAC
 481 TCTTCCCATTCCTCAGACCAGCAGGAAAAGAGGGGAGACGTCAGTCTTTTTCCTGTGGTTCCCTCTCATTTGTCCCAGTT
 561 ACTAACTACGGAAATAGCATCCTCTGCTGGTGCTAAGTGTGATTAGGAAGAAGCCTGGGGAGAGGTGAGTCTGGAATTTT
 641 GGTCACAAGAGGGAAGGACTTGGAGAGGAGAATTAGTTTTCTAGGCTCATTGGCATTTAGTTTCCCTAGGAAAGGGGTCA
 721 AAACTTCAAGACACTGGTGGTGGTGGGAGATCAGGAAAATAACTTGGCCTAGCTCAAACAATATTGGATAATCCCCTCCT
 801 TGGGGGAGAGGGATTAGAGTGTGCTCCTACTGGCCCCTTGGAGCCTCCCCTAGCTTACACAGTTAACTTGATTTTAAAAT
 881 CCAAGGCCAGGAGAGAAGAATCCAAAAAGCAATATTTTTCATCACATGCCAAAAACGGGGGATAGAGAGAAGGAGTGGCA
 961 GGCCTAGGCCCCTCCGATTGTCCCTTGGGGGTTACCCCTCAGCCCACCTCACTATGGTGCTGGGTAGAGGGGATACCTGG
1041 GTTCTAACCTCTAAATAGGGGAGATCCCAGCCTCCACAAAGAGGCCCTTTTATTTTTTATTCTGATTAGCCATTTTAAAC
1121 CAACGAGGAATAAAAAGAAATCCTGATCTAACCAGCAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucUCCA-ACUGAC----AUAUUAUAa 5'
            |||| ||  ||    |||||||| 
Target 5' ccAGGTGTGTGTGTACATATAATATa 3'
 363 - 388 157.00 -6.94
2 
miRNA  3' ucUCCAACU------GACAUAUUAUAa 5'
            ||| |||      :| | ||| || 
Target 5' agAGGATGAGGAGTGTTTTCTAAAATg 3'
 123 - 149 93.00 -8.06
3 
miRNA  3' ucUCCAACUGACAUAUUAUAa 5'
            |||  ||:  || |:|:| 
Target 5' agAGG--GAT--TAGAGTGTg 3'
 807 - 823 87.00 -9.04
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN28861570 29 COSMIC
COSN30164211 31 COSMIC
COSN30761986 35 COSMIC
COSN30145065 36 COSMIC
COSN28758325 187 COSMIC
COSN29467966 277 COSMIC
COSN26643687 278 COSMIC
COSN32062025 402 COSMIC
COSN7014773 467 COSMIC
COSN31539470 521 COSMIC
COSN24900733 525 COSMIC
COSN31590600 614 COSMIC
COSN28709076 682 COSMIC
COSN8584270 682 COSMIC
COSN31603633 702 COSMIC
COSN31596324 794 COSMIC
COSN24823874 845 COSMIC
COSN28758008 894 COSMIC
COSN28638248 1127 COSMIC
COSN31513712 1137 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs760716857 2 dbSNP
rs926864588 4 dbSNP
rs764199512 6 dbSNP
rs754070531 7 dbSNP
rs530650676 8 dbSNP
rs200117655 11 dbSNP
rs765382865 13 dbSNP
rs750225456 18 dbSNP
rs1488481131 23 dbSNP
rs376192237 24 dbSNP
rs1208590491 25 dbSNP
rs779883003 25 dbSNP
rs370314176 26 dbSNP
rs374038596 27 dbSNP
rs367986917 34 dbSNP
rs747814809 35 dbSNP
rs1042423140 37 dbSNP
rs1003018673 38 dbSNP
rs769574039 40 dbSNP
rs1300617283 41 dbSNP
rs544848422 45 dbSNP
rs746256502 51 dbSNP
rs1482979842 53 dbSNP
rs113438323 54 dbSNP
rs1187067974 55 dbSNP
rs1358077662 64 dbSNP
rs563072034 72 dbSNP
rs1417008240 76 dbSNP
rs1021542860 82 dbSNP
rs578260699 84 dbSNP
rs996246810 91 dbSNP
rs900407308 92 dbSNP
rs1256508960 110 dbSNP
rs1210977181 116 dbSNP
rs1030861577 117 dbSNP
rs954552900 131 dbSNP
rs983325336 133 dbSNP
rs907788028 134 dbSNP
rs1341536861 145 dbSNP
rs963259473 154 dbSNP
rs886246094 159 dbSNP
rs777279157 161 dbSNP
rs545695706 168 dbSNP
rs186968752 169 dbSNP
rs971090599 172 dbSNP
rs1352219254 175 dbSNP
rs947738137 180 dbSNP
rs749685518 181 dbSNP
rs1001192526 182 dbSNP
rs1465762791 189 dbSNP
rs1377676938 191 dbSNP
rs1185609907 193 dbSNP
rs1033964953 198 dbSNP
rs1256830915 200 dbSNP
rs959869519 200 dbSNP
