miRTarBase - #MIRT287615


—
pre-miRNA Information
pre-miRNA hsa-mir-3942   
Genomic Coordinates chr15: 35372256 - 35372364
Description Homo sapiens miR-3942 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3942-3p
Sequence 65| UUUCAGAUAACAGUAUUACAU |85
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 5 15 - 35372296 29233923 MiREDiBase
A-to-I 10 15 - 35372291 23291724, 29233923 MiREDiBase
A-to-I 18 15 - 35372283 23291724, 29233923 MiREDiBase
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN1674243 19 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1043666670 6 dbSNP
rs1264147291 18 dbSNP
rs1223363654 20 dbSNP
Putative Targets

Gene Information
Gene Symbol NPEPPS   
Synonyms AAP-S, MP100, PSA
Description aminopeptidase puromycin sensitive
Transcript NM_006310   
Expression
Putative miRNA Targets on NPEPPS
3'UTR of NPEPPS
(miRNA target sites are highlighted)		 
>NPEPPS|NM_006310|3'UTR
   1 ATCCTGAGGTGCCGCCATTGGCGGTTCTGCTGCTTCGCTGCAGGGATAAGGTGGAGCTACCGAACAGCTGATTCATATGC
  81 CAAGAATTTGGAGTCTTCTTTCAAACCAGTGGGGGTTGGACAATGAATGTAGTTAACTGGTTCCTGCTCACACTCCAGAA
 161 TTAAATTCTATTGAAAAAGGAAAATCAGCAATTCAGCAAAAAATAAATAAAAAATAAAAATGTAAATATGATAGTAATAA
 241 AATAGAGCATAACGAAACTGTGAAACTTTCTGAAGCCTTGTCAGTGGTTAAAAGTATTTAACACTCTACTGTTAATGACA
 321 GATGTTCTGTTTTTATAACCTACCAAAAGGAAACTAGAGGCTTCTTGGTGAAGAGCATTTTTGTGAAGTGGGTTCTGCAA
 401 GGAGCCTATAAAGCCAAGGGTGGTGTCCATTTCTGGGAATGGTTAAACACAAAAGGCTGATAGCTGGTATCACATAGTTG
 481 GAGTCAGTGCATAATTCCAAGTGGCTTTTTTTTTTTTTGGCACGGGGACTGATCAGGAAGATATATTCCTGCATAACTCA
 561 ATCTGAACCAAGGATTGTAGTTTAGTTTTCCTCCTTGCCTTCCCTTCTGTGTGACCGACCCCTTGGCCAAAAAAAAACAA
 641 AAAGCAAAAAACAAAAACCTACCCTGTTCTGGTTTTTTTCCTCCCTTTAGTTCCACCCCCAACCCCCATTCCCTGGTGTC
 721 CTTCTTAGAGATGAAGAAATAATAAGGAAACATCTTTCATAGCCACATTAAATAAGAGAAACTGATATACATTATTTTTT
 801 TCTTTTTAAAGATGACTTATAAGAACCCTGAAATTTATATAGGTGAGACAATAGAAATAAAAAGATCTTCAGCCAGGCCT
 881 TTCTGAAGGAGTTATTCTGCTAAAAATGGTCTTAGTTGTCTGAAAAGCCAGCTCTTGAACCTCTTCACAACAGTATCAAC
 961 ACTGGCTTCTCCCGGTTCATTTTATGCGTGCGAGAAGTCAGTGGTAACTGCTGCAGGGCTTAATACATTAGTGGTAACTG
1041 GTTTAAAAAACAAAGACTGTAAGCCTGTGTGTGCCACTGTTTGCTTCAACAGTATATCCTAATAAGCCTCACCTATTTAA
1121 TCCAATGAGTTTTAAATCTAAATCTCATTCCCTTCTTCTTTCCCTACCTTTTTTTTCTTTTTTTCTTAAAAAAATATTTT
1201 GTGTTATTAACAGAAATTCATATTTGGTGTGGCTTAACGGTATTTCAGAAGGTCATCAGATTGTGAGACTGCTTCCTTGA
1281 AACATTTTTGTGCTATTGTTTTAAAAAAATAATTAAAAAACAGTTGGCGTTAATAAAAATGTCAATGTGAAACTGAAAAA
1361 AAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uacAUUAUGA-CAAUAGACUUu 5'
             |::| :| |||:|||||| 
Target 5' aaaTGGTCTTAGTTGTCTGAAa 3'
 904 - 925 146.00 -12.42
2 
miRNA  3' uacauUA-UGACAAUAGACUUu 5'
               || |||   ||||||| 
Target 5' cctgcATAACT-CAATCTGAAc 3'
 548 - 568 143.00 -6.10
3 
miRNA  3' uaCAUUAUGACAAUAGACUUu 5'
            ||:| ||| |  |||||| 
Target 5' ctGTGAAACT-T--TCTGAAg 3'
 258 - 275 129.00 -10.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31527033 6 COSMIC
COSN26986856 15 COSMIC
COSN30178011 25 COSMIC
COSN17489732 47 COSMIC
COSN26648834 50 COSMIC
COSN31606304 75 COSMIC
COSN8837652 159 COSMIC
COSN31487542 195 COSMIC
COSN31563585 255 COSMIC
COSN31480318 273 COSMIC
COSN31565215 332 COSMIC
COSN31564932 363 COSMIC
COSN20114051 519 COSMIC
COSN31486659 560 COSMIC
COSN31548077 670 COSMIC
COSN30545148 734 COSMIC
COSN20296637 935 COSMIC
COSN20114052 1102 COSMIC
COSN31520890 1106 COSMIC
COSN20467445 1123 COSMIC
COSN30587770 1177 COSMIC
COSN31532670 1177 COSMIC
COSN31575972 1195 COSMIC
COSN19534195 1239 COSMIC
COSN31528407 1310 COSMIC
COSN31482541 1321 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs774511140 2 dbSNP
rs761756611 6 dbSNP
rs767566250 14 dbSNP
rs1313181319 15 dbSNP
rs751139571 17 dbSNP
rs1173415533 19 dbSNP
rs773223548 20 dbSNP
rs1461781711 21 dbSNP
rs1296733760 22 dbSNP
rs760673351 23 dbSNP
rs766339983 24 dbSNP
rs1021725923 25 dbSNP
rs149267740 25 dbSNP
rs754725558 25 dbSNP
rs1353882650 26 dbSNP
rs754684842 30 dbSNP
rs764761486 31 dbSNP
rs1296181686 37 dbSNP
rs752258993 38 dbSNP
rs1336830758 43 dbSNP
rs1338692898 44 dbSNP
rs1224967682 47 dbSNP
rs1311986055 49 dbSNP
rs1257475611 51 dbSNP
rs1015336989 52 dbSNP
rs1269028105 61 dbSNP
rs111492806 62 dbSNP
rs962564361 66 dbSNP
rs1399802167 78 dbSNP
rs954242515 79 dbSNP
rs368206440 84 dbSNP
rs1413845364 89 dbSNP
rs1164562165 91 dbSNP
rs1210876131 94 dbSNP
rs1474051048 96 dbSNP
rs1236242413 97 dbSNP
rs1006911173 100 dbSNP
rs1488837457 103 dbSNP
rs1265543482 110 dbSNP
rs1277389931 111 dbSNP
rs1020016695 114 dbSNP
rs567598443 116 dbSNP
rs536602461 117 dbSNP
rs1446712054 124 dbSNP
rs930895920 125 dbSNP
rs556588263 134 dbSNP
rs966019177 142 dbSNP
rs915936785 146 dbSNP
rs1292632544 152 dbSNP
rs1218964605 153 dbSNP
rs1342117959 154 dbSNP
rs975965797 157 dbSNP
rs1444304356 171 dbSNP
rs1429585969 176 dbSNP
rs1350168885 180 dbSNP
rs950018138 192 dbSNP
rs576642911 201 dbSNP
rs903263407 201 dbSNP
rs1474452136 205 dbSNP
rs1190678567 223 dbSNP
rs548374813 227 dbSNP
rs934700641 230 dbSNP
rs1390647664 231 dbSNP
rs1185206513 232 dbSNP
rs1475176631 242 dbSNP
rs1247516732 249 dbSNP
rs1434027563 254 dbSNP
rs1449963270 256 dbSNP
rs1171476667 259 dbSNP
rs1272677991 259 dbSNP
rs1199160007 277 dbSNP
rs539258699 280 dbSNP
rs1276051315 293 dbSNP
rs1414872171 296 dbSNP
rs892939251 296 dbSNP
rs1276277722 303 dbSNP
rs984553266 317 dbSNP
rs996745236 322 dbSNP
rs34314592 327 dbSNP
rs757053589 348 dbSNP
rs890828884 351 dbSNP
rs747442625 362 dbSNP
rs948449997 376 dbSNP
rs1297714563 382 dbSNP
rs1044090086 392 dbSNP
rs1426077059 398 dbSNP
rs928275007 403 dbSNP
rs559223234 404 dbSNP
rs961161687 406 dbSNP
rs572663108 407 dbSNP
rs1053361601 413 dbSNP
rs1347553236 419 dbSNP
rs1201432358 424 dbSNP
rs1203504494 426 dbSNP
rs1027843555 433 dbSNP
rs1280526841 436 dbSNP
rs892018491 443 dbSNP
rs569863983 451 dbSNP
rs952173141 458 dbSNP
rs149109100 461 dbSNP
rs916157421 463 dbSNP
rs950068716 465 dbSNP
rs1043595162 475 dbSNP
rs1448365202 481 dbSNP
rs889901177 484 dbSNP
rs1210592401 491 dbSNP
rs560192363 492 dbSNP
rs1360080045 498 dbSNP
rs369565339 505 dbSNP
rs1176524495 506 dbSNP
rs1248263524 506 dbSNP
rs57585141 506 dbSNP
rs796072799 506 dbSNP
rs879039677 506 dbSNP
rs893002573 511 dbSNP
rs1191644704 513 dbSNP
rs1379338891 515 dbSNP
rs1208490417 519 dbSNP
rs1478230871 520 dbSNP
rs1157840341 521 dbSNP
rs1382252046 522 dbSNP
rs1458492581 524 dbSNP
rs932481241 525 dbSNP
rs190680892 542 dbSNP
rs767101980 545 dbSNP
rs1305721005 550 dbSNP
rs1322114215 552 dbSNP
rs1391318359 554 dbSNP
rs552338624 562 dbSNP
rs1234409108 574 dbSNP
rs1304899156 578 dbSNP
rs1279338469 595 dbSNP
rs774110830 605 dbSNP
rs1375029740 616 dbSNP
rs1421801240 618 dbSNP
rs891047244 620 dbSNP
rs755545688 621 dbSNP
rs1424269189 629 dbSNP
rs879074100 629 dbSNP
rs1230486008 632 dbSNP
rs1269060745 633 dbSNP
rs1485235527 636 dbSNP
rs1218302482 638 dbSNP
rs747999757 638 dbSNP
rs1468064542 639 dbSNP
rs1007374517 650 dbSNP
rs1259613727 658 dbSNP
rs1019647649 663 dbSNP
rs896790740 670 dbSNP
rs995290899 673 dbSNP
rs1181875507 682 dbSNP
rs1231787625 686 dbSNP
rs1355196947 692 dbSNP
rs746306135 695 dbSNP
rs562660393 703 dbSNP
rs1299230146 708 dbSNP
rs1026721400 715 dbSNP
rs901182302 717 dbSNP
rs952223544 721 dbSNP
rs181526426 722 dbSNP
rs551244423 724 dbSNP
rs1473341191 729 dbSNP
rs1159419982 738 dbSNP
rs1162676136 753 dbSNP
rs994092123 759 dbSNP
rs1416771697 760 dbSNP
rs1459414285 768 dbSNP
rs1023097763 773 dbSNP
rs1195650300 783 dbSNP
rs1426306846 788 dbSNP
rs971679986 789 dbSNP
rs1164557783 795 dbSNP
rs1270775736 809 dbSNP
rs1393425673 815 dbSNP
rs1212329113 821 dbSNP
rs1026194460 825 dbSNP
rs372371302 837 dbSNP
rs924652386 844 dbSNP
rs956224001 852 dbSNP
rs17609248 853 dbSNP
rs1348989295 857 dbSNP
rs1412108071 861 dbSNP
rs1387613179 867 dbSNP
rs1369782924 868 dbSNP
rs1289213284 871 dbSNP
rs1460847703 872 dbSNP
rs367570351 879 dbSNP
rs1334511395 884 dbSNP
rs1016492452 892 dbSNP
rs1372092851 896 dbSNP
rs749741703 903 dbSNP
rs980250847 906 dbSNP
rs375614287 913 dbSNP
rs928359274 921 dbSNP
rs1485803622 940 dbSNP
rs17677508 944 dbSNP
rs988446468 952 dbSNP
rs1254825136 958 dbSNP
rs552229891 974 dbSNP
rs553067928 975 dbSNP
rs1188856525 977 dbSNP
rs1468379361 977 dbSNP
rs1259308655 979 dbSNP
rs1211863933 985 dbSNP
rs1420839915 986 dbSNP
rs143209825 988 dbSNP
rs779291559 989 dbSNP
rs756584904 992 dbSNP
rs1037339241 993 dbSNP
rs896847079 998 dbSNP
rs1373761732 1001 dbSNP
rs1401909835 1003 dbSNP
rs1289449134 1005 dbSNP
rs1361195507 1007 dbSNP
rs1380402994 1015 dbSNP
rs748464036 1017 dbSNP
rs1348283960 1022 dbSNP
rs1233170546 1025 dbSNP
rs1198080544 1026 dbSNP
rs1277730269 1027 dbSNP
rs1355308454 1028 dbSNP
rs1215888023 1035 dbSNP
rs1389652049 1036 dbSNP
rs901229846 1040 dbSNP
rs1173008403 1041 dbSNP
rs1467246785 1045 dbSNP
rs995573027 1051 dbSNP
rs201093336 1052 dbSNP
rs749565799 1052 dbSNP
rs1011967593 1053 dbSNP
rs1185245665 1054 dbSNP
rs1255332495 1058 dbSNP
rs1454965633 1059 dbSNP
rs1184567205 1066 dbSNP
rs772585628 1073 dbSNP
rs1173311440 1074 dbSNP
rs1167810901 1080 dbSNP
rs1025575577 1081 dbSNP
rs3065062 1099 dbSNP
rs71712895 1100 dbSNP
rs80040289 1103 dbSNP
rs886379973 1106 dbSNP
rs1278493396 1108 dbSNP
rs1369315585 1112 dbSNP
rs1354477287 1114 dbSNP
rs1281386158 1116 dbSNP
rs1006537574 1119 dbSNP
rs3809866 1123 dbSNP
rs1335157456 1125 dbSNP
rs970293211 1135 dbSNP
rs979920951 1139 dbSNP
rs550121585 1151 dbSNP
rs1334495049 1152 dbSNP
rs1416427450 1152 dbSNP
rs1035861039 1153 dbSNP
rs1309033214 1156 dbSNP
rs148390023 1163 dbSNP
rs1032334064 1166 dbSNP
rs1394541601 1167 dbSNP
rs1409527828 1168 dbSNP
rs1156363064 1169 dbSNP
rs199946088 1169 dbSNP
rs956107289 1169 dbSNP
rs1314885228 1170 dbSNP
rs575887993 1174 dbSNP
rs565997512 1175 dbSNP
rs1272387615 1177 dbSNP
rs3087904 1178 dbSNP
rs990114006 1178 dbSNP
rs1205540247 1181 dbSNP
rs1279377927 1184 dbSNP
rs1484455997 1186 dbSNP
rs1183212431 1188 dbSNP
rs1222152655 1188 dbSNP
rs1256467741 1193 dbSNP
rs1427403277 1195 dbSNP
rs1190469335 1196 dbSNP
rs1388795258 1200 dbSNP
rs1284734451 1203 dbSNP
rs1451884680 1204 dbSNP
rs914541780 1211 dbSNP
rs954142000 1212 dbSNP
rs1375244451 1220 dbSNP
rs1400215023 1221 dbSNP
rs959754188 1233 dbSNP
rs1346615870 1236 dbSNP
rs371805362 1239 dbSNP
rs988500459 1260 dbSNP
rs1399646189 1261 dbSNP
rs879054629 1266 dbSNP
rs1464902209 1268 dbSNP
rs570045811 1270 dbSNP
rs1166257116 1272 dbSNP
rs1476496046 1289 dbSNP
rs943856587 1294 dbSNP
rs1187746039 1296 dbSNP
rs546471628 1303 dbSNP
rs918496788 1303 dbSNP
rs912890518 1304 dbSNP
rs1403266067 1310 dbSNP
rs774009700 1310 dbSNP
rs1381710943 1311 dbSNP
rs931205976 1316 dbSNP
rs1367194217 1318 dbSNP
rs1332659458 1320 dbSNP
rs1272249635 1321 dbSNP
rs564754336 1322 dbSNP
rs1302638298 1329 dbSNP
rs894782580 1330 dbSNP
rs1310182941 1341 dbSNP
rs1331149363 1345 dbSNP
rs979422286 1346 dbSNP
rs1046158769 1356 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166 , TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uacauUA-UGACAAUAGACUUu 5'
               || |||   ||||||| 
Target 5' ccugcAUAACU-CAAUCUGAAc 3'
 		8 - 28
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177623. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_1 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_006310 | 3UTR | AGAGAAACUGAUAUACAUUAUUUUUUUCUUUUUAAAGAUGACUUAUAAGAACCCUGAAAUUUAUAUAGGUGAGACAAUAGAAAUAAAAAGAUCUUCAGCCAGGCCUUUCUGAAGGAGUUAUUCUGCUAAAAAUGGUCUUAGUUGUCUGAAAAGCCAGCUCUUGAACCUCUUCACAACAGUAUCAACACUGGCUUCUCCCGGUUCAUUUUAUGCGUGCGAGAAGUCAGUGGUAACUGCUGCAGGGCUUAAUACAUUAGUGGUAACUGGUUUAAAAAACAAAGACUGUAAGCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_006310 | 3UTR | GAAAAGCCAGCUCUUGAACCUCUUCACAACAGUAUCAACACUGGCUUCUCCCGGUUCAUUUUAUGCGUGCGAGAAGUCAGUGGUAACUGCUGCAGGGCUUAAUACAUUAGUGGUAACUGGUUUAAAAAACAAAGACUGUAAGCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_006310 | 3UTR | CUUAGUUGUCUGAAAAGCCAGCUCUUGAACCUCUUCACAACAGUAUCAACACUGGCUUCUCCCGGUUCAUUUUAUGCGUGCGAGAAGUCAGUGGUAACUGCUGCAGGGCUUAAUACAUUAGUGGUAACUGGUUUAAAAAACAAAGACUGUAAGCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_006310 | 3UTR | CUUAGUUGUCUGAAAAGCCAGCUCUUGAACCUCUUCACAACAGUAUCAACACUGGCUUCUCCCGGUUCAUUUUAUGCGUGCGAGAAGUCAGUGGUAACUGCUGCAGGGCUUAAUACAUUAGUGGUAACUGGUUUAAAAAACAAAGACUGUAAGCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_006310 | 3UTR | UCUUAGUUGUCUGAAAAGCCAGCUCUUGAACCUCUUCACAACAGUAUCAACACUGGCUUCUCCCGGUUCAUUUUAUGCGUGCGAGAAGUCAGUGGUAACUGCUGCAGGGCUUAAUACAUUAGUGGUAACUGGUUUAAAAAACAAAGACUGUAAGCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000322157.4 | 3UTR | AUAUAUUCCUGCAUAACUCAAUCUGAACCAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000322157.4 | 3UTR | AUAUAUUCCUGCAUAACUCAAUCUGAACCAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
116 hsa-miR-3942-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT093395 TMA16 translation machinery associated 16 homolog 2 2
MIRT134018 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT194942 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT265807 NOTCH2 notch 2 2 2
MIRT287615 NPEPPS aminopeptidase puromycin sensitive 2 2
MIRT444196 SESN3 sestrin 3 2 2
MIRT444480 UBN2 ubinuclein 2 2 2
MIRT446589 FBXO40 F-box protein 40 2 2
MIRT450501 ALPK3 alpha kinase 3 2 2
MIRT455182 AGTRAP angiotensin II receptor associated protein 2 2
MIRT455446 EPB41L4B erythrocyte membrane protein band 4.1 like 4B 2 2
MIRT456385 KLHL12 kelch like family member 12 2 2
MIRT460303 FLCN folliculin 2 2
MIRT461247 COX10 COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor 2 6
MIRT467948 SLC16A1 solute carrier family 16 member 1 2 2
MIRT468007 SIX4 SIX homeobox 4 2 2
MIRT468211 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT470635 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT471785 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT473557 MATR3 matrin 3 2 2
MIRT475415 ICK intestinal cell kinase 2 2
MIRT476265 GNAL G protein subunit alpha L 2 6
MIRT477135 FAM107B family with sequence similarity 107 member B 2 6
MIRT478433 DAZAP2 DAZ associated protein 2 2 2
MIRT479050 CNOT6L CCR4-NOT transcription complex subunit 6 like 2 8
MIRT480872 BDNF-AS BDNF antisense RNA 2 2
MIRT484229 CLDN1 claudin 1 2 2
MIRT485055 SUCO SUN domain containing ossification factor 2 2
MIRT489871 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT492411 SCARB2 scavenger receptor class B member 2 2 2
MIRT499682 KCTD2 potassium channel tetramerization domain containing 2 2 4
MIRT505969 RAB11FIP1 RAB11 family interacting protein 1 2 4
MIRT507708 CNIH cornichon family AMPA receptor auxiliary protein 1 2 4
MIRT511878 GID4 GID complex subunit 4 homolog 2 6
MIRT513411 RTP4 receptor transporter protein 4 2 2
MIRT519873 ZFP30 ZFP30 zinc finger protein 2 4
MIRT520703 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT522890 KCNN3 potassium calcium-activated channel subfamily N member 3 2 6
MIRT523781 FAM63B MINDY lysine 48 deubiquitinase 2 2 2
MIRT523950 DYNLT1 dynein light chain Tctex-type 1 2 4
MIRT526894 ATP6V0E2 ATPase H+ transporting V0 subunit e2 2 2
MIRT529167 CCDC25 coiled-coil domain containing 25 2 2
MIRT529703 ZBTB49 zinc finger and BTB domain containing 49 2 2
MIRT530359 PCSK1 proprotein convertase subtilisin/kexin type 1 2 2
MIRT530595 C7orf33 chromosome 7 open reading frame 33 2 4
MIRT531528 CCT6A chaperonin containing TCP1 subunit 6A 2 2
MIRT531992 BARD1 BRCA1 associated RING domain 1 2 2
MIRT539547 AAK1 AP2 associated kinase 1 2 2
MIRT547757 KATNAL1 katanin catalytic subunit A1 like 1 2 2
MIRT549059 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 2
MIRT549836 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 2
MIRT552698 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 2 2
MIRT554318 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 2
MIRT556358 MAF MAF bZIP transcription factor 2 2
MIRT557772 FRS2 fibroblast growth factor receptor substrate 2 2 2
MIRT558795 CHEK2 checkpoint kinase 2 2 2
MIRT561367 UBXN2B UBX domain protein 2B 2 2
MIRT561673 RAPGEF2 Rap guanine nucleotide exchange factor 2 2 2
MIRT567898 CSNK1A1 casein kinase 1 alpha 1 2 2
MIRT568456 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT568838 NBPF12 NBPF member 12 2 2
MIRT568846 VPS53 VPS53, GARP complex subunit 2 2
MIRT568856 NBPF1 NBPF member 1 2 2
MIRT568888 NBPF15 NBPF member 15 2 2
MIRT569331 CDC5L cell division cycle 5 like 2 2
MIRT569388 NBPF11 NBPF member 11 2 2
MIRT569398 NBPF14 NBPF member 14 2 2
MIRT569644 NBPF10 NBPF member 10 2 2
MIRT571582 TROVE2 TROVE domain family member 2 2 2
MIRT573027 NBPF3 NBPF member 3 2 2
MIRT573293 UFM1 ubiquitin fold modifier 1 2 2
MIRT608814 SEPT6 septin 6 2 6
MIRT609046 BACH2 BTB domain and CNC homolog 2 2 6
MIRT609517 RAB3IP RAB3A interacting protein 2 2
MIRT611861 SRRM4 serine/arginine repetitive matrix 4 2 2
MIRT612174 EMC3 ER membrane protein complex subunit 3 2 2
MIRT612714 NR2F6 nuclear receptor subfamily 2 group F member 6 2 4
MIRT613305 ARL6IP6 ADP ribosylation factor like GTPase 6 interacting protein 6 2 4
MIRT616357 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT632424 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 2
MIRT636005 SAMD15 sterile alpha motif domain containing 15 2 2
MIRT636534 FAM126B family with sequence similarity 126 member B 2 2
MIRT637275 FGFR1OP FGFR1 oncogene partner 2 2
MIRT639131 ZNF726 zinc finger protein 726 2 2
MIRT641257 C8orf46 chromosome 8 open reading frame 46 2 2
MIRT642930 KRTAP5-9 keratin associated protein 5-9 2 2
MIRT644018 NUCB1 nucleobindin 1 2 2
MIRT645021 MAGEB4 MAGE family member B4 2 2
MIRT646790 EVC2 EvC ciliary complex subunit 2 2 2
MIRT647338 RPH3AL rabphilin 3A like (without C2 domains) 2 2
MIRT647975 PDE12 phosphodiesterase 12 2 2
MIRT650610 NEK4 NIMA related kinase 4 2 2
MIRT651052 ZNF579 zinc finger protein 579 2 2
MIRT651593 WDFY2 WD repeat and FYVE domain containing 2 2 2
MIRT652785 TCEANC2 transcription elongation factor A N-terminal and central domain containing 2 2 2
MIRT656450 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT660086 BTD biotinidase 2 2
MIRT661398 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT661759 MICA MHC class I polypeptide-related sequence A 2 2
MIRT666402 SH3D19 SH3 domain containing 19 2 2
MIRT668362 FGD4 FYVE, RhoGEF and PH domain containing 4 2 2
MIRT668895 CREG2 cellular repressor of E1A stimulated genes 2 2 2
MIRT669329 BSND barttin CLCNK type accessory beta subunit 2 2
MIRT672369 PDPK1 3-phosphoinositide dependent protein kinase 1 2 2
MIRT686261 YTHDF1 YTH N6-methyladenosine RNA binding protein 1 2 2
MIRT695571 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT701959 MINK1 misshapen like kinase 1 2 2
MIRT702322 KMT2A lysine methyltransferase 2A 2 2
MIRT705209 BRWD1 bromodomain and WD repeat domain containing 1 2 2
MIRT713949 KCTD6 potassium channel tetramerization domain containing 6 2 2
MIRT717082 EBF4 early B-cell factor 4 2 2
MIRT717896 COPS8 COP9 signalosome subunit 8 2 2
MIRT721043 TRIM67 tripartite motif containing 67 2 2
MIRT722194 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT722782 ACADSB acyl-CoA dehydrogenase, short/branched chain 2 2
MIRT725412 HNRNPU heterogeneous nuclear ribonucleoprotein U 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3942-3p Osimertinib 71496458 NSC779217 approved resistant Low Non-Small Cell Lung Cancer tissue
hsa-miR-3942-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-3942-3p Neoadjuvant chemotherapy resistant tissue (breast cancer)

Error report submission