miRTarBase - #MIRT294224


—
pre-miRNA Information
pre-miRNA hsa-mir-548s   
Genomic Coordinates chr2: 11767444 - 11767525
Description Homo sapiens miR-548s stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-548s
Sequence 52| AUGGCCAAAACUGCAGUUAUUUU |74
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 1 2 + 11767495 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1187825186 1 dbSNP
rs1161985266 4 dbSNP
rs1476642595 6 dbSNP
rs772377981 6 dbSNP
rs1427306684 19 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol U2AF2   
Synonyms U2AF65
Description U2 small nuclear RNA auxiliary factor 2
Transcript NM_001012478   
Other Transcripts NM_007279   
Expression
Putative miRNA Targets on U2AF2
3'UTR of U2AF2
(miRNA target sites are highlighted)		 
>U2AF2|NM_001012478|3'UTR
   1 AGGCGGCTGGGGGAGGGTGGGGGCAGGGCTGGCTGGGGGCTTCTCCCCACTCCCGCCCCCCCCTTATCCCCCTCTGAAGA
  81 CGATGGGCAGAGGAGTGACAGCCGCAGACACACGACAGCCGGCAGCAACTGGAATGGCAGCAATTAAGGGTGGGGGGCGG
 161 GGGTTGGGGGGTTGGGGGGTTAGGGCAGGGAGGGGACTGGGGAAGTGCGCACACAGCCCACACAGACAACACGCACCCAC
 241 ACAGACACAGAGGGAAGGGGTTGGGATGGGGACAGGGTGCACAGCAGGGCGGGGTAGGACCCCAGCCCCTCCCAAAACAG
 321 CCTCTCCTTCTCCCATAGACCCCTTTCTTCTCCCCTTCCCCACGGTAGGAACATAGCGTGTTTATATTTTATGGCCAAAC
 401 TATTTTGAATTTTGTTGTCCGGCCCTCAGTGCCCTGCCCTCTCCCTTACCAGGACCACAGCTCTGTTCCTTCGGCCTCTG
 481 GTCCTCTCTGGTCCCCTCCTGGGTTTCTTACGTAGTTGATTTTTCCTCTTTAGTCTCCCCCGACCTGCGCCCAGCCCCGT
 561 GGCCCCTGCCCCTCTCCTACTCTCTGTGGCAGTTTCATATTTGCTAAGACGAATTTGCTCATTAAACATTTTGTTGTATT
 641 TTACTTTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uuuUAUUG-AC----GUCAAA-ACCGGUa 5'
             |||:| ||    :| ||| |||||| 
Target 5' aacATAGCGTGTTTATATTTTATGGCCAa 3'
 370 - 398 130.00 -10.70
2 
miRNA  3' uuuUAUUGACGUCAA--AA-CCGGua 5'
             | |:|| | |||  || ||||  
Target 5' accACAGCT-CTGTTCCTTCGGCCtc 3'
 454 - 478 105.00 -8.40
3 
miRNA  3' uuuuauugacgucaaaACCGGua 5'
                          |||||  
Target 5' cctgcgcccagccccgTGGCCcc 3'
 544 - 566 100.00 -9.74
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN27000807 14 COSMIC
COSN17984030 15 COSMIC
COSN30468208 17 COSMIC
COSN30459950 47 COSMIC
COSN24355897 50 COSMIC
COSN18747979 64 COSMIC
COSN30681066 64 COSMIC
COSN32056409 104 COSMIC
COSN31961601 105 COSMIC
COSN27288102 175 COSMIC
COSN7450116 490 COSMIC
COSN6147618 583 COSMIC
COSN28257843 637 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1408944608 1 dbSNP
rs762317948 2 dbSNP
rs369340285 5 dbSNP
rs372467427 6 dbSNP
rs748598866 7 dbSNP
rs772625199 8 dbSNP
rs758867639 11 dbSNP
rs549920806 13 dbSNP
rs921016137 15 dbSNP
rs745564221 18 dbSNP
rs773337577 19 dbSNP
rs932360855 19 dbSNP
rs769538864 20 dbSNP
rs1342047216 24 dbSNP
rs1211312610 25 dbSNP
rs1239575974 36 dbSNP
rs1253286145 37 dbSNP
rs1484064052 38 dbSNP
rs570236951 39 dbSNP
rs1202626084 48 dbSNP
rs1241995774 50 dbSNP
rs1026348982 51 dbSNP
rs748817796 53 dbSNP
rs1026701428 56 dbSNP
rs952449701 56 dbSNP
rs536052231 57 dbSNP
rs1344960721 58 dbSNP
rs988025232 60 dbSNP
rs910821394 62 dbSNP
rs965299867 63 dbSNP
rs1464859437 64 dbSNP
rs983891744 65 dbSNP
rs978459914 67 dbSNP
rs1316024969 69 dbSNP
rs1160498991 70 dbSNP
rs1473834777 72 dbSNP
rs992824704 75 dbSNP
rs1179450242 82 dbSNP
rs918152670 83 dbSNP
rs555741577 84 dbSNP
rs1482166581 96 dbSNP
rs1453170845 99 dbSNP
rs934313952 102 dbSNP
rs1218927097 103 dbSNP
rs566402042 105 dbSNP
rs1052892484 112 dbSNP
rs1286368930 113 dbSNP
rs1227933873 114 dbSNP
rs1341068468 115 dbSNP
rs1052300452 116 dbSNP
rs1394458428 119 dbSNP
rs534702334 119 dbSNP
rs1321691231 121 dbSNP
rs949938609 122 dbSNP
rs1195244740 139 dbSNP
rs1041375493 142 dbSNP
rs1477129317 150 dbSNP
rs1158991740 151 dbSNP
rs909526966 152 dbSNP
rs1368491013 156 dbSNP
rs1189232135 159 dbSNP
rs144845046 159 dbSNP
rs59036809 159 dbSNP
rs939680563 159 dbSNP