rs371268180 201 dbSNP
rs1316245157 205 dbSNP
rs1260224393 206 dbSNP
rs751150913 206 dbSNP
rs112723301 212 dbSNP
rs938844527 221 dbSNP
rs548684500 223 dbSNP
rs1314103542 224 dbSNP
rs1053181653 245 dbSNP
rs560675239 246 dbSNP
rs1330004758 253 dbSNP
rs978188101 259 dbSNP
rs1402090556 261 dbSNP
rs1215942473 263 dbSNP
rs1243741271 264 dbSNP
rs374462812 270 dbSNP
rs531302092 271 dbSNP
rs1043716218 277 dbSNP
rs549605761 278 dbSNP
rs571117196 287 dbSNP
rs1166851623 290 dbSNP
rs1417163697 301 dbSNP
rs900488382 303 dbSNP
rs1237493904 306 dbSNP
rs1039429921 315 dbSNP
rs1178173845 315 dbSNP
rs1383734054 315 dbSNP
rs996605129 318 dbSNP
rs1030415377 321 dbSNP
rs1182734956 323 dbSNP
rs890580895 324 dbSNP
rs1208244559 329 dbSNP
rs1385640460 332 dbSNP
rs921932944 334 dbSNP
rs1004981210 338 dbSNP
rs1309152390 342 dbSNP
rs1315729921 342 dbSNP
rs1048938231 348 dbSNP
rs1407598981 352 dbSNP
rs761292789 356 dbSNP
rs1320447388 359 dbSNP
rs781157668 360 dbSNP
rs1452567831 363 dbSNP
rs1004714801 367 dbSNP
rs1337726052 367 dbSNP
rs1045540894 368 dbSNP
rs1159149822 373 dbSNP
rs149110165 376 dbSNP
rs1001229607 381 dbSNP
rs1197036708 383 dbSNP
rs1491513075 383 dbSNP
rs10633679 384 dbSNP
rs1231890022 384 dbSNP
rs759646421 384 dbSNP
rs963217704 384 dbSNP
rs34110973 385 dbSNP
rs1331389906 388 dbSNP
rs138094238 392 dbSNP
rs1247653126 399 dbSNP
rs1491478335 401 dbSNP
rs1491299857 402 dbSNP
rs1326538217 403 dbSNP
rs868633633 403 dbSNP
rs1298753509 404 dbSNP
rs1023995996 405 dbSNP
rs1022543555 412 dbSNP
rs1223845237 416 dbSNP
rs969078407 419 dbSNP
rs1378475480 423 dbSNP
rs190229110 424 dbSNP
rs1477060027 426 dbSNP
rs912000651 430 dbSNP
rs966120493 441 dbSNP
rs767029045 445 dbSNP
rs1489595011 450 dbSNP
rs182445440 458 dbSNP
rs1199440262 461 dbSNP
rs921936858 464 dbSNP
rs1176590786 466 dbSNP
rs1278525312 467 dbSNP
rs1401608449 479 dbSNP
rs866148578 481 dbSNP
rs1333403068 483 dbSNP
rs1227183926 486 dbSNP
rs1049487179 487 dbSNP
rs1402944226 489 dbSNP
rs1174550832 495 dbSNP
rs907783455 500 dbSNP
rs2956980 520 dbSNP
rs1045569950 523 dbSNP
rs913374157 528 dbSNP
rs1469701840 538 dbSNP
rs1442516928 543 dbSNP
rs534233979 544 dbSNP
rs1177813725 546 dbSNP
rs1409004448 548 dbSNP
rs1257583608 559 dbSNP
rs1196367195 564 dbSNP
rs947585743 570 dbSNP
rs745756836 571 dbSNP
rs1220290094 575 dbSNP
rs900791625 579 dbSNP
rs1448595390 580 dbSNP
rs1341149184 582 dbSNP
rs1328677429 583 dbSNP
rs931994591 586 dbSNP
rs1052167981 588 dbSNP
rs1442498982 590 dbSNP
rs1467543916 599 dbSNP
rs1280749006 600 dbSNP
rs1163200563 612 dbSNP
rs555777289 614 dbSNP
rs937098947 615 dbSNP
rs186895390 620 dbSNP
rs1456913882 625 dbSNP
rs1783979 627 dbSNP
rs1015043309 647 dbSNP
rs1022533033 647 dbSNP
rs556656677 648 dbSNP
rs191335096 649 dbSNP
rs573240140 661 dbSNP
rs902755790 662 dbSNP
rs1306965548 663 dbSNP
rs539108587 665 dbSNP
rs779756699 667 dbSNP
rs999709573 668 dbSNP
rs1332330018 671 dbSNP
rs1019086466 675 dbSNP
rs995117232 690 dbSNP
rs1323385736 694 dbSNP
rs1023543449 696 dbSNP
