miRTarBase - #MIRT281810


—
pre-miRNA Information
pre-miRNA hsa-mir-451b   
Genomic Coordinates chr17: 28861371 - 28861438
Description Homo sapiens miR-451b stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-451b
Sequence 7| UAGCAAGAGAACCAUUACCAUU |28
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 2 17 + 28861378 16594986, 27587585 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs761024330 13 dbSNP
rs1173019348 17 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MAP2K1   
Synonyms CFC3, MAPKK1, MEK1, MKK1, PRKMK1
Description mitogen-activated protein kinase kinase 1
Transcript NM_002755   
Expression
Putative miRNA Targets on MAP2K1
3'UTR of MAP2K1
(miRNA target sites are highlighted)		 
>MAP2K1|NM_002755|3'UTR
   1 GTGTTTGGGAAGCAACAAAGAGCGAGTCCCCTGCCCGGTGGTTTGCCATGTCGCTTTTGGGCCTCCTTCCCATGCCTGTC
  81 TCTGTTCAGATGTGCATTTCACCTGTGACAAAGGATGAAGAACACAGCATGTGCCAAGATTCTACTCTTGTCATTTTTAA
 161 TATTACTGTCTTTATTCTTATTACTATTATTGTTCCCCTAAGTGGATTGGCTTTGTGCTTGGGGCTATTTGTGTGTATGC
 241 TGATGATCAAAACCTGTGCCAGGCTGAATTACAGTGAAATTTTGGTGAATGTGGGTAGTCATTCTTACAATTGCACTGCT
 321 GTTCCTGCTCCATGACTGGCTGTCTGCCTGTATTTTCGGGATTCTTTGACATTTGGTGGTACTTTATTCTTGCTGGGCAT
 401 ACTTTCTCTCTAGGAGGGAGCCTTGTGAGATCCTTCACAGGCAGTGCATGTGAAGCATGCTTTGCTGCTATGAAAATGAG
 481 CATCAGAGAGTGTACATCATGTTATTTTATTATTATTATTTGCTTTTCATGTAGAACTCAGCAGTTGACATCCAAATCTA
 561 GCCAGAGCCCTTCACTGCCATGATAGCTGGGGCTTCACCAGTCTGTCTACTGTGGTGATCTGTAGACTTCTGGTTGTATT
 641 TCTATATTTATTTTCAGTATACTGTGTGGGATACTTAGTGGTATGTCTCTTTAAGTTTTGATTAATGTTTCTTAAATGGA
 721 ATTATTTTGAATGTCACAAATTGATCAAGATATTAAAATGTCGGATTTATCTTTCCCCATATCCAAGTACCAATGCTGTT
 801 GTAAACAACGTGTATAGTGCCTAAAATTGTATGAAAATCCTTTTAACCATTTTAACCTAGATGTTTAACAAATCTAATCT
 881 CTTATTCTAATAAATATACTATGAAATAAAAAAAAAAGGATGAAAGCTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uuACCAUUACCAA--GAGAACGAu 5'
            ||||::|  ||  :||||||| 
Target 5' ttTGGTGGTACTTTATTCTTGCTg 3'
 372 - 395 162.00 -15.30
2 
miRNA  3' uuaccaUUACCAAGAGAACGau 5'
                :||  | ||||||:  
Target 5' tgccaaGATTCTACTCTTGTca 3'
 132 - 153 116.00 -7.20
3 
miRNA  3' uuaccAUU-ACC-AA--GAGA-ACGAu 5'
               ||| ||| ||  ||:| |||| 
Target 5' tccccTAAGTGGATTGGCTTTGTGCTt 3'
 194 - 220 111.00 -11.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
316839 148 ClinVar
316849 908 ClinVar
316850 908 ClinVar
COSN5756077 10 COSMIC
COSN13634431 25 COSMIC
COSN30181030 38 COSMIC
COSN30160029 118 COSMIC
COSN30530219 120 COSMIC
COSN31542546 169 COSMIC
COSN26554838 637 COSMIC
COSN31514049 740 COSMIC
COSN31561694 764 COSMIC
COSN1682607 894 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1318932276 3 dbSNP
rs1445596534 7 dbSNP
rs1191089664 9 dbSNP
rs1388311751 13 dbSNP
rs1422535238 17 dbSNP
rs777783461 18 dbSNP
rs376181437 24 dbSNP
rs1023819747 25 dbSNP
rs749220939 27 dbSNP
rs771041748 31 dbSNP
rs774452900 32 dbSNP
rs574828384 37 dbSNP
rs775193561 38 dbSNP
rs540533521 41 dbSNP
rs763625326 43 dbSNP
rs776051290 46 dbSNP
rs761330415 49 dbSNP
rs766828156 51 dbSNP
rs372452427 53 dbSNP
rs755282867 54 dbSNP
rs978417415 58 dbSNP