rs1209189903 163 dbSNP
rs1414955631 164 dbSNP
rs1466082970 165 dbSNP
rs1036937688 166 dbSNP
rs1285989653 166 dbSNP
rs1357164485 166 dbSNP
rs1242657728 167 dbSNP
rs899720514 170 dbSNP
rs1298588399 173 dbSNP
rs1363399545 174 dbSNP
rs895760604 174 dbSNP
rs1320501362 175 dbSNP
rs1406421098 177 dbSNP
rs996945290 178 dbSNP
rs1026589882 180 dbSNP
rs1455924942 183 dbSNP
rs888233986 185 dbSNP
rs1003927351 188 dbSNP
rs371494737 190 dbSNP
rs1300123343 198 dbSNP
rs1451109977 206 dbSNP
rs1015258082 207 dbSNP
rs1044600619 207 dbSNP
rs1187883408 209 dbSNP
rs1291910171 210 dbSNP
rs962540784 210 dbSNP
rs1208195759 212 dbSNP
rs796471281 213 dbSNP
rs1275639120 215 dbSNP
rs1025679924 216 dbSNP
rs1031467674 216 dbSNP
rs1297378244 217 dbSNP
rs192395170 218 dbSNP
rs980809110 221 dbSNP
rs543477060 222 dbSNP
rs1226449858 228 dbSNP
rs1290524295 230 dbSNP
rs1488429523 233 dbSNP
rs936621362 234 dbSNP
rs1038287656 236 dbSNP
rs1478224942 241 dbSNP
rs988225285 243 dbSNP
rs1196589335 245 dbSNP
rs913961837 249 dbSNP
rs1252579601 251 dbSNP
rs943879657 257 dbSNP
rs1482227041 269 dbSNP
rs1274179638 271 dbSNP
rs1218078442 274 dbSNP
rs899206389 276 dbSNP
rs1040870974 282 dbSNP
rs899770629 285 dbSNP
rs1273589979 286 dbSNP
rs1233097143 291 dbSNP
rs993446045 292 dbSNP
rs1308149165 298 dbSNP
rs1411104199 305 dbSNP
rs868391248 309 dbSNP
rs1327758943 312 dbSNP
rs146943256 318 dbSNP
rs1414829303 319 dbSNP
rs1026378799 323 dbSNP
rs762740044 327 dbSNP
rs888117196 328 dbSNP
rs8791 330 dbSNP
rs1232528644 331 dbSNP
rs1009079232 341 dbSNP
rs151200677 343 dbSNP
rs184745070 343 dbSNP
rs369481128 343 dbSNP
rs1014196569 344 dbSNP
rs970080431 347 dbSNP
rs1348014514 351 dbSNP
rs1285928204 353 dbSNP
rs542048028 355 dbSNP
rs981027021 356 dbSNP
rs1448252789 359 dbSNP
rs1360504400 361 dbSNP
rs964994482 364 dbSNP
rs1384773070 370 dbSNP
rs756238986 375 dbSNP
rs979463216 379 dbSNP
rs1471661072 385 dbSNP
rs1407282714 386 dbSNP
rs561832127 390 dbSNP
rs1033255393 397 dbSNP
rs545778319 398 dbSNP
rs1235918320 399 dbSNP
rs771617468 409 dbSNP
rs1183427367 412 dbSNP
rs988459482 414 dbSNP
rs958041212 418 dbSNP
rs879812950 420 dbSNP
rs1381766714 421 dbSNP
rs764244345 422 dbSNP
rs1342221727 424 dbSNP
rs949812175 426 dbSNP
rs1228372767 427 dbSNP
rs1380964801 429 dbSNP
rs572334661 433 dbSNP
rs944117706 434 dbSNP
rs1353898847 437 dbSNP
rs1322489536 438 dbSNP
rs927157466 440 dbSNP
rs1344498912 442 dbSNP
rs189728146 446 dbSNP
rs941194361 448 dbSNP
rs977029168 456 dbSNP
rs1250247369 461 dbSNP
rs1187034198 464 dbSNP
rs1485855362 468 dbSNP
rs373981551 469 dbSNP
rs368115101 473 dbSNP
rs932448552 474 dbSNP
rs1244728909 479 dbSNP
rs1342645502 490 dbSNP
rs1279892785 491 dbSNP
rs181721499 494 dbSNP
rs1047690897 495 dbSNP
rs1361254034 496 dbSNP
rs1182070820 499 dbSNP
rs1048318132 501 dbSNP
rs890547530 503 dbSNP
rs939719125 508 dbSNP
rs1440770189 515 dbSNP
rs1430690700 516 dbSNP
rs1392232226 517 dbSNP
rs1009358624 519 dbSNP
rs1017687558 526 dbSNP
rs1428288068 527 dbSNP
rs900703033 528 dbSNP
rs1193371572 529 dbSNP
rs1426493583 529 dbSNP
rs1489190547 534 dbSNP
rs895596693 535 dbSNP
rs112542173 536 dbSNP
rs1044505988 537 dbSNP
rs1453088616 538 dbSNP
rs1306636294 540 dbSNP
rs1301911582 541 dbSNP
rs1220827275 542 dbSNP
rs1343532860 545 dbSNP
rs905361325 546 dbSNP
rs1410504223 549 dbSNP
rs1404175943 550 dbSNP
rs1461811121 552 dbSNP
rs1002348473 554 dbSNP
rs1178913769 555 dbSNP
rs1431984201 558 dbSNP
rs1429168394 559 dbSNP
rs371897089 560 dbSNP
rs1253527967 563 dbSNP
rs1336061979 563 dbSNP
rs1377353524 565 dbSNP
rs1032606309 568 dbSNP
rs1256327967 569 dbSNP
rs956255347 569 dbSNP
rs958261512 570 dbSNP
rs532982602 572 dbSNP
rs1306601510 573 dbSNP
rs1229092308 575 dbSNP
rs1352354773 577 dbSNP
rs988490601 578 dbSNP
rs1020951828 582 dbSNP
rs1023944711 583 dbSNP
rs1305007105 584 dbSNP
rs971083009 585 dbSNP
rs549857584 587 dbSNP
rs1413467674 591 dbSNP
rs1179261243 593 dbSNP
rs1418199418 598 dbSNP
rs1334825579 601 dbSNP
rs563378665 603 dbSNP
rs921326351 606 dbSNP
rs1183451542 607 dbSNP
rs953894017 611 dbSNP
rs1233289689 614 dbSNP
rs184495971 619 dbSNP
rs909828758 620 dbSNP
rs1342337085 629 dbSNP
rs939940132 631 dbSNP
rs1238390352 637 dbSNP
rs1341353786 639 dbSNP
rs1315101675 641 dbSNP
rs376811094 645 dbSNP
rs1037140382 647 dbSNP
rs916931809 649 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000450554.2 | 3UTR | UUUAUAUUUUAUGGCCAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000450554.2 | 3UTR | UUUAUAUUUUAUGGCCAAACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000450554.2 | 3UTR | UUUAUAUUUUAUGGCCAAACUAUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.656 0.02 0.733 0.01 10 Click to see details
LIHC 0.297 0.04 0.337 0.03 34 Click to see details
THCA 0.233 0.09 0.163 0.18 34 Click to see details
KIRC 0.295 0.13 0.244 0.18 16 Click to see details
CHOL 0.692 0.15 0.400 0.3 4 Click to see details
PRAD 0.437 0.23 0.300 0.31 5 Click to see details
ESCA -0.668 0.27 -1.000 0.5 3 Click to see details
LUSC 0.149 0.31 0.130 0.33 14 Click to see details
KICH -0.16 0.32 -0.264 0.22 11 Click to see details
BRCA 0.078 0.33 0.077 0.33 35 Click to see details
UCEC -0.145 0.34 -0.027 0.47 11 Click to see details
PAAD 0.115 0.46 0.500 0.33 3 Click to see details
KIRP 0.032 0.47 0.000 0.5 7 Click to see details
HNSC -0.019 0.48 -0.073 0.42 11 Click to see details
HNSC -0.019 0.48 -0.073 0.42 11 Click to see details
HNSC -0.019 0.48 -0.073 0.42 11 Click to see details
HNSC -0.019 0.48 -0.073 0.42 11 Click to see details
HNSC -0.019 0.48 -0.073 0.42 11 Click to see details
374 hsa-miR-548s Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT075229 PHF13 PHD finger protein 13 2 4
MIRT090370 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT096411 C5ORF22 chromosome 5 open reading frame 22 2 2
MIRT153366 MAVS mitochondrial antiviral signaling protein 2 2
MIRT194890 DCTN5 dynactin subunit 5 2 8
MIRT195549 NIP7 NIP7, nucleolar pre-rRNA processing protein 2 2
MIRT219209 LYRM4 LYR motif containing 4 2 2
MIRT234472 ZNF652 zinc finger protein 652 2 2
MIRT235966 BACH1 BTB domain and CNC homolog 1 2 2
MIRT271874 ZNF678 zinc finger protein 678 2 2
MIRT294224 U2AF2 U2 small nuclear RNA auxiliary factor 2 2 2
MIRT334729 BTG2 BTG anti-proliferation factor 2 2 4
MIRT441397 SOX5 SRY-box 5 2 2
MIRT441551 TBCEL tubulin folding cofactor E like 2 2
MIRT441568 PLEKHA2 pleckstrin homology domain containing A2 2 2
MIRT441581 POLR1B RNA polymerase I subunit B 2 2
MIRT441681 GABRB2 gamma-aminobutyric acid type A receptor beta2 subunit 2 2
MIRT442049 KLHDC10 kelch domain containing 10 2 2
MIRT442633 TBC1D12 TBC1 domain family member 12 2 2
MIRT442694 ZNF646 zinc finger protein 646 2 4
MIRT443108 DENND5B DENN domain containing 5B 2 2
MIRT443110 VLDLR very low density lipoprotein receptor 2 2
MIRT443423 MAPT microtubule associated protein tau 2 2
MIRT443464 ACPP acid phosphatase, prostate 2 2
MIRT443763 HLF HLF, PAR bZIP transcription factor 2 2
MIRT443806 SIDT2 SID1 transmembrane family member 2 2 2
MIRT451031 ZNF610 zinc finger protein 610 2 2
MIRT451275 ZNF101 zinc finger protein 101 2 6
MIRT451671 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 2 6
MIRT454144 FLYWCH2 FLYWCH family member 2 2 8
MIRT454595 MAG myelin associated glycoprotein 2 4
MIRT459352 AGXT alanine-glyoxylate aminotransferase 2 2
MIRT460053 RPL22L1 ribosomal protein L22 like 1 2 2
MIRT460737 HEXA hexosaminidase subunit alpha 2 2
MIRT463084 ZNF618 zinc finger protein 618 2 2
MIRT465757 TMPPE transmembrane protein with metallophosphoesterase domain 2 8
MIRT471102 PHLDA2 pleckstrin homology like domain family A member 2 2 2
MIRT472939 MSMO1 methylsterol monooxygenase 1 2 6
MIRT473686 MAPK8 mitogen-activated protein kinase 8 2 4
MIRT474288 LAMTOR3 late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 2 2
MIRT476935 FAM83G family with sequence similarity 83 member G 2 2
MIRT477130 FAM118A family with sequence similarity 118 member A 2 2
MIRT477321 EPHA2 EPH receptor A2 2 2
MIRT478310 DDN dendrin 2 2
MIRT494936 IFFO2 intermediate filament family orphan 2 2 2
MIRT495287 RASL10B RAS like family 10 member B 2 2
MIRT495310 GDF11 growth differentiation factor 11 2 2
MIRT495323 ADAMTS8 ADAM metallopeptidase with thrombospondin type 1 motif 8 2 4
MIRT496580 RGMA repulsive guidance molecule family member a 2 2
MIRT496647 TNPO2 transportin 2 2 2
MIRT496804 SLC16A10 solute carrier family 16 member 10 2 2
MIRT496850 GPAM glycerol-3-phosphate acyltransferase, mitochondrial 2 2
MIRT496910 RTKN rhotekin 2 2
MIRT496955 MAP1LC3B microtubule associated protein 1 light chain 3 beta 2 2
MIRT497149 PRDM15 PR/SET domain 15 2 2
MIRT498253 ELAVL1 ELAV like RNA binding protein 1 2 2
MIRT498380 GPRC5B G protein-coupled receptor class C group 5 member B 2 2
MIRT500426 ZMAT3 zinc finger matrin-type 3 2 8
MIRT500482 ZBTB4 zinc finger and BTB domain containing 4 2 6
MIRT505372 TMEM154 transmembrane protein 154 2 4
MIRT505674 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT509787 CHAF1B chromatin assembly factor 1 subunit B 2 4
MIRT512344 ZNF665 zinc finger protein 665 2 4
MIRT512404 CD84 CD84 molecule 2 2
MIRT512526 ATCAY ATCAY, caytaxin 2 4
MIRT513223 RYK receptor-like tyrosine kinase 2 2
MIRT514247 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT514276 ZNF345 zinc finger protein 345 2 4
MIRT514426 SLC38A7 solute carrier family 38 member 7 2 2
MIRT514551 PTGR2 prostaglandin reductase 2 2 2
MIRT514776 RBM4B RNA binding motif protein 4B 2 2
MIRT514854 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 2
MIRT515033 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT515265 CSNK1E casein kinase 1 epsilon 2 2
MIRT515283 MSRB1 methionine sulfoxide reductase B1 2 2
MIRT515587 FBXL13 F-box and leucine rich repeat protein 13 2 2
MIRT515898 AGTPBP1 ATP/GTP binding protein 1 2 2
MIRT515945 C9orf156 tRNA methyltransferase O 2 2
MIRT516281 DBT dihydrolipoamide branched chain transacylase E2 2 2
MIRT516517 PARK2 parkin RBR E3 ubiquitin protein ligase 2 2
MIRT516932 THAP1 THAP domain containing 1 2 4
MIRT517201 OTUD6A OTU deubiquitinase 6A 2 2
MIRT517379 METTL7A methyltransferase like 7A 2 2
MIRT517467 PEX26 peroxisomal biogenesis factor 26 2 2
MIRT517564 SNX22 sorting nexin 22 2 2
MIRT517617 DEGS1 delta 4-desaturase, sphingolipid 1 2 2
MIRT518210 TRMT10B tRNA methyltransferase 10B 2 2
MIRT518545 ABCA6 ATP binding cassette subfamily A member 6 2 2
MIRT519089 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 4
MIRT519103 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 2
MIRT519138 C2orf49 chromosome 2 open reading frame 49 2 2
MIRT519316 TIMELESS timeless circadian clock 2 2
MIRT519393 DNASE2 deoxyribonuclease 2, lysosomal 2 4
MIRT519441 GLA galactosidase alpha 2 2
MIRT519465 SPTLC2 serine palmitoyltransferase long chain base subunit 2 2 2
MIRT519705 ZNF584 zinc finger protein 584 2 4
MIRT519822 ZKSCAN4 zinc finger with KRAB and SCAN domains 4 2 2
MIRT520236 USP9X ubiquitin specific peptidase 9, X-linked 2 4
MIRT520259 URGCP upregulator of cell proliferation 2 2
MIRT520409 TXNL1 thioredoxin like 1 2 4
MIRT521401 RDH11 retinol dehydrogenase 11 (all-trans/9-cis/11-cis) 2 2
MIRT521511 QSOX1 quiescin sulfhydryl oxidase 1 2 2
MIRT522644 MANEAL mannosidase endo-alpha like 2 2
MIRT522789 KPNA4 karyopherin subunit alpha 4 2 4
MIRT523502 GMPS guanine monophosphate synthase 2 4
MIRT523686 FHL2 four and a half LIM domains 2 2 2
MIRT523902 EMC7 ER membrane protein complex subunit 7 2 4
MIRT524126 DMXL1 Dmx like 1 2 2
MIRT524770 BCKDK branched chain ketoacid dehydrogenase kinase 2 2
MIRT528264 GPRIN2 G protein regulated inducer of neurite outgrowth 2 2 2
MIRT528675 CEP57L1 centrosomal protein 57 like 1 2 2
MIRT529138 CLCC1 chloride channel CLIC like 1 2 4
MIRT530704 RNMTL1 mitochondrial rRNA methyltransferase 3 2 2
MIRT531620 TM4SF5 transmembrane 4 L six family member 5 2 4
MIRT533399 TXNIP thioredoxin interacting protein 2 2
MIRT535650 NLN neurolysin 2 2
MIRT539958 SPRY1 sprouty RTK signaling antagonist 1 2 2
MIRT551760 MED21 mediator complex subunit 21 2 2
MIRT552021 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT557187 HOXA10 homeobox A10 2 2
MIRT560435 GOLGA7B golgin A7 family member B 2 2
MIRT561596 SKI SKI proto-oncogene 2 2
MIRT563915 STAT2 signal transducer and activator of transcription 2 2 2
MIRT565964 RPP14 ribonuclease P/MRP subunit p14 2 2
MIRT567313 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 2 2
MIRT572687 NCMAP non-compact myelin associated protein 2 2
MIRT574419 SOX4 SRY-box 4 2 2
MIRT575235 Serping1 serine (or cysteine) peptidase inhibitor, clade G, member 1 2 2
MIRT576186 Vsig2 V-set and immunoglobulin domain containing 2 2 2
MIRT576301 Acbd7 acyl-Coenzyme A binding domain containing 7 2 2
MIRT576477 Lhx4 LIM homeobox protein 4 2 3
MIRT576576 Ptbp1 polypyrimidine tract binding protein 1 2 2
MIRT576602 Ccdc117 coiled-coil domain containing 117 2 2
MIRT576655 Fam216a family with sequence similarity 216, member A 2 2
MIRT576666 H6pd hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) 2 2
MIRT576703 Kras Kirsten rat sarcoma viral oncogene homolog 2 2
MIRT576845 Socs6 suppressor of cytokine signaling 6 2 2
MIRT576944 Aldoa aldolase A, fructose-bisphosphate 2 2
MIRT608646 ABCF3 ATP binding cassette subfamily F member 3 2 2
MIRT609892 C1S complement C1s 2 2
MIRT613517 ANAPC7 anaphase promoting complex subunit 7 2 2
MIRT614073 XRCC2 X-ray repair cross complementing 2 2 2
MIRT618202 C22orf39 chromosome 22 open reading frame 39 2 2
MIRT618350 CDKL1 cyclin dependent kinase like 1 2 2
MIRT618619 GREB1 growth regulation by estrogen in breast cancer 1 2 4
MIRT618826 PHF20 PHD finger protein 20 2 2
MIRT619371 SYT2 synaptotagmin 2 2 2
MIRT620103 HARBI1 harbinger transposase derived 1 2 2
MIRT620220 VN1R1 vomeronasal 1 receptor 1 2 2
MIRT621183 FAM153B family with sequence similarity 153 member B 2 2
MIRT621477 GPKOW G-patch domain and KOW motifs 2 2
MIRT621874 TAZ tafazzin 2 2
MIRT624054 EIF4E eukaryotic translation initiation factor 4E 2 2
MIRT624689 AR androgen receptor 2 2
MIRT625234 C6orf89 chromosome 6 open reading frame 89 2 2
MIRT626070 CWF19L1 CWF19 like 1, cell cycle control (S. pombe) 2 2
MIRT629490 PABPC1L2A poly(A) binding protein cytoplasmic 1 like 2A 2 2
MIRT629861 GATAD1 GATA zinc finger domain containing 1 2 2
MIRT630995 ZNF573 zinc finger protein 573 2 2
MIRT631087 UQCRB ubiquinol-cytochrome c reductase binding protein 2 2
MIRT631279 SGSM1 small G protein signaling modulator 1 2 2
MIRT631526 MYO6 myosin VI 2 2
MIRT631637 WDR91 WD repeat domain 91 2 4
MIRT632773 LZIC leucine zipper and CTNNBIP1 domain containing 2 2
MIRT633272 FGFR1OP2 FGFR1 oncogene partner 2 2 2
MIRT633588 ABRACL ABRA C-terminal like 2 2
MIRT634152 YME1L1 YME1 like 1 ATPase 2 2
MIRT634920 CHMP1B charged multivesicular body protein 1B 2 2
MIRT635848 PRR11 proline rich 11 2 2
MIRT636006 SAMD15 sterile alpha motif domain containing 15 2 4
MIRT639203 RAD51 RAD51 recombinase 2 2
MIRT639378 FFAR4 free fatty acid receptor 4 2 2
MIRT639535 GSG2 histone H3 associated protein kinase 2 2
MIRT639635 PREX2 phosphatidylinositol-3,4,5-trisphosphate dependent Rac exchange factor 2 2 2
MIRT640224 TOMM40 translocase of outer mitochondrial membrane 40 2 2
MIRT640297 PRR13 proline rich 13 2 2
MIRT640683 MCUR1 mitochondrial calcium uniporter regulator 1 2 2
MIRT641118 NPHP3 nephrocystin 3 2 2
MIRT641451 LRIG1 leucine rich repeats and immunoglobulin like domains 1 2 2
MIRT642306 FPR1 formyl peptide receptor 1 2 2
MIRT642712 ZNF273 zinc finger protein 273 2 2
MIRT642840 ZNF891 zinc finger protein 891 2 2
MIRT643694 KIAA0586 KIAA0586 2 2
MIRT644309 NFKBID NFKB inhibitor delta 2 2
MIRT644504 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT645171 NOL9 nucleolar protein 9 2 4
MIRT645728 POLR3A RNA polymerase III subunit A 2 2
MIRT646120 SLC26A9 solute carrier family 26 member 9 2 2
MIRT647725 CXCR2 C-X-C motif chemokine receptor 2 2 2
MIRT647991 PDE12 phosphodiesterase 12 2 2
MIRT648053 TRMT10C tRNA methyltransferase 10C, mitochondrial RNase P subunit 2 2
MIRT648172 TMEM192 transmembrane protein 192 2 2
MIRT648789 VPS8 VPS8, CORVET complex subunit 2 2
MIRT649285 NEK8 NIMA related kinase 8 2 2
MIRT649837 LIPG lipase G, endothelial type 2 2
MIRT650004 KLB klotho beta 2 2
MIRT650563 YIPF4 Yip1 domain family member 4 2 2
MIRT651782 UTP6 UTP6, small subunit processome component 2 2
MIRT652076 TSPAN14 tetraspanin 14 2 2
MIRT653397 SLCO5A1 solute carrier organic anion transporter family member 5A1 2 2
MIRT654540 RAB3C RAB3C, member RAS oncogene family 2 2
MIRT655362 PCBD2 pterin-4 alpha-carbinolamine dehydratase 2 2 2
MIRT655386 PAPLN papilin, proteoglycan like sulfated glycoprotein 2 2
MIRT657139 ITGA1 integrin subunit alpha 1 2 2
MIRT657754 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT658821 EEF1E1 eukaryotic translation elongation factor 1 epsilon 1 2 2
MIRT659082 DENR density regulated re-initiation and release factor 2 2
MIRT659106 DENND6A DENN domain containing 6A 2 2
MIRT659409 CORO2A coronin 2A 2 2
MIRT659829 CARHSP1 calcium regulated heat stable protein 1 2 2
MIRT660252 BLOC1S6 biogenesis of lysosomal organelles complex 1 subunit 6 2 2
MIRT660260 BLOC1S5 biogenesis of lysosomal organelles complex 1 subunit 5 2 4
MIRT660933 ACOX1 acyl-CoA oxidase 1 2 2
MIRT662986 TMEM59 transmembrane protein 59 2 2
MIRT663064 SFR1 SWI5 dependent homologous recombination repair protein 1 2 2
MIRT663256 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 2 2
MIRT663583 C10orf32 BLOC-1 related complex subunit 7 2 2
MIRT663755 ZNF285 zinc finger protein 285 2 2
MIRT664135 ZMIZ2 zinc finger MIZ-type containing 2 2 2
MIRT665143 PTK6 protein tyrosine kinase 6 2 2
MIRT665394 WEE1 WEE1 G2 checkpoint kinase 2 2
MIRT665978 SYT11 synaptotagmin 11 2 2
MIRT666186 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 2
MIRT666568 RHOBTB3 Rho related BTB domain containing 3 2 2
MIRT666772 PTGES3L prostaglandin E synthase 3 like 2 2
MIRT667018 PDF peptide deformylase, mitochondrial 2 2
MIRT667098 SLC25A2 solute carrier family 25 member 2 2 2
MIRT667134 NT5DC3 5'-nucleotidase domain containing 3 2 4
MIRT669790 GAN gigaxonin 2 2
MIRT669920 LRPAP1 LDL receptor related protein associated protein 1 2 2
MIRT669998 GPR156 G protein-coupled receptor 156 2 4
MIRT670291 RBBP4 RB binding protein 4, chromatin remodeling factor 2 2
MIRT670380 EMP2 epithelial membrane protein 2 2 2
MIRT670453 RSBN1L round spermatid basic protein 1 like 2 2
MIRT670564 GLTP glycolipid transfer protein 2 2
MIRT670859 IFNAR1 interferon alpha and beta receptor subunit 1 2 4
MIRT671055 KIF1B kinesin family member 1B 2 2
MIRT671078 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT671299 RABGAP1L RAB GTPase activating protein 1 like 2 2
MIRT671801 WISP3 WNT1 inducible signaling pathway protein 3 2 2
MIRT671851 APOL2 apolipoprotein L2 2 2
MIRT671950 SPPL3 signal peptide peptidase like 3 2 2
MIRT671990 OSTF1 osteoclast stimulating factor 1 2 2
MIRT672163 FANCF Fanconi anemia complementation group F 2 2
MIRT672267 SHE Src homology 2 domain containing E 2 2
MIRT672444 TTPAL alpha tocopherol transfer protein like 2 2
MIRT672870 TTC28 tetratricopeptide repeat domain 28 2 2
MIRT673643 CYCS cytochrome c, somatic 2 4
MIRT674049 ATXN3 ataxin 3 2 2
MIRT674240 NUP62 nucleoporin 62 2 2
MIRT674276 LMOD3 leiomodin 3 2 2
MIRT674430 MIOX myo-inositol oxygenase 2 4
MIRT674473 BCL2L15 BCL2 like 15 2 2
MIRT674493 TIRAP TIR domain containing adaptor protein 2 2
MIRT674846 GINM1 glycoprotein integral membrane 1 2 2
MIRT675706 EMC3 ER membrane protein complex subunit 3 2 2
MIRT675972 FAM126B family with sequence similarity 126 member B 2 2
MIRT676235 PARP2 poly(ADP-ribose) polymerase 2 2 2
MIRT676737 SGTB small glutamine rich tetratricopeptide repeat containing beta 2 2
MIRT677426 DDX19B DEAD-box helicase 19B 2 2
MIRT677454 PDLIM3 PDZ and LIM domain 3 2 2
MIRT677576 TRIM65 tripartite motif containing 65 2 2
MIRT677639 HAUS2 HAUS augmin like complex subunit 2 2 2
MIRT677827 TSPYL1 TSPY like 1 2 2
MIRT678937 MYADM myeloid associated differentiation marker 2 2
MIRT680405 SFT2D2 SFT2 domain containing 2 2 2
MIRT680475 ATP1B4 ATPase Na+/K+ transporting family member beta 4 2 2
MIRT683260 ZNF329 zinc finger protein 329 2 2
MIRT683564 CARD8 caspase recruitment domain family member 8 2 2
MIRT683812 CBS cystathionine-beta-synthase 2 2
MIRT684532 ZNF460 zinc finger protein 460 2 2
MIRT684939 PLA2G16 phospholipase A2 group XVI 2 2
MIRT685127 MAGI3 membrane associated guanylate kinase, WW and PDZ domain containing 3 2 2
MIRT685164 ERCC1 ERCC excision repair 1, endonuclease non-catalytic subunit 2 2
MIRT685429 PM20D2 peptidase M20 domain containing 2 2 2
MIRT685437 SLC10A6 solute carrier family 10 member 6 2 2
MIRT685676 TRIM45 tripartite motif containing 45 2 2
MIRT685991 NEK4 NIMA related kinase 4 2 2
MIRT687311 OTUD7B OTU deubiquitinase 7B 2 2
MIRT687535 MOB1B MOB kinase activator 1B 2 2
MIRT687710 KLF2 Kruppel like factor 2 2 2
MIRT687902 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT688044 GLUL glutamate-ammonia ligase 2 2
MIRT688891 C1GALT1 core 1 synthase, glycoprotein-N-acetylgalactosamine 3-beta-galactosyltransferase 1 2 2
MIRT689242 PGPEP1 pyroglutamyl-peptidase I 2 2
MIRT689519 ORC6 origin recognition complex subunit 6 2 2
MIRT689582 NUDT7 nudix hydrolase 7 2 2
MIRT689611 AKAP6 A-kinase anchoring protein 6 2 2
MIRT689665 RBM23 RNA binding motif protein 23 2 2
MIRT689911 ACOT13 acyl-CoA thioesterase 13 2 2
MIRT690005 LUZP2 leucine zipper protein 2 2 2
MIRT690027 CCDC90B coiled-coil domain containing 90B 2 2
MIRT690309 MRPS30 mitochondrial ribosomal protein S30 2 2
MIRT690503 MDM2 MDM2 proto-oncogene 2 2
MIRT691056 CRCP CGRP receptor component 2 2
MIRT691441 CXorf36 chromosome X open reading frame 36 2 2
MIRT691918 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT692269 GPR157 G protein-coupled receptor 157 2 2
MIRT692631 SUSD1 sushi domain containing 1 2 2
MIRT693378 ZNF528 zinc finger protein 528 2 2
MIRT693858 IYD iodotyrosine deiodinase 2 2
MIRT693971 ZNF70 zinc finger protein 70 2 2
MIRT694137 CYP27C1 cytochrome P450 family 27 subfamily C member 1 2 2
MIRT694288 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT694608 CXorf56 chromosome X open reading frame 56 2 2
MIRT694988 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 2 2
MIRT695160 TCTN2 tectonic family member 2 2 2
MIRT695359 PHAX phosphorylated adaptor for RNA export 2 2
MIRT695538 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 2
MIRT695884 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT696015 TYRO3 TYRO3 protein tyrosine kinase 2 2
MIRT696052 ZNF264 zinc finger protein 264 2 2
MIRT696119 GLP2R glucagon like peptide 2 receptor 2 2
MIRT696154 SLC11A2 solute carrier family 11 member 2 2 2
MIRT696158 TIPIN TIMELESS interacting protein 2 2
MIRT696295 SCO1 SCO1, cytochrome c oxidase assembly protein 2 2
MIRT696394 CORO7 coronin 7 2 2
MIRT696675 APOC3 apolipoprotein C3 2 2
MIRT696696 PNPO pyridoxamine 5'-phosphate oxidase 2 2
MIRT696742 RBM28 RNA binding motif protein 28 2 2
MIRT696842 WDR13 WD repeat domain 13 2 2
MIRT697179 QPCTL glutaminyl-peptide cyclotransferase like 2 2
MIRT697876 UBE2B ubiquitin conjugating enzyme E2 B 2 2
MIRT698134 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT698352 TMEM127 transmembrane protein 127 2 2
MIRT698698 TBC1D15 TBC1 domain family member 15 2 2
MIRT698824 STARD7 StAR related lipid transfer domain containing 7 2 2
MIRT699111 SMU1 DNA replication regulator and spliceosomal factor 2 2
MIRT699657 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT699845 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT699954 RSBN1 round spermatid basic protein 1 2 2
MIRT700447 PURB purine rich element binding protein B 2 2
MIRT700887 PER2 period circadian clock 2 2 2
MIRT700906 PDXK pyridoxal kinase 2 2
MIRT701001 PCSK6 proprotein convertase subtilisin/kexin type 6 2 2
MIRT701082 PAPOLG poly(A) polymerase gamma 2 2
MIRT701138 PANK1 pantothenate kinase 1 2 2
MIRT701204 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT701374 NOA1 nitric oxide associated 1 2 2
MIRT701627 MYO10 myosin X 2 2
MIRT701847 MRO maestro 2 2
MIRT702074 PCDHB11 protocadherin beta 11 2 2
MIRT702265 LHX4 LIM homeobox 4 2 3
MIRT702350 KLHL26 kelch like family member 26 2 2
MIRT702417 KIF5B kinesin family member 5B 2 2
MIRT702553 KBTBD6 kelch repeat and BTB domain containing 6 2 2
MIRT702769 IFNLR1 interferon lambda receptor 1 2 2
MIRT703300 GGCX gamma-glutamyl carboxylase 2 2
MIRT703408 FYTTD1 forty-two-three domain containing 1 2 2
MIRT703467 FOSL2 FOS like 2, AP-1 transcription factor subunit 2 2
MIRT703549 FKBP14 FK506 binding protein 14 2 2
MIRT703953 ENAH ENAH, actin regulator 2 2
MIRT703969 EMC10 ER membrane protein complex subunit 10 2 2
MIRT704307 DCUN1D5 defective in cullin neddylation 1 domain containing 5 2 2
MIRT704455 CRNKL1 crooked neck pre-mRNA splicing factor 1 2 2
MIRT705028 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT705113 C4orf29 abhydrolase domain containing 18 2 2
MIRT705837 AHCY adenosylhomocysteinase 2 2
MIRT708432 CPM carboxypeptidase M 2 2
MIRT710340 ZNF669 zinc finger protein 669 2 2
MIRT710828 PLEKHO2 pleckstrin homology domain containing O2 2 2
MIRT712615 KNSTRN kinetochore localized astrin/SPAG5 binding protein 2 2
MIRT714275 COQ7 coenzyme Q7, hydroxylase 2 2
MIRT718942 HIF1AN hypoxia inducible factor 1 alpha subunit inhibitor 2 2
MIRT719748 RRP8 ribosomal RNA processing 8 2 2
MIRT720035 C12orf5 TP53 induced glycolysis regulatory phosphatase 2 2
MIRT720432 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT720632 SPA17 sperm autoantigenic protein 17 2 2
MIRT720728 ELOVL7 ELOVL fatty acid elongase 7 2 2
MIRT722882 MOB3A MOB kinase activator 3A 2 2
MIRT723045 YTHDC1 YTH domain containing 1 2 2
MIRT723441 NDUFAF3 NADH:ubiquinone oxidoreductase complex assembly factor 3 2 2
MIRT724404 WWC1 WW and C2 domain containing 1 2 2
MIRT725459 GRAP2 GRB2-related adaptor protein 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-548s Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-548s Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-548s Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-548s Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-548s Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-548s Cisplatin 5460033 NSC119875 approved sensitive cell line (MGC-803)
hsa-miR-548s Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-548s Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)

Error report submission