rs1406303657 709 dbSNP
rs1368059182 710 dbSNP
rs969676755 728 dbSNP
rs982053898 739 dbSNP
rs545235411 741 dbSNP
rs1380323737 748 dbSNP
rs956386202 753 dbSNP
rs1029074645 760 dbSNP
rs114728264 765 dbSNP
rs1245756993 769 dbSNP
rs749484276 785 dbSNP
rs1464572656 789 dbSNP
rs1167641061 793 dbSNP
rs182641182 795 dbSNP
rs907814425 796 dbSNP
rs1353098981 797 dbSNP
rs968857013 798 dbSNP
rs1309982549 800 dbSNP
rs1225533385 803 dbSNP
rs979374851 805 dbSNP
rs922133571 811 dbSNP
rs981326951 813 dbSNP
rs928459922 817 dbSNP
rs1296910997 819 dbSNP
rs1419568751 819 dbSNP
rs932189029 820 dbSNP
rs542258855 821 dbSNP
rs1361730040 830 dbSNP
rs937150034 835 dbSNP
rs560537280 837 dbSNP
rs531168465 841 dbSNP
rs1052033215 842 dbSNP
rs188783024 846 dbSNP
rs1191377573 861 dbSNP
rs1478900895 865 dbSNP
rs564608565 867 dbSNP
rs1192856806 871 dbSNP
rs940694633 875 dbSNP
rs947065346 883 dbSNP
rs768977808 890 dbSNP
rs1288054683 904 dbSNP
rs143262971 913 dbSNP
rs899282108 914 dbSNP
rs1310485639 927 dbSNP
rs994938426 928 dbSNP
rs1255966472 931 dbSNP
rs2969941 937 dbSNP
rs71484458 938 dbSNP
rs1276775791 942 dbSNP
rs1291114280 944 dbSNP
rs193249911 944 dbSNP
rs1445219567 948 dbSNP
rs999742524 948 dbSNP
rs1034929521 951 dbSNP
rs1490267055 958 dbSNP
rs529943168 959 dbSNP
rs1029518240 962 dbSNP
rs772253660 962 dbSNP
rs549443325 976 dbSNP
rs567675904 977 dbSNP
rs141487300 979 dbSNP
rs1325994791 985 dbSNP
rs984847749 990 dbSNP
rs1009228262 991 dbSNP
rs1318993552 994 dbSNP
rs185330509 1016 dbSNP
rs1298406512 1017 dbSNP
rs147487820 1018 dbSNP
rs1374201234 1023 dbSNP
rs1476576903 1024 dbSNP
rs1302986712 1027 dbSNP
rs1161897835 1029 dbSNP
rs1190400599 1030 dbSNP
rs1454103970 1037 dbSNP
rs879070538 1041 dbSNP
rs1397729432 1045 dbSNP
rs968170081 1047 dbSNP
rs761201097 1049 dbSNP
rs1374533576 1054 dbSNP
rs1162612006 1065 dbSNP
rs1303164597 1067 dbSNP
rs1414432208 1072 dbSNP
rs1472306438 1073 dbSNP
rs922072658 1075 dbSNP
rs539246596 1077 dbSNP
rs1462686730 1093 dbSNP
rs1236616211 1100 dbSNP
rs879722165 1103 dbSNP
rs1481175077 1108 dbSNP
rs1253381884 1109 dbSNP
rs1243068248 1113 dbSNP
rs1321702251 1115 dbSNP
rs958817753 1117 dbSNP
rs991321061 1121 dbSNP
rs988108725 1124 dbSNP
rs190181991 1125 dbSNP
rs554066922 1126 dbSNP
rs924285475 1135 dbSNP
rs1358921693 1148 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Disease 25921.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1 "HITS-CLIP data was present in GSM714643. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 25921.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM714642
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000287169.3 | 3UTR | UACAUAUAAUAUAUAUAUAUAUAUAUUAUAAAUAUCAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714643