rs756795713 59 dbSNP
rs1270038654 61 dbSNP
rs767930298 64 dbSNP
rs752962298 65 dbSNP
rs1264694706 66 dbSNP
rs756331255 67 dbSNP
rs369901206 73 dbSNP
rs1159168621 76 dbSNP
rs777889018 80 dbSNP
rs749280724 82 dbSNP
rs576922968 83 dbSNP
rs1229160685 85 dbSNP
rs757416394 87 dbSNP
rs1365900526 89 dbSNP
rs778934345 92 dbSNP
rs757367010 97 dbSNP
rs1367022676 99 dbSNP
rs778371173 102 dbSNP
rs1282574802 113 dbSNP
rs956370086 114 dbSNP
rs1437046680 124 dbSNP
rs1314139458 127 dbSNP
rs771988141 128 dbSNP
rs960707594 134 dbSNP
rs1319856811 136 dbSNP
rs1240035768 138 dbSNP
rs1432806231 139 dbSNP
rs1292971861 145 dbSNP
rs745540522 148 dbSNP
rs987848214 148 dbSNP
rs1224284436 150 dbSNP
rs1164884301 155 dbSNP
rs373707256 157 dbSNP
rs1409034916 161 dbSNP
rs1404179557 175 dbSNP
rs1411228028 178 dbSNP
rs916689128 178 dbSNP
rs1451771566 179 dbSNP
rs922999751 181 dbSNP
rs1287945864 185 dbSNP
rs1248998558 187 dbSNP
rs1330153502 188 dbSNP
rs1230466885 190 dbSNP
rs941519942 194 dbSNP
rs1276517617 206 dbSNP
rs1311700917 208 dbSNP
rs1222407506 209 dbSNP
rs879660920 211 dbSNP
rs986342896 217 dbSNP
rs1230847663 228 dbSNP
rs918833757 228 dbSNP
rs1239762507 232 dbSNP
rs930207107 236 dbSNP
rs1225829478 238 dbSNP
rs1294003943 241 dbSNP
rs886051367 246 dbSNP
rs546295504 254 dbSNP
rs181822467 260 dbSNP
rs866878741 279 dbSNP
rs890100403 281 dbSNP
rs184860087 288 dbSNP
rs1038788277 294 dbSNP
rs1168365976 295 dbSNP
rs1427040419 298 dbSNP
rs1427903583 299 dbSNP
rs1192232240 305 dbSNP
rs900285094 306 dbSNP
rs14303 309 dbSNP
rs1022088957 311 dbSNP
rs1173833787 313 dbSNP
rs1207635608 317 dbSNP
rs1423800878 321 dbSNP
rs902351947 325 dbSNP
rs999419432 329 dbSNP
rs1202805906 333 dbSNP
rs1313692681 338 dbSNP
rs371021779 340 dbSNP
rs1301959827 341 dbSNP
rs372877813 344 dbSNP
rs1178109937 345 dbSNP
rs929950049 351 dbSNP
rs1409838118 352 dbSNP
rs1012232852 353 dbSNP
rs1047088155 358 dbSNP
rs561736994 359 dbSNP
rs1308333252 371 dbSNP
rs949514883 374 dbSNP
rs1045171300 383 dbSNP
rs528023985 390 dbSNP
rs772667633 401 dbSNP
rs1414390821 405 dbSNP
rs190094372 405 dbSNP
rs1427744108 422 dbSNP
rs1184446126 423 dbSNP
rs56366941 426 dbSNP
rs1032536857 433 dbSNP
rs1411844958 450 dbSNP
rs181853123 457 dbSNP
rs1256360474 459 dbSNP
rs918732191 468 dbSNP
rs892747780 469 dbSNP
rs1009616533 472 dbSNP
rs1228503968 485 dbSNP
rs1269867559 485 dbSNP
rs1349280573 496 dbSNP
rs1286123511 502 dbSNP
rs1219938891 507 dbSNP
rs1303806556 507 dbSNP
rs1397415078 507 dbSNP
rs1030015054 509 dbSNP
rs1465797997 516 dbSNP
rs1404578783 523 dbSNP
rs954569648 529 dbSNP
rs552268563 531 dbSNP
rs1457883149 538 dbSNP
rs1411292187 542 dbSNP
rs747416216 543 dbSNP
rs1157278107 546 dbSNP
rs1425766477 548 dbSNP
rs1257047746 553 dbSNP
rs1281332843 558 dbSNP
rs879611202 561 dbSNP
rs963208023 567 dbSNP
rs987049047 571 dbSNP
rs1209251101 580 dbSNP
rs1327909973 581 dbSNP
rs1205082681 589 dbSNP
rs568999981 591 dbSNP
rs147974693 593 dbSNP
rs973258138 597 dbSNP
rs944344776 602 dbSNP
rs1395835969 604 dbSNP
rs1381014872 608 dbSNP
rs1196351476 610 dbSNP
rs886051368 615 dbSNP
rs886051369 616 dbSNP
rs1245723942 626 dbSNP
rs1323189486 634 dbSNP
rs1388068295 645 dbSNP
rs375853830 645 dbSNP
rs1287202363 649 dbSNP
rs8684 658 dbSNP
rs1369298179 667 dbSNP
rs1164284775 675 dbSNP
rs1416771374 677 dbSNP
rs1391751036 679 dbSNP
rs1448853388 683 dbSNP
rs929253045 684 dbSNP
rs570295657 690 dbSNP
rs755632888 693 dbSNP
rs983166113 706 dbSNP
rs946415330 707 dbSNP
rs1259495751 714 dbSNP
rs773070290 724 dbSNP
rs574442434 733 dbSNP
rs902320143 738 dbSNP
rs1422472995 740 dbSNP
rs1357834319 747 dbSNP
rs186510658 751 dbSNP
rs999790561 752 dbSNP
rs949465115 761 dbSNP
rs553748886 764 dbSNP
rs1388614239 766 dbSNP
rs896441986 770 dbSNP
rs1276753884 772 dbSNP
rs1363098715 776 dbSNP
rs905309165 777 dbSNP
rs11540657 778 dbSNP
rs1293201029 779 dbSNP
rs770655370 781 dbSNP
rs1023554173 782 dbSNP
rs758446727 785 dbSNP
rs962696082 788 dbSNP
rs191261480 794 dbSNP
rs14538 797 dbSNP
rs1344790732 804 dbSNP
rs892686251 810 dbSNP
rs545708663 811 dbSNP
rs1433307455 812 dbSNP
rs1266055566 816 dbSNP
rs74022018 817 dbSNP
rs1483837829 820 dbSNP
rs1274826373 821 dbSNP
rs1030374268 824 dbSNP
rs1026169607 828 dbSNP
rs890122976 830 dbSNP
rs1268980943 840 dbSNP
rs576168372 858 dbSNP
rs571144374 861 dbSNP
rs541916514 864 dbSNP
rs1282741449 878 dbSNP
rs912813559 880 dbSNP
rs1352598475 886 dbSNP
rs1308814759 889 dbSNP
rs180838974 889 dbSNP
rs138560168 891 dbSNP
rs548081932 898 dbSNP
rs767501618 902 dbSNP
rs1189179875 903 dbSNP
rs1466481264 907 dbSNP
rs886051370 908 dbSNP
rs886051371 908 dbSNP
rs921569769 908 dbSNP
rs946392719 908 dbSNP
rs199531879 918 dbSNP
rs77444537 920 dbSNP
rs1252113273 925 dbSNP
rs1180974868 930 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uuaccauuaccAAGAGAACGAu 5'
                     | :||||||| 
Target 5' --------cuuUAUUCUUGCUg 3'
 		1 - 14
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000307102.5 | 3UTR | CUUUAUUCUUGCUGGGCAUACUUUCUCUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
124 hsa-miR-451b Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT060018 VANGL2 VANGL planar cell polarity protein 2 2 4
MIRT069874 SRP54 signal recognition particle 54 2 2
MIRT088316 RAB10 RAB10, member RAS oncogene family 2 4
MIRT100747 VEGFA vascular endothelial growth factor A 5 12
MIRT152236 ZNF460 zinc finger protein 460 2 2
MIRT198492 USP14 ubiquitin specific peptidase 14 2 6
MIRT204750 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT211209 FGF2 fibroblast growth factor 2 2 2
MIRT234352 MSL1 male specific lethal 1 homolog 2 8
MIRT281810 MAP2K1 mitogen-activated protein kinase kinase 1 2 2
MIRT369113 CKMT1A creatine kinase, mitochondrial 1A 2 2
MIRT401349 C5ORF51 chromosome 5 open reading frame 51 2 4
MIRT441509 ERN1 endoplasmic reticulum to nucleus signaling 1 2 2
MIRT441888 RD3 retinal degeneration 3 2 4
MIRT443549 GPR35 G protein-coupled receptor 35 2 2
MIRT444959 ADAM22 ADAM metallopeptidase domain 22 2 2
MIRT445808 NFATC2 nuclear factor of activated T-cells 2 2 2
MIRT446509 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT447457 ST18 ST18, C2H2C-type zinc finger 2 2
MIRT448296 ZDHHC3 zinc finger DHHC-type containing 3 2 2
MIRT463178 ZNF281 zinc finger protein 281 2 2
MIRT466606 TBC1D13 TBC1 domain family member 13 2 2
MIRT467235 SPRED1 sprouty related EVH1 domain containing 1 2 2
MIRT471039 PISD phosphatidylserine decarboxylase 2 10
MIRT471892 NUAK2 NUAK family kinase 2 2 2
MIRT474151 LIMA1 LIM domain and actin binding 1 2 6
MIRT474155 LIFR LIF receptor alpha 2 2
MIRT481037 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 2
MIRT483083 GPR75 G protein-coupled receptor 75 2 4
MIRT485208 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 8
MIRT495187 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 2 2
MIRT495431 ATG7 autophagy related 7 2 2
MIRT499160 FAM83C family with sequence similarity 83 member C 2 6
MIRT499505 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 2 2
MIRT500400 ZMAT3 zinc finger matrin-type 3 2 10
MIRT500684 TRIM37 tripartite motif containing 37 2 2
MIRT501301 RPS6KB1 ribosomal protein S6 kinase B1 2 2
MIRT504339 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT505931 RCAN3 RCAN family member 3 2 4
MIRT513196 SLU7 SLU7 homolog, splicing factor 2 2
MIRT521807 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT522779 LAMP2 lysosomal associated membrane protein 2 2 6
MIRT530179 ZBED2 zinc finger BED-type containing 2 2 2
MIRT532397 SNX3 sorting nexin 3 2 2
MIRT532482 HOXA13 homeobox A13 2 2
MIRT532538 WDR13 WD repeat domain 13 2 2
MIRT534779 RAN RAN, member RAS oncogene family 2 2
MIRT535719 N4BP1 NEDD4 binding protein 1 2 2
MIRT539310 AKAP12 A-kinase anchoring protein 12 2 4
MIRT539877 RPL32 ribosomal protein L32 2 2
MIRT539891 IRGQ immunity related GTPase Q 2 2
MIRT540063 CEP104 centrosomal protein 104 2 2
MIRT540154 GTF2B general transcription factor IIB 2 4
MIRT540206 ARHGAP18 Rho GTPase activating protein 18 2 2
MIRT540391 CRTC1 CREB regulated transcription coactivator 1 2 2
MIRT540595 ERCC1 ERCC excision repair 1, endonuclease non-catalytic subunit 2 4
MIRT540733 FABP2 fatty acid binding protein 2 2 2
MIRT540949 SLC25A43 solute carrier family 25 member 43 2 2
MIRT541444 C18orf32 chromosome 18 open reading frame 32 2 4
MIRT541571 ZNF43 zinc finger protein 43 2 4
MIRT541601 ALOX15 arachidonate 15-lipoxygenase 2 2
MIRT541933 ORC1 origin recognition complex subunit 1 2 4
MIRT542394 WDR12 WD repeat domain 12 2 2
MIRT542414 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT542481 APOC3 apolipoprotein C3 2 2
MIRT542621 XIAP X-linked inhibitor of apoptosis 2 2
MIRT542976 FAM83F family with sequence similarity 83 member F 2 2
MIRT543741 DHCR7 7-dehydrocholesterol reductase 2 2
MIRT544594 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT546441 SNX5 sorting nexin 5 2 2
MIRT548213 FKBP1A FK506 binding protein 1A 2 2
MIRT550471 OSCAR osteoclast associated, immunoglobulin-like receptor 2 4
MIRT555230 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 4
MIRT555428 PPAP2B phospholipid phosphatase 3 2 2
MIRT556368 MAF MAF bZIP transcription factor 2 2
MIRT558149 ELK4 ELK4, ETS transcription factor 2 2
MIRT566181 PTPN14 protein tyrosine phosphatase, non-receptor type 14 2 2
MIRT568468 ARMC12 armadillo repeat containing 12 2 2
MIRT607594 TANGO2 transport and golgi organization 2 homolog 2 2
MIRT617588 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT621244 SIGLEC9 sialic acid binding Ig like lectin 9 2 4
MIRT623679 HOXD4 homeobox D4 2 2
MIRT625989 FGFR1OP FGFR1 oncogene partner 2 4
MIRT627244 ZBTB3 zinc finger and BTB domain containing 3 2 2
MIRT632946 ELOVL6 ELOVL fatty acid elongase 6 2 4
MIRT635872 SLC11A2 solute carrier family 11 member 2 2 2
MIRT636638 CHAF1B chromatin assembly factor 1 subunit B 2 2
MIRT643563 WDR73 WD repeat domain 73 2 2
MIRT647907 CIRH1A UTP4, small subunit processome component 2 2
MIRT652503 TMEM170A transmembrane protein 170A 2 2
MIRT652843 TACO1 translational activator of cytochrome c oxidase I 2 2
MIRT653299 SMUG1 single-strand-selective monofunctional uracil-DNA glycosylase 1 2 2
MIRT659383 CREG2 cellular repressor of E1A stimulated genes 2 2 2
MIRT661339 TBC1D15 TBC1 domain family member 15 2 2
MIRT662372 ANKRD42 ankyrin repeat domain 42 2 2
MIRT664322 CD209 CD209 molecule 2 2
MIRT671759 F11R F11 receptor 2 2
MIRT673240 KLHDC8A kelch domain containing 8A 2 2
MIRT682871 C9orf156 tRNA methyltransferase O 2 2
MIRT683171 SF3A1 splicing factor 3a subunit 1 2 2
MIRT684262 TBXA2R thromboxane A2 receptor 2 2
MIRT684395 MCTS1 MCTS1, re-initiation and release factor 2 2
MIRT684883 P4HB prolyl 4-hydroxylase subunit beta 2 2
MIRT686650 TMEM184C transmembrane protein 184C 2 2
MIRT687771 KIAA0355 KIAA0355 2 2
MIRT694352 CHST6 carbohydrate sulfotransferase 6 2 2
MIRT696347 SLC35D2 solute carrier family 35 member D2 2 2
MIRT700480 PUM1 pumilio RNA binding family member 1 2 2
MIRT705909 ADAM9 ADAM metallopeptidase domain 9 2 2
MIRT714076 FNDC3B fibronectin type III domain containing 3B 2 2
MIRT714401 FBXO31 F-box protein 31 2 2
MIRT716442 RPS24 ribosomal protein S24 2 2
MIRT718204 PSMF1 proteasome inhibitor subunit 1 2 2
MIRT721238 CRCP CGRP receptor component 2 2
MIRT721271 SH3D19 SH3 domain containing 19 2 2
MIRT721603 ZNF484 zinc finger protein 484 2 2
MIRT722916 COA4 cytochrome c oxidase assembly factor 4 homolog 2 2
MIRT723457 CUL4A cullin 4A 2 2
MIRT733813 KREMEN1 kringle containing transmembrane protein 1 2 0
MIRT733814 CASK calcium/calmodulin dependent serine protein kinase 2 0
MIRT733815 KLF4 Kruppel like factor 4 2 0
MIRT733816 BCL2 BCL2, apoptosis regulator 2 0
MIRT733817 PCNA proliferating cell nuclear antigen 2 0
MIRT733818 BAX BCL2 associated X, apoptosis regulator 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-451b Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780CIS)
hsa-miR-451b Trastuzumab sensitive High HER2-Positive Breast Cancer tissue
hsa-mir-451b Cisplatin 5460033 NSC119875 approved sensitive cell line (CP20)
hsa-mir-451b Cisplatin 5460033 NSC119875 approved sensitive cell line (CIS)
hsa-miR-451b Neoadjuvant chemotherapy sensitive tissue (breast cancer)

Error report submission