>TERF2IP|NM_018975|3'UTR
   1 TTGGCAAGATAATGAGAAAAGAAAAAAGTCATGGTAGGTGAGGTGGTTAAAAAAAATTGTGACCAATGAACTTTAGAGAG
  81 TTCTTGCATTGGAACTGGCACTTATTTTCTGACCATCGCTGCTGTTGCTCTGTGAGTCCTAGATTTTTGTAGCCAAGCAG
 161 AGTTGTAGAGGGGGATAAAAAGAAAAGAAATTGGATGTATTTACAGCTGTCCTTGAACAAGTATCAATGTGTTTATGAAA
 241 GGAAGATCTAAATCAGACAGGAGTTGGTCTACATAGTAGTAATCCATTGTTGGAATGGAACCCTTGCTATAGTAGTGACA
 321 AAGTGAAAGGAAATTTAGGAGGCATAGGCCATTTCAGGCAGCATAAGTAATCTCCTGTCCTTTGGCAGAAGCTCCTTTAG
 401 ATTGGGATAGATTCCAAATAAAGAATCTAGAAATAGGAGAAGATTTAATTATGAGGCCTTGAACACGGATTATCCCCAAA
 481 CCCTTGTCATTTCCCCCAGTGAGCTCTGATTTCTAGACTGCTTTGAAAATGCTGTATTCATTTTGCTAACTTAGTATTTG
 561 GGTACCCTGCTCTTTGGCTGTTCTTTTTTTGGAGCCCTTCTCAGTCAAGTCTGCCGGATGTCTTTCTTTACCTACCCCTC
 641 AGTTTTCCTTAAAACGCGCACACAACTCTAGAGAGTGTTAAGAATAATGTTACTTGGTTAATGTGTTATTTATTGAGTAT
 721 TGTTTGTGCTAAGCATTGTGTTAGATTTAAAAAATTAGTGGATTGACTCCACTTTGTTGTGTTGTTTTCATTGTTGAAAA
 801 TAAATATAACTTTGTATTCGAGTCTCGTCAAAAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' uuUUCAUUAAUGUCAAAAa 5' | ||| |||||| | | Target 5' ggATGTATTTACAGCTGTc 3'	193 - 211	105.00	-5.23
2	miRNA 3' uuUUCAUUAAUGUCAAaaa 5' |:||:| :::||| Target 5' gtAGGTGA-GGTGGTTaaa 3'	34 - 51	80.00	-5.03

Mutant ID	Mutant Position	Mutant Source
COSN21192725	2	COSMIC
COSN26998300	40	COSMIC
COSN30118944	45	COSMIC
COSN31492689	88	COSMIC
COSN31525514	188	COSMIC
COSN18937796	219	COSMIC
COSN31961239	352	COSMIC
COSN5411838	541	COSMIC
COSN22508891	633	COSMIC
COSN7271605	735	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs145177251	1	dbSNP
rs199596670	4	dbSNP
rs780194201	6	dbSNP
rs1206080215	9	dbSNP
rs1264384699	11	dbSNP
rs1445747342	14	dbSNP
rs1193160740	15	dbSNP
rs1332389903	17	dbSNP
rs1419245237	17	dbSNP
rs751471311	19	dbSNP
rs770287626	21	dbSNP
rs773676067	22	dbSNP
rs543971435	23	dbSNP
rs779236005	24	dbSNP
rs748995836	27	dbSNP
rs1034228721	28	dbSNP
rs770470672	29	dbSNP
rs748639482	30	dbSNP
rs1313370565	31	dbSNP
rs772636447	32	dbSNP
rs773702576	33	dbSNP
rs1291578439	34	dbSNP
rs377354294	37	dbSNP
rs1174441055	42	dbSNP
rs188012863	43	dbSNP
rs1262844441	47	dbSNP
rs758952216	49	dbSNP
rs773954934	49	dbSNP
rs576255798	50	dbSNP
rs1186437425	55	dbSNP
rs1447174424	57	dbSNP
rs765521113	58	dbSNP
rs1006031220	65	dbSNP
rs1014705158	72	dbSNP
rs542027587	76	dbSNP
rs1275238722	85	dbSNP
rs192591533	88	dbSNP
rs549970644	91	dbSNP
rs1226131041	106	dbSNP
rs572338846	111	dbSNP
rs976187065	118	dbSNP
rs183658113	119	dbSNP
rs1221239711	120	dbSNP
rs879589505	122	dbSNP
rs1287367818	125	dbSNP
rs372525429	133	dbSNP
rs532775987	136	dbSNP
rs549419958	137	dbSNP
rs1360074460	140	dbSNP
rs187619079	141	dbSNP
rs1428405171	143	dbSNP
rs1392526061	147	dbSNP
rs1188643005	150	dbSNP
rs1422669566	173	dbSNP
rs1224152474	179	dbSNP
rs867192703	180	dbSNP
rs1253715830	184	dbSNP
rs985692625	188	dbSNP
rs779983053	193	dbSNP
rs1483478134	207	dbSNP
rs1250529130	219	dbSNP
rs1247687680	226	dbSNP
rs375856547	228	dbSNP
rs911444238	235	dbSNP
rs1275186411	249	dbSNP
rs1229299383	253	dbSNP
rs1339939031	258	dbSNP
rs1310892372	259	dbSNP
rs1397979603	264	dbSNP
rs192816216	267	dbSNP
rs549589398	271	dbSNP
rs752676443	273	dbSNP
rs936203515	274	dbSNP
rs1372960031	278	dbSNP
rs1054536010	281	dbSNP
rs1366170928	291	dbSNP
rs1457031037	291	dbSNP
rs1392063053	302	dbSNP
rs1450240104	307	dbSNP
rs566223137	308	dbSNP
rs913348813	311	dbSNP
rs1424056917	312	dbSNP
rs1250568013	313	dbSNP
rs946147122	315	dbSNP
rs578014885	336	dbSNP
rs1252531144	344	dbSNP
rs1209131172	345	dbSNP
rs1355786998	346	dbSNP
rs150763950	348	dbSNP
rs879943448	349	dbSNP
rs1322559001	356	dbSNP
rs1407303456	359	dbSNP
rs1287898411	364	dbSNP
rs1408445444	366	dbSNP
rs1352710857	375	dbSNP
rs138025937	376	dbSNP
rs887674420	378	dbSNP
rs1432781800	380	dbSNP
rs1294809675	386	dbSNP
rs1457914066	387	dbSNP
rs1006096793	388	dbSNP
rs1473472114	390	dbSNP
rs962152795	391	dbSNP
rs1212239177	395	dbSNP
rs111634375	398	dbSNP
rs1468953987	398	dbSNP
rs953084634	407	dbSNP
rs1226766299	420	dbSNP
rs985746290	425	dbSNP
rs1018506661	428	dbSNP
rs1281927363	435	dbSNP
rs1357976057	436	dbSNP
rs777899475	437	dbSNP
rs1329865512	438	dbSNP
rs1469342372	443	dbSNP
rs1303982518	448	dbSNP
rs990314539	451	dbSNP
rs913411368	458	dbSNP
rs1318186565	467	dbSNP
rs142824586	468	dbSNP
rs11556641	469	dbSNP
rs1171786358	474	dbSNP
rs574093286	475	dbSNP
rs1379356261	477	dbSNP
rs146103190	485	dbSNP
rs1454797138	486	dbSNP
rs928683364	492	dbSNP
rs555564686	496	dbSNP
rs1466446449	498	dbSNP
rs1285141634	502	dbSNP
rs752453772	504	dbSNP
rs140021449	505	dbSNP
rs1343301880	516	dbSNP
rs1186850661	525	dbSNP
rs770572609	528	dbSNP
rs1365039197	544	dbSNP
rs1294805820	548	dbSNP
rs937355335	560	dbSNP
rs1365487273	561	dbSNP
rs1333079340	568	dbSNP
rs1412609536	571	dbSNP
rs1055800278	572	dbSNP
rs375108390	583	dbSNP
rs887726588	586	dbSNP
rs941932027	588	dbSNP
rs199546803	592	dbSNP
rs1473870414	595	dbSNP
rs10308	601	dbSNP
rs1036650151	609	dbSNP
rs778631144	615	dbSNP
rs541279404	616	dbSNP
rs184950115	617	dbSNP
rs866605736	618	dbSNP
rs1441093318	624	dbSNP
rs1455506721	629	dbSNP
rs372904811	633	dbSNP
rs771670823	634	dbSNP
rs777562523	635	dbSNP
rs888848237	635	dbSNP
rs1161117356	636	dbSNP
rs577191710	641	dbSNP
rs749266007	641	dbSNP
rs774840803	642	dbSNP
rs1395416475	645	dbSNP
rs543031949	649	dbSNP
rs190202248	654	dbSNP
rs563030981	656	dbSNP
rs377037876	657	dbSNP
rs957668474	658	dbSNP
rs990367014	659	dbSNP
rs1020933771	660	dbSNP
rs1170402723	661	dbSNP
rs967587215	664	dbSNP
rs1278656398	666	dbSNP
rs769322263	668	dbSNP
rs1471948625	671	dbSNP
rs549310785	675	dbSNP
rs1189108633	676	dbSNP
rs1482925124	679	dbSNP
rs1250333165	683	dbSNP
rs982005457	684	dbSNP
rs559934676	685	dbSNP
rs1226883904	688	dbSNP
rs1270428868	690	dbSNP
rs1330381677	694	dbSNP
rs1226081488	698	dbSNP
rs779084742	706	dbSNP
rs1276563721	711	dbSNP
rs777230788	723	dbSNP
rs1444239322	726	dbSNP
rs1348395750	727	dbSNP
rs1309825070	730	dbSNP
rs1188505149	738	dbSNP
rs1442860314	738	dbSNP
rs149357328	739	dbSNP
rs369498526	740	dbSNP
rs571132688	744	dbSNP
rs1416300730	746	dbSNP
rs1184028449	749	dbSNP
rs1165917607	762	dbSNP
rs1472491492	768	dbSNP
rs937399320	769	dbSNP
rs1412462103	772	dbSNP
rs991535394	773	dbSNP
rs762284491	778	dbSNP
rs1246570599	780	dbSNP
rs1218760518	782	dbSNP
rs1452825154	786	dbSNP
rs549562926	788	dbSNP
rs1207683483	791	dbSNP
rs1326878774	792	dbSNP
rs1290014898	794	dbSNP
rs1224062887	799	dbSNP
rs1366832555	799	dbSNP
rs1272987719	811	dbSNP
rs1465461171	820	dbSNP

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome biology, 2014

BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.