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000287169.3 | 3UTR | UAUAAUAUAUAUAUAUAUAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000287169.3 | 3UTR | CAUAUAAUAUAUAUAUAUAUAUAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000287169.3 | 3UTR | UACAUAUAAUAUAUAUAUAUAUAUAUUAUAAAUAUCAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000287169.3 | 3UTR | UACAUAUAAUAUAUAUAUAUAUAUAUUAUAAAUAUCAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000287169.3 | 3UTR | UACAUAUAAUAUAUAUAUAUAUAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC -0.413 0.01 -0.367 0.01 36 Click to see details
BLCA 0.456 0.03 0.412 0.05 17 Click to see details
UCEC -0.431 0.07 -0.308 0.15 13 Click to see details
LIHC 0.239 0.08 0.209 0.11 35 Click to see details
KIRC -0.42 0.15 -0.524 0.09 8 Click to see details
KIRP -0.385 0.15 -0.400 0.14 9 Click to see details
KICH -0.445 0.19 -0.257 0.31 6 Click to see details
PRAD -0.124 0.23 -0.218 0.09 39 Click to see details
BRCA -0.038 0.39 -0.075 0.29 56 Click to see details
ESCA -0.12 0.4 0.214 0.32 7 Click to see details
STAD 0.051 0.4 -0.063 0.38 26 Click to see details
PAAD -0.174 0.41 -0.200 0.4 4 Click to see details
PCPG -0.216 0.43 -0.500 0.33 3 Click to see details
THCA -0.052 0.44 0.175 0.29 12 Click to see details
CHOL 0.074 0.44 -0.314 0.27 6 Click to see details
CESC -0.114 0.46 -0.500 0.33 3 Click to see details
LUSC 0.016 0.47 -0.029 0.45 24 Click to see details
LUAD -0.019 0.49 0.086 0.44 6 Click to see details
LUAD -0.019 0.49 0.086 0.44 6 Click to see details
117 hsa-miR-656-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT054590 BMPR1A bone morphogenetic protein receptor type 1A 3 1
MIRT070954 ZFP36L1 ZFP36 ring finger protein like 1 2 2
MIRT080090 C18ORF25 chromosome 18 open reading frame 25 2 6
MIRT107594 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 8
MIRT113091 CCND2 cyclin D2 2 2
MIRT156603 COQ10B coenzyme Q10B 2 2
MIRT216714 SCAMP1 secretory carrier membrane protein 1 2 2
MIRT261132 TRIM8 tripartite motif containing 8 2 2
MIRT262930 ARID5B AT-rich interaction domain 5B 2 4
MIRT267010 ZDHHC5 zinc finger DHHC-type containing 5 2 6
MIRT338333 IKZF4 IKAROS family zinc finger 4 2 6
MIRT378852 ITGB8 integrin subunit beta 8 2 2
MIRT441577 EXOC5 exocyst complex component 5 2 2
MIRT441972 RNF41 ring finger protein 41 2 2
MIRT442617 PPP3R1 protein phosphatase 3 regulatory subunit B, alpha 2 2
MIRT447730 DGKH diacylglycerol kinase eta 2 2
MIRT449237 KIAA0408 KIAA0408 2 2
MIRT449884 PRMT7 protein arginine methyltransferase 7 2 2
MIRT452912 ZNF138 zinc finger protein 138 2 2
MIRT458867 CD55 CD55 molecule (Cromer blood group) 2 2
MIRT480582 BUB3 BUB3, mitotic checkpoint protein 2 2
MIRT483118 SH3BP5 SH3 domain binding protein 5 2 2
MIRT493755 GNG5 G protein subunit gamma 5 2 8
MIRT504369 ARID1B AT-rich interaction domain 1B 2 4
MIRT505523 SPATA2 spermatogenesis associated 2 2 10
MIRT505628 SLC16A1 solute carrier family 16 member 1 2 6
MIRT506382 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 4
MIRT507045 HIC2 HIC ZBTB transcriptional repressor 2 2 6
MIRT507416 ELK4 ELK4, ETS transcription factor 2 4
MIRT508194 PTP4A2 protein tyrosine phosphatase type IVA, member 2 2 6
MIRT508599 CREB1 cAMP responsive element binding protein 1 2 6
MIRT508617 HOXC4 homeobox C4 2 8
MIRT508692 NRIP1 nuclear receptor interacting protein 1 2 4
MIRT509017 CUL2 cullin 2 2 8
MIRT509079 RABGAP1 RAB GTPase activating protein 1 2 10
MIRT509970 CRIM1 cysteine rich transmembrane BMP regulator 1 2 4
MIRT510172 STARD8 StAR related lipid transfer domain containing 8 2 8
MIRT510370 ZNF703 zinc finger protein 703 2 6
MIRT510667 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 2
MIRT511116 NFIB nuclear factor I B 2 6
MIRT511357 ITPRIPL2 inositol 1,4,5-trisphosphate receptor interacting protein like 2 2 6
MIRT511423 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 6
MIRT512295 AMER1 APC membrane recruitment protein 1 2 6
MIRT514084 MGAT4C MGAT4 family member C 2 4
MIRT516900 RAI1 retinoic acid induced 1 2 4
MIRT516944 SLC35F6 solute carrier family 35 member F6 2 8
MIRT518816 AKAP8 A-kinase anchoring protein 8 2 4
MIRT519244 TNFSF9 TNF superfamily member 9 2 4
MIRT519573 ZXDA zinc finger, X-linked, duplicated A 2 6
MIRT519870 ZFP62 ZFP62 zinc finger protein 2 6
MIRT520892 STRN striatin 2 4
MIRT520963 SPSB1 splA/ryanodine receptor domain and SOCS box containing 1 2 6
MIRT521932 PHF8 PHD finger protein 8 2 10
MIRT522188 NR2C2 nuclear receptor subfamily 2 group C member 2 2 6
MIRT523594 FZD5 frizzled class receptor 5 2 4
MIRT523810 FAM19A1 family with sequence similarity 19 member A1, C-C motif chemokine like 2 4
MIRT527780 DNAJC21 DnaJ heat shock protein family (Hsp40) member C21 2 2
MIRT528048 ID4 inhibitor of DNA binding 4, HLH protein 2 2
MIRT528241 SPIN4 spindlin family member 4 2 2
MIRT534474 SAR1B secretion associated Ras related GTPase 1B 2 2
MIRT538907 BRI3BP BRI3 binding protein 2 2
MIRT540705 PDPK1 3-phosphoinositide dependent protein kinase 1 2 4
MIRT542593 ZBTB18 zinc finger and BTB domain containing 18 2 4
MIRT543065 BACH2 BTB domain and CNC homolog 2 2 4
MIRT543491 MDM2 MDM2 proto-oncogene 2 2
MIRT544063 KIAA1462 junctional cadherin 5 associated 2 2
MIRT545530 NEDD4L neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase 2 2
MIRT546703 RORA RAR related orphan receptor A 2 4
MIRT548248 FBXW7 F-box and WD repeat domain containing 7 2 2
MIRT549271 ASH1L ASH1 like histone lysine methyltransferase 2 2
MIRT549402 AKAP11 A-kinase anchoring protein 11 2 2
MIRT550252 EIF2B1 eukaryotic translation initiation factor 2B subunit alpha 2 2
MIRT550552 ARSK arylsulfatase family member K 2 2
MIRT550793 WARS2 tryptophanyl tRNA synthetase 2, mitochondrial 2 2
MIRT551098 TTC8 tetratricopeptide repeat domain 8 2 2
MIRT551417 LRRC31 leucine rich repeat containing 31 2 2
MIRT551883 EPHA1 EPH receptor A1 2 2
MIRT552558 ZFP36L2 ZFP36 ring finger protein like 2 2 2
MIRT553764 TAGLN2 transgelin 2 2 2
MIRT553817 SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein 2 2
MIRT554978 RAB5C RAB5C, member RAS oncogene family 2 2
MIRT556427 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT556464 LMNB2 lamin B2 2 4
MIRT559180 BRAP BRCA1 associated protein 2 2
MIRT559549 ARGLU1 arginine and glutamate rich 1 2 2
MIRT560578 ZNF460 zinc finger protein 460 2 2
MIRT561173 TMEM30A transmembrane protein 30A 2 2
MIRT563712 SVIP small VCP interacting protein 2 4
MIRT564563 CCDC80 coiled-coil domain containing 80 2 2
MIRT567650 EXOC8 exocyst complex component 8 2 2
MIRT568539 ALKBH5 alkB homolog 5, RNA demethylase 2 2
MIRT571343 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 2 2
MIRT573904 SRP9 signal recognition particle 9 2 2
MIRT611915 RAB3GAP1 RAB3 GTPase activating protein catalytic subunit 1 2 2
MIRT612269 SEMA3F semaphorin 3F 2 2
MIRT614457 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT615492 AJAP1 adherens junctions associated protein 1 2 4
MIRT639515 FYB FYN binding protein 1 2 2
MIRT674959 PEX2 peroxisomal biogenesis factor 2 2 2
MIRT687808 KATNAL1 katanin catalytic subunit A1 like 1 2 2
MIRT698408 TM9SF3 transmembrane 9 superfamily member 3 2 2
MIRT698527 TFRC transferrin receptor 2 2
MIRT702313 L1CAM L1 cell adhesion molecule 2 4
MIRT707252 SIK3 SIK family kinase 3 2 2
MIRT707265 RRAGC Ras related GTP binding C 2 2
MIRT707519 HHIP hedgehog interacting protein 2 2
MIRT707529 CXCL5 C-X-C motif chemokine ligand 5 2 2
MIRT707762 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT707793 TTYH3 tweety family member 3 2 2
MIRT707815 TMEM178B transmembrane protein 178B 2 2
MIRT708108 HERPUD2 HERPUD family member 2 2 2
MIRT708173 C16orf52 chromosome 16 open reading frame 52 2 2
MIRT711910 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT714484 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT715016 LIN9 lin-9 DREAM MuvB core complex component 2 2
MIRT715669 SCOC short coiled-coil protein 2 2
MIRT725386 METTL8 methyltransferase like 8 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-656 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-656 Fluorouracil 3385 NSC19893 approved resistant cell line (KYSE)
hsa-mir-656 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-656-3p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-656-3p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (NCM460, SW480, RKO, DLD1, SW48, HCT-116, LOVO, HT-29, HCT8, SW620)
hsa-miR-656-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-656-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-656-3p Tripterygium wilfordii Hook F sensitive tissue
hsa-miR-656-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-656-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-656-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-656-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM47)
hsa-miR-656-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-656-3p Sunitinib 5329102 NSC750690 approved sensitive tissue (CardB)
hsa-miR-656-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-656-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-656-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission