miRTarBase - #MIRT301069


—
pre-miRNA Information
pre-miRNA hsa-mir-7849   
Genomic Coordinates chr4: 146408583 - 146408688
Description Homo sapiens miR-7849 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-7849-3p
Sequence 64| GACAAUUGUUGAUCUUGGGCCU |85
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1386078731 3 dbSNP
rs144001291 10 dbSNP
rs1334425573 16 dbSNP
rs557644637 20 dbSNP
Putative Targets

Gene Information
Gene Symbol SLC16A14   
Synonyms MCT14
Description solute carrier family 16 member 14
Transcript NM_152527   
Expression
Putative miRNA Targets on SLC16A14
3'UTR of SLC16A14
(miRNA target sites are highlighted)		 
>SLC16A14|NM_152527|3'UTR
   1 TATCATGTAATGTTCCGTGTAGGTTTCATTGTAATACTCATGCCTACCTCGCATGGTTGCTGTGAGGCACCTATGACAGG
  81 ACGTGGGAAAGCATTTTGTACGGTAACTGGCACTGTCATTTGTAAATGCCATTGTCACAGCCTCATTTGTAAGCAGCACT
 161 GCCTCTCTGTTTGGGGAGATGTAATGCTGGAAGATCTTAAGGACTACATACATTCTAGAGATGACAGTGTTGTTCAAAGA
 241 CAGCCTAGTAAGTAATTGGTAGAAATGCCCTTATAAAAACCATTCTCTTGTCATCTACTGGGACTAGGGTTTTAAATACA
 321 GCTTTTAAAAACAAAAACAGGGAATAAAAGCTTTTCAACTCAACCACTTCTTTGTAAGACAAAACTGAAGTATCTGTGTG
 401 CTTCCAGAAAGCTTACAGATAAATGGGTTTCAAGCACAAGAATATGACTAGATTTCAGAAATTAATTATTACAGGGAGCT
 481 ATTGATCTACTAGCATCAAACAAAGGCAAGCTCTAATTCCACAGGTAATACAATTTAGTGCAATTAAAGAAACACGGCTT
 561 GTATTTTTATGAGGGAATTCTGCAGCTAGGGATTGTGACTCCTAAATCCTCCTCTAAAAGAAGGCACTTGCCATTAATCC
 641 TAATTCAGTGCTATCCAGTTATAAATGGAATCTTGAGACAAAACCTTAACAAAGAAATAACAGTAATGATTTCCTTAGCA
 721 GAAGCCGTATTTGTACGCACAACATTAAATCAAGGGCTACAATTCAAGCACTTTTATTCGTATCATTGGCCTCTTAGATG
 801 ATATAAGCATGAGGTGGGGCCTGTAATATTTTTTTCTGAGTTTCTTCTGCCCAAAAATATAATATAGAACTAATTGCTAA
 881 CTGACAAATAAAGTTAATAGTTAAATCATCTCCAAGGAATGTTGCTAATCCAAAGTATAACACTATCAATTTGTGAGGAT
 961 AATAAATGGAATGCCATTAGTGTAGATGTCTGTGCCACATCTGACACTGGAGTAGTGATAACAAATAGCCCATCTCTAGA
1041 CTCTCGTGTTGTTATATAGACCATTCATTTGCCTGAGCGTGGCACAGTTTTAAAAATAGTTCTCTTGATTGATTTCATAC
1121 AGAAGATGACTGTGATCCATGACATCTAATAATGCCCTTTCTTTATCTGAGATGTCTATTTTTCTAAGCCAAACGTTTTT
1201 CAGACTGCAGAATGTTCTTCCCAGATCATTTGAAATTTCTGGCTGCCTTACTTGTTTACAGATAGTTTAAGACTATTTAA
1281 ATTTCTACTCACAATTTGATCATCACACACACACAAATCCTTGAATATCATTGCCAGTGTCTTAGGTCAAATTTACCTAA
1361 AGTGAATACAGCCCATTCTCAATTATCCTTCACAATTAGACGCAGGAATGCTACTAGGAATTGGAATCAAACAATGCCAC
1441 CCCAAGCGTAATTTTAGCCAGCAGTTTCAGTTATACTCAACCATGCCCTTCTGAGCTGTTAACAAGTGATTCAATGGACA
1521 AGTTCTCTTTTTGTTCCATCTCCATTATTTCCTGCTCTAATGTATAGTGGGAGTGGTTGTGTAATGAAAGGACCACCAAA
1601 ATAATAAAAGGCAGCTAATGGAAAGGAGAGACAAAAGCATGGTTAATATATATACTTAATATTACCTCCAATGACTCGGG
1681 AATTGCCTGTAAATTATTATAGACAATAGATTGCATGTCATACTCCATTTGGTTCAACACAACAACCTATGTGTTATCAT
1761 TACAGCTTTGGCTGCTGTTAAAGAATCCAGCTCTCTATTTTGATAAAGATAATCTTAAAGCTGAGGCAATGCTCCCTCCT
1841 CTATCTCTCTCTGTGTAATTTACCATAGAATTAGGATGATTAGATTGAAACACATGTTGTATGTTTTAAAAACTACATTG
1921 CTTCATTACTTTCATTTTCCGACAACATCAAACTAACAAGAGGCAGTGTTAAATATTTTAAATGGTGCTATAGCCAATGT
2001 ATTTGAATGCTTGCACTGCTGGTTGTGTATCATCAATATGAACTTTTTATCCAATGACTCAACTCTAATTACATCTAAGT
2081 TAGACTTGCTCACGTTCAGTTTGTACAGTTGTGTGTTGACTTACTATGTTTTGAAAGTGGTGACTTCTACCGAATGAGTG
2161 GAAGTTCCCATTGTCAAAAAAAATAAAGACCTGCTTGCAGTATTCATGTTGACAACAGAGTAAAAGAGAATACTGTAAAG
2241 AATTACTGCAAATATTTCCTGTTTATGTTATTTGCCGTTGTTTGAAGATATTATAAAGGGTTAATTGTATATTTATATCA
2321 TGTGCTTTATCGTTTTCCCCTCATGTATCCAAGTAATTTTTATTTACATACAACTAAATAAATGTTGTCCTCTTTGAAGA
2401 CGGTCAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucCGGGUUCUAGU------UGUUAACAg 5'
            ||:|| | |||      |||:|||| 
Target 5' ttGCTCACGTTCAGTTTGTACAGTTGTg 3'
 2086 - 2113 146.00 -11.40
2 
miRNA  3' uccgggUUCUA----GUU-----GUUAACAg 5'
                |||||    :||     :|||||| 
Target 5' tgtttgAAGATATTATAAAGGGTTAATTGTa 3'
 2279 - 2309 130.00 -6.80
3 
miRNA  3' uccgGGUUCUAGUUGUUAAcag 5'
              :||||: | ||||||   
Target 5' taaaTCAAGGGCTACAATTcaa 3'
 746 - 767 126.00 -9.52
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30535623 9 COSMIC
COSN13976179 16 COSMIC
COSN1234973 17 COSMIC
COSN31600640 24 COSMIC
COSN30542354 37 COSMIC
COSN17132155 51 COSMIC
COSN30101217 64 COSMIC
COSN30100818 83 COSMIC
COSN28201032 101 COSMIC
COSN31584974 129 COSMIC
COSN30110068 161 COSMIC
COSN30157946 167 COSMIC
COSN31525548 193 COSMIC
COSN1830642 514 COSMIC
COSN24487778 581 COSMIC
COSN31967688 779 COSMIC
COSN25804661 863 COSMIC
COSN31778174 1079 COSMIC
COSN31578463 1098 COSMIC
COSN26548245 1189 COSMIC
COSN31584781 1323 COSMIC
COSN25525169 1385 COSMIC
COSN30161047 1457 COSMIC
COSN1830641 1576 COSMIC
COSN31567826 1783 COSMIC
COSN31571953 1799 COSMIC
COSN5499760 1838 COSMIC
COSN1830640 2065 COSMIC
COSN21112639 2197 COSMIC
COSN31529438 2226 COSMIC
COSN32099323 2287 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1271009056 6 dbSNP
rs1475452353 10 dbSNP
rs371317232 12 dbSNP
rs772544973 16 dbSNP
rs748453094 17 dbSNP
rs1376394613 19 dbSNP
rs774958543 23 dbSNP
rs1293620072 27 dbSNP
rs377633420 30 dbSNP
rs373831513 31 dbSNP
rs780315736 37 dbSNP
rs1274223887 39 dbSNP
rs1170670450 40 dbSNP
rs1477673107 43 dbSNP
rs1233191318 45 dbSNP
rs370539947 50 dbSNP
rs781259109 51 dbSNP
rs1280793661 55 dbSNP
rs1487799021 57 dbSNP
rs1203076186 67 dbSNP
rs368203213 70 dbSNP
rs1263389384 80 dbSNP
rs1307745418 82 dbSNP
rs553631225 83 dbSNP
rs974098316 101 dbSNP
rs969359020 102 dbSNP
rs534945312 104 dbSNP
rs916559216 115 dbSNP
rs1176014720 119 dbSNP
rs992662771 132 dbSNP
rs148604703 134 dbSNP
rs1287383838 141 dbSNP
rs1387374764 151 dbSNP
rs569349545 161 dbSNP
rs1382949943 163 dbSNP
rs1031587409 164 dbSNP
rs999692750 165 dbSNP
rs1368799787 167 dbSNP
rs1443012533 174 dbSNP
rs1179195631 176 dbSNP
rs1304059169 180 dbSNP
rs1029681046 189 dbSNP
rs796785873 190 dbSNP
rs763061194 197 dbSNP
rs1022487383 198 dbSNP
rs147557268 208 dbSNP
rs900191290 210 dbSNP
rs1250612756 213 dbSNP
rs1485868897 214 dbSNP
rs1469365266 222 dbSNP
rs376215541 239 dbSNP
rs1039982123 241 dbSNP
rs372870724 244 dbSNP
rs1282448644 252 dbSNP
rs903687646 253 dbSNP
rs537023944 256 dbSNP
rs1365859452 258 dbSNP
rs1454515530 263 dbSNP
rs886187164 271 dbSNP
rs185410141 272 dbSNP
rs769719248 274 dbSNP
rs1307024619 275 dbSNP
rs896437336 283 dbSNP
rs1326550071 287 dbSNP
rs145065456 289 dbSNP
rs1048055408 290 dbSNP
rs867081657 307 dbSNP
rs1287316544 313 dbSNP
rs1415840550 322 dbSNP
rs532385573 326 dbSNP
rs904931103 329 dbSNP
rs1465939761 334 dbSNP
rs535428260 338 dbSNP
rs920534606 339 dbSNP
rs1256824068 341 dbSNP
rs908722720 356 dbSNP
rs745801448 367 dbSNP
rs1044350547 373 dbSNP
rs948587927 378 dbSNP
rs141014403 415 dbSNP
rs1253103322 425 dbSNP
rs992131732 427 dbSNP
rs780380174 444 dbSNP
rs13432082 449 dbSNP
rs922871366 450 dbSNP
rs975405221 456 dbSNP
rs1259305492 469 dbSNP
rs924037906 474 dbSNP
rs1198681944 481 dbSNP
rs796144359 493 dbSNP
rs1260803767 505 dbSNP
rs1353965119 512 dbSNP
rs1460420800 515 dbSNP
rs1217392511 518 dbSNP
rs1299748183 520 dbSNP
rs1397030348 525 dbSNP
rs1033059947 526 dbSNP
rs1291110803 531 dbSNP
rs1326442029 533 dbSNP
rs979274267 535 dbSNP
rs1233467841 542 dbSNP
rs1294247548 543 dbSNP
rs1305190258 544 dbSNP
rs529765417 545 dbSNP
rs1267152635 548 dbSNP
rs1481190911 553 dbSNP
rs112997092 555 dbSNP
rs1255803642 556 dbSNP
rs1357788490 556 dbSNP
rs1022391326 571 dbSNP
rs1188855797 583 dbSNP
rs374526554 589 dbSNP
rs974974472 597 dbSNP
rs1418906629 599 dbSNP
rs1426808854 602 dbSNP
rs1009380696 615 dbSNP
rs1291759738 615 dbSNP
rs1395967040 622 dbSNP
rs1355017777 624 dbSNP
rs1433980649 637 dbSNP
rs1310865830 639 dbSNP
rs1376983537 649 dbSNP
rs896406176 651 dbSNP
rs1291133202 662 dbSNP
rs1034932889 674 dbSNP
rs1215788951 679 dbSNP
rs746844766 682 dbSNP
rs1343541278 686 dbSNP
rs1234142111 690 dbSNP
rs777410633 692 dbSNP
rs964894285 702 dbSNP
rs542673663 717 dbSNP
rs147339137 726 dbSNP
rs758094492 727 dbSNP
rs886215823 736 dbSNP
rs1026045920 737 dbSNP
rs1420252799 751 dbSNP
rs994971852 759 dbSNP
rs899009527 768 dbSNP
rs1396725461 769 dbSNP
rs1211167508 774 dbSNP
rs1044215476 779 dbSNP
rs1262410515 780 dbSNP
rs886891142 782 dbSNP
rs189208193 797 dbSNP
rs1266889522 803 dbSNP
rs183918181 808 dbSNP
rs934186121 813 dbSNP
rs1336412325 814 dbSNP
rs922817189 815 dbSNP
rs1350580674 825 dbSNP
rs1056898861 826 dbSNP
rs942694264 836 dbSNP
rs1315373565 863 dbSNP
rs1218139761 867 dbSNP
rs939350691 874 dbSNP
rs925960100 880 dbSNP
rs978816760 886 dbSNP
rs923917046 888 dbSNP
rs1191731806 889 dbSNP
rs967849624 893 dbSNP
rs1020408798 896 dbSNP
rs1478256162 904 dbSNP
rs544729687 909 dbSNP
rs868326569 910 dbSNP
rs34193177 918 dbSNP
rs978217009 919 dbSNP
rs1405463968 926 dbSNP
rs1402100181 940 dbSNP
rs960534780 942 dbSNP
rs752254280 950 dbSNP
rs1459407338 955 dbSNP
rs778491950 957 dbSNP
rs191232208 961 dbSNP
rs1380984506 967 dbSNP
rs1279348573 971 dbSNP
rs1371543550 972 dbSNP
rs143946938 977 dbSNP
rs974881259 983 dbSNP
rs1334325874 987 dbSNP
rs1364575150 988 dbSNP
rs904827762 989 dbSNP
rs1443384153 991 dbSNP
rs1392635616 995 dbSNP
rs1162873189 997 dbSNP
rs1457258818 998 dbSNP
rs1016998551 1000 dbSNP
rs1172476923 1002 dbSNP
rs1180929197 1002 dbSNP
rs1447523690 1003 dbSNP
rs1246891878 1005 dbSNP
rs139365606 1010 dbSNP
rs1469409363 1011 dbSNP
rs1264888989 1014 dbSNP
rs68015263 1016 dbSNP
rs1481183335 1022 dbSNP
rs1416693892 1026 dbSNP
rs987566085 1029 dbSNP
rs950431360 1031 dbSNP
rs186875222 1034 dbSNP
rs537085658 1036 dbSNP
rs765359796 1037 dbSNP
rs150843245 1038 dbSNP
rs1022842394 1046 dbSNP
rs1444785746 1046 dbSNP
rs1355096194 1054 dbSNP
rs1231630386 1059 dbSNP
rs1236660592 1061 dbSNP
rs1295217597 1069 dbSNP
rs942935287 1078 dbSNP
rs1012744409 1079 dbSNP
rs1392136916 1086 dbSNP
rs895746808 1087 dbSNP
rs1396968265 1097 dbSNP
rs1299607233 1098 dbSNP
rs926252019 1099 dbSNP
rs1427579596 1117 dbSNP
rs1189536673 1125 dbSNP
rs1368606169 1127 dbSNP
rs1043450080 1128 dbSNP
rs1057068874 1136 dbSNP
rs934546301 1138 dbSNP
rs913282929 1140 dbSNP
rs1174162708 1141 dbSNP
rs1417954266 1146 dbSNP
rs1432125817 1148 dbSNP
rs558237329 1153 dbSNP
rs757729269 1154 dbSNP
rs1042742613 1160 dbSNP
rs1413175714 1163 dbSNP
rs539511112 1166 dbSNP
rs141455780 1167 dbSNP
rs757391739 1172 dbSNP
rs1437988899 1188 dbSNP
rs1226754684 1190 dbSNP
rs974910684 1194 dbSNP
rs943521266 1195 dbSNP
rs546788972 1198 dbSNP
rs1279361669 1204 dbSNP
rs528274255 1208 dbSNP
rs980601487 1213 dbSNP
rs1212643964 1214 dbSNP
rs1256391656 1221 dbSNP
rs987753517 1222 dbSNP
rs1445957025 1228 dbSNP
rs1190437012 1230 dbSNP
rs1243293437 1231 dbSNP
rs752723784 1233 dbSNP
rs1451892808 1241 dbSNP
rs148333722 1249 dbSNP
rs969691760 1251 dbSNP
rs1433233847 1252 dbSNP
rs1174584103 1255 dbSNP
rs1482924339 1256 dbSNP
rs549291087 1263 dbSNP
rs950996700 1264 dbSNP
rs1328219479 1275 dbSNP
rs1281724419 1277 dbSNP
rs182545235 1282 dbSNP
rs1302567228 1283 dbSNP
rs1345523691 1288 dbSNP
rs190381190 1294 dbSNP
rs1256328004 1300 dbSNP
rs963156125 1308 dbSNP
rs545103203 1314 dbSNP
rs867663619 1319 dbSNP
rs532860352 1320 dbSNP
rs1349532992 1323 dbSNP
rs1274275860 1333 dbSNP
rs1285749967 1334 dbSNP
rs1464953839 1343 dbSNP
rs1189845729 1344 dbSNP
rs1252896128 1355 dbSNP
rs1240037195 1356 dbSNP
rs1337828754 1357 dbSNP
rs1453010374 1359 dbSNP
rs1025376595 1364 dbSNP
rs1022705006 1366 dbSNP
rs1286671083 1374 dbSNP
rs997948566 1376 dbSNP
rs1407820649 1383 dbSNP
rs1369683530 1387 dbSNP
rs900952510 1393 dbSNP
rs1012649244 1399 dbSNP
rs116413365 1401 dbSNP
rs1416052433 1402 dbSNP
rs1399450544 1403 dbSNP
rs1334881550 1410 dbSNP
rs1007100831 1415 dbSNP
rs116069372 1421 dbSNP
rs1043320652 1428 dbSNP
rs1212489657 1433 dbSNP
rs115006723 1434 dbSNP
rs1467546301 1445 dbSNP
rs576396988 1447 dbSNP
rs903096907 1448 dbSNP
rs1042405484 1449 dbSNP
rs1010850717 1451 dbSNP
rs1179984288 1468 dbSNP
rs763264520 1470 dbSNP
rs1473016528 1476 dbSNP
rs759436350 1480 dbSNP
rs1164330579 1482 dbSNP
rs893915370 1484 dbSNP
rs1039113199 1487 dbSNP
rs943428154 1503 dbSNP
rs912069611 1510 dbSNP
rs1395582183 1517 dbSNP
rs1389441137 1522 dbSNP
rs1289878199 1530 dbSNP
rs1350762687 1537 dbSNP
rs1232253782 1553 dbSNP
rs1290922371 1555 dbSNP
rs775505409 1557 dbSNP
rs555685075 1559 dbSNP
rs1057112858 1562 dbSNP
rs543664383 1564 dbSNP
rs1480532565 1565 dbSNP
rs927405869 1569 dbSNP
rs981009794 1573 dbSNP
rs1205855420 1579 dbSNP
rs919493864 1585 dbSNP
rs1187405739 1586 dbSNP
rs1415856031 1589 dbSNP
rs1425618972 1592 dbSNP
rs1165460059 1594 dbSNP
rs1372398006 1596 dbSNP
rs1460368075 1610 dbSNP
rs1352907898 1612 dbSNP
rs1370881360 1619 dbSNP
rs765367857 1619 dbSNP
rs370190194 1638 dbSNP
rs1227975519 1640 dbSNP
rs1380769309 1649 dbSNP
rs915553891 1652 dbSNP
rs984075330 1655 dbSNP
rs557834377 1665 dbSNP
rs1307445163 1675 dbSNP
rs1450131083 1677 dbSNP
rs1338698293 1678 dbSNP
rs1333414611 1679 dbSNP
rs1343312194 1680 dbSNP
rs991247806 1687 dbSNP
rs1025302468 1697 dbSNP
rs1484301774 1714 dbSNP
rs960018910 1718 dbSNP
rs997876717 1721 dbSNP
rs1261070935 1725 dbSNP
rs1426677913 1731 dbSNP
rs1170342880 1732 dbSNP
rs1156542163 1743 dbSNP
rs759760189 1744 dbSNP
rs1390636154 1747 dbSNP
rs1035568472 1755 dbSNP
rs1171403643 1773 dbSNP
rs539947886 1774 dbSNP
rs1419041288 1780 dbSNP
rs967351200 1782 dbSNP
rs188287934 1783 dbSNP
rs773956596 1793 dbSNP
rs1433612424 1795 dbSNP
rs893820610 1800 dbSNP
rs1038977332 1801 dbSNP
rs1007642879 1802 dbSNP
rs1007438097 1805 dbSNP
rs1233982287 1816 dbSNP
rs1276901438 1821 dbSNP
rs1237464347 1827 dbSNP
rs890532348 1829 dbSNP
rs1194478856 1831 dbSNP
rs1211019932 1834 dbSNP
rs1051970192 1840 dbSNP
rs929449791 1843 dbSNP
rs554293313 1846 dbSNP
rs1248531717 1847 dbSNP
rs866091328 1851 dbSNP
rs1246214842 1853 dbSNP
rs534856033 1858 dbSNP
rs1191536944 1863 dbSNP
rs1426932564 1867 dbSNP
rs1414685844 1868 dbSNP
rs942227697 1874 dbSNP
rs1157907459 1882 dbSNP
rs1022269470 1883 dbSNP
rs1458337431 1895 dbSNP
rs760995592 1896 dbSNP
rs1010498481 1900 dbSNP
rs776825234 1901 dbSNP
rs1440754277 1914 dbSNP
rs1273458766 1916 dbSNP
rs991151265 1918 dbSNP
rs1275277222 1930 dbSNP
rs892073925 1932 dbSNP
rs1306550563 1935 dbSNP
rs567467912 1940 dbSNP
rs1210702673 1941 dbSNP
rs1268793161 1951 dbSNP
rs938479352 1954 dbSNP
rs569695453 1958 dbSNP
rs1248309053 1971 dbSNP
rs1478225832 1977 dbSNP
rs1366765298 1993 dbSNP
rs928361620 1994 dbSNP
rs1176315833 1998 dbSNP
rs1409273315 2010 dbSNP
rs1473345975 2012 dbSNP
rs977306024 2013 dbSNP
rs1393024886 2015 dbSNP
rs967633551 2027 dbSNP
rs1461385400 2031 dbSNP
rs1021384292 2034 dbSNP
rs905948364 2037 dbSNP
rs1352044064 2054 dbSNP
rs543064277 2056 dbSNP
rs1044493261 2063 dbSNP
rs1348883730 2068 dbSNP
rs549305727 2073 dbSNP
rs1230398224 2079 dbSNP
rs771043983 2084 dbSNP
rs1289069519 2090 dbSNP
rs1334246721 2091 dbSNP
rs1433712029 2093 dbSNP
rs142812557 2094 dbSNP
rs766056060 2108 dbSNP
rs1166447575 2109 dbSNP
rs947858162 2115 dbSNP
rs569655491 2123 dbSNP
rs556174949 2124 dbSNP
rs1182370996 2128 dbSNP
rs963888966 2134 dbSNP
rs1169023193 2139 dbSNP
rs183823596 2142 dbSNP
rs1471517436 2149 dbSNP
rs746896255 2152 dbSNP
rs890572852 2154 dbSNP
rs1030851816 2155 dbSNP
rs993569505 2156 dbSNP
rs1406407658 2167 dbSNP
rs191619109 2176 dbSNP
rs929860701 2180 dbSNP
rs532923785 2183 dbSNP
rs1411978285 2184 dbSNP
rs1219604636 2191 dbSNP
rs1354953668 2197 dbSNP
rs187205640 2198 dbSNP
rs1288816916 2201 dbSNP
rs1213863910 2205 dbSNP
rs1272217709 2213 dbSNP
rs1344039210 2214 dbSNP
rs762469611 2215 dbSNP
rs181954834 2220 dbSNP
rs1215098858 2221 dbSNP
rs773092112 2227 dbSNP
rs894723380 2236 dbSNP
rs965051219 2237 dbSNP
rs1256345683 2253 dbSNP
rs1344318653 2271 dbSNP
rs1189042039 2272 dbSNP
rs189589174 2276 dbSNP
rs116199717 2277 dbSNP
rs1388766835 2284 dbSNP
rs1371058536 2309 dbSNP
rs1169509123 2310 dbSNP
rs969259872 2317 dbSNP
rs928296022 2322 dbSNP
rs185214071 2325 dbSNP
rs7355333 2331 dbSNP
rs138081675 2332 dbSNP
rs1367162032 2345 dbSNP
rs1228832665 2347 dbSNP
rs1279295975 2356 dbSNP
rs989937409 2363 dbSNP
rs572462253 2364 dbSNP
rs1369306235 2367 dbSNP
rs1044847663 2368 dbSNP
rs942113254 2369 dbSNP
rs1188538259 2374 dbSNP
rs1168483794 2378 dbSNP
rs1454795345 2379 dbSNP
rs1246694465 2389 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 151473.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000295190.4 | 3UTR | UAUAUUUAUAUCAUGUGCUUUAUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000295190.4 | 3UTR | UAUAUUUAUAUCAUGUGCUUUAUCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000295190.4 | 3UTR | UAUAUUUAUAUCAUGUGCUUUAUCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
69 hsa-miR-7849-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT062192 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT064755 CCND2 cyclin D2 2 8
MIRT076594 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT086027 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT091394 EIF4A2 eukaryotic translation initiation factor 4A2 2 2
MIRT104730 KLF10 Kruppel like factor 10 2 2
MIRT105345 SLC7A2 solute carrier family 7 member 2 2 2
MIRT105672 PNMA2 paraneoplastic Ma antigen 2 2 6
MIRT173218 TMEM64 transmembrane protein 64 2 2
MIRT228305 SMU1 DNA replication regulator and spliceosomal factor 2 2
MIRT229503 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 2
MIRT243387 SKIL SKI like proto-oncogene 2 2
MIRT257404 E2F3 E2F transcription factor 3 2 2
MIRT301069 SLC16A14 solute carrier family 16 member 14 2 4
MIRT307327 CTNNB1 catenin beta 1 2 2
MIRT443182 DENND4C DENN domain containing 4C 2 2
MIRT469272 RHOB ras homolog family member B 2 8
MIRT475106 IRF2BP2 interferon regulatory factor 2 binding protein 2 2 4
MIRT484134 C14orf142 GON7, KEOPS complex subunit homolog 2 2
MIRT491117 TMTC1 transmembrane and tetratricopeptide repeat containing 1 2 4
MIRT504856 HAUS3 HAUS augmin like complex subunit 3 2 4
MIRT505544 SNX16 sorting nexin 16 2 6
MIRT506752 LCOR ligand dependent nuclear receptor corepressor 2 8
MIRT507358 FAM129A family with sequence similarity 129 member A 2 6
MIRT507812 CDK6 cyclin dependent kinase 6 2 6
MIRT510730 SON SON DNA binding protein 2 6
MIRT521296 RRAGD Ras related GTP binding D 2 4
MIRT521371 RNF11 ring finger protein 11 2 6
MIRT525860 ARL13B ADP ribosylation factor like GTPase 13B 2 2
MIRT527352 FAM69C family with sequence similarity 69 member C 2 2
MIRT528796 RAB32 RAB32, member RAS oncogene family 2 2
MIRT530417 SULT1B1 sulfotransferase family 1B member 1 2 2
MIRT533425 TWF1 twinfilin actin binding protein 1 2 2
MIRT539512 ACSS3 acyl-CoA synthetase short chain family member 3 2 2
MIRT543660 ZNF589 zinc finger protein 589 2 4
MIRT544833 ZNF639 zinc finger protein 639 2 2
MIRT545266 TRIM36 tripartite motif containing 36 2 4
MIRT545425 SLC39A6 solute carrier family 39 member 6 2 2
MIRT546070 VEZF1 vascular endothelial zinc finger 1 2 2
MIRT546896 PTPRK protein tyrosine phosphatase, receptor type K 2 2
MIRT547932 HNRNPR heterogeneous nuclear ribonucleoprotein R 2 2
MIRT548836 CHD1 chromodomain helicase DNA binding protein 1 2 4
MIRT550937 ZNF100 zinc finger protein 100 2 2
MIRT551840 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 2 2
MIRT553749 TBC1D8 TBC1 domain family member 8 2 2
MIRT554070 SOBP sine oculis binding protein homolog 2 2
MIRT554254 SIX4 SIX homeobox 4 2 2
MIRT558254 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT559252 BBX BBX, HMG-box containing 2 4
MIRT561110 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT561412 TSN translin 2 2
MIRT562154 ID4 inhibitor of DNA binding 4, HLH protein 2 2
MIRT563324 ORC4 origin recognition complex subunit 4 2 2
MIRT563985 SLFN11 schlafen family member 11 2 2
MIRT571387 JKAMP JNK1/MAPK8-associated membrane protein 2 2
MIRT575040 Fasl Fas ligand (TNF superfamily, member 6) 1 1
MIRT610374 C9orf64 chromosome 9 open reading frame 64 2 2
MIRT611045 FASLG Fas ligand 2 3
MIRT625440 RMDN1 regulator of microtubule dynamics 1 2 2
MIRT655071 PKIA cAMP-dependent protein kinase inhibitor alpha 2 2
MIRT656139 MSH6 mutS homolog 6 2 2
MIRT667042 PDE3A phosphodiesterase 3A 2 2
MIRT691264 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT699773 SEMA4D semaphorin 4D 2 2
MIRT707809 TSPAN6 tetraspanin 6 2 2
MIRT711125 CYYR1 cysteine and tyrosine rich 1 2 2
MIRT714107 RLIM ring finger protein, LIM domain interacting 2 2
MIRT717792 TGFBR2 transforming growth factor beta receptor 2 2 2
MIRT717929 ZNF546 zinc finger protein 546 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-7849-3p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-miR-7849-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission