miRTarBase - #MIRT303051


—
pre-miRNA Information
pre-miRNA hsa-mir-1299   
Genomic Coordinates chr9: 40929010 - 40929092
Synonyms MIRN1299, hsa-mir-1299, MIR1299
Description Homo sapiens miR-1299 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-1299
Sequence 62| UUCUGGAAUUCUGUGUGAGGGA |83
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1042551075 4 dbSNP
rs747216379 19 dbSNP
rs1009712608 20 dbSNP
rs796108267 21 dbSNP
rs796728500 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol B3GNT2   
Synonyms 3-Gn-T1, 3-Gn-T2, B3GN-T2, B3GNT, B3GNT-2, B3GNT1, BETA3GNT, BGNT2, BGnT-2, beta-1, beta3Gn-T1, beta3Gn-T2
Description UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
Transcript NM_006577   
Expression
Putative miRNA Targets on B3GNT2
3'UTR of B3GNT2
(miRNA target sites are highlighted)		 
>B3GNT2|NM_006577|3'UTR
   1 AATAGATACAAACTCAATTTTGCATAGAAAGGTGTATTTTGAATAGTTCCCATGTTGTGTTCTCACATTAGAGTAATTTC
  81 TATATTAAACCATGAAAATTGCCTTTATGAGTGATACCCATTTGAGGGCCTCTAAACCCTTCAATTTGGTACTCACGTGA
 161 AGAGGGAAAGCGGAAGATGGTAATTTTTTTTTATGGATGATATGGCAGGATGATTGGTTCTGATCTTACCGGCTAGTGGT
 241 CATTTTTAAAAAACTTGTACCCTCTTATCTGAAATCCTGTTTCTGGAATTTGGCCATTTTAAGTGATTTTGTTTGCCCTC
 321 TTCTATAATATTCCTACTTCCCATAATAATGACTGATTTATTTGTAATTCAGGTATTTATAAACCTATTGGCTACAAAGA
 401 CTTTGTTAAACATTATCCAGTGGTTTTCGTGAAATGGAATTATGTTTATTTTTATGGGATTTGGGTAAATTTTAAATTGT
 481 CTAGAAAACTGAAATTTCAGTTGTCAGTTGTGGAATTCAGTTTTTCAATTGTGGAAATTTCCTGCCACCCCAACAGTATT
 561 TTTGTGTGTTAATTAATTTTGCAAAATGAGAATCATGGTGTGACACTCATCTAATTTATCTTGTTGTGATGTTATGGTCA
 641 TAATAAGGAGAAAGAGGGTTTAATTTTTCTTGTATTTGGTTTCCTGGTGGTATCATAGTGTAATTTTAGTATTTGAAAAT
 721 CAGTGTGATTCCTTAATGGCCAACTGAAGATTGAATTGCCGCTAACAACCATATCGTGTTAGTGAATTTTCAATATGGAC
 801 CAGGAAGGCATATGTATTTTGAACTTGAGTGAAAAGGTTGAAGTTACAGACTTTTGCATAGATGGTTTGTCAATTTAAAA
 881 TTCCAGAATTTATTATTGCCATATTTTCACATGCTGCTTATACAAGATTATTATTGAGTAGTAACTGCTTCCCTGTCTAT
 961 GTAGAAGTGCCTGTGTTTTTATTTATTGTTCAGATCAAAGACCAAAACATTTTCTTAAATATATTTTATGTAATATTTTA
1041 TTTGTATACAGTGTTGTTGATGAAATATTTAACTAGAGCATGATATTTTAAATGTTAAGGTGTAACATATGTTAAATAAA
1121 ACTGTTATTTTTGAATTTTAAAATTTGTTTTTTGGGGGTATGAACTACTAGAGTTTAAAATTCTGCCAAACTATTACTTA
1201 TATGTACTATTGTGTAACATACTTTCTTGAAATATTTTTGTTTATAGAATTGAAGGTTCTTATCAGATGGGATACTGGGG
1281 ACTATAAACAATGGAAATAAAGCCACTGTATTTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agggAG-UGUGUCUUAAGGUCUu 5'
              || |: :| ||||||||| 
Target 5' tttgTCAATTTAAAATTCCAGAa 3'
 866 - 888 158.00 -14.00
2 
miRNA  3' agggagUGUGUC-UUAAGGUCuu 5'
                | || | ||||:|||  
Target 5' tctagaAAACTGAAATTTCAGtt 3'
 480 - 502 120.00 -9.01
3 
miRNA  3' agGGAGUGU-GUCUU-------AAGGUCUu 5'
            |||| :| | |||       |||::|| 
Target 5' acCCTCTTATCTGAAATCCTGTTTCTGGAa 3'
 259 - 288 120.00 -14.71
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30186019 6 COSMIC
COSN31565260 16 COSMIC
COSN31505307 33 COSMIC
COSN30476759 51 COSMIC
COSN31606839 63 COSMIC
COSN32065586 81 COSMIC
COSN28643728 83 COSMIC
COSN30530532 130 COSMIC
COSN19380288 135 COSMIC
COSN30111577 153 COSMIC
COSN24298707 158 COSMIC
COSN29802677 167 COSMIC
COSN15623270 173 COSMIC
COSN29728730 193 COSMIC
COSN28652925 195 COSMIC
COSN30131413 402 COSMIC
COSN31546302 473 COSMIC
COSN21778401 680 COSMIC
COSN1241111 761 COSMIC
COSN30120878 776 COSMIC
COSN30532002 793 COSMIC
COSN30124939 810 COSMIC
COSN17730821 874 COSMIC
COSN30545132 941 COSMIC
COSN31608838 992 COSMIC
COSN31517244 1007 COSMIC
COSN31534046 1086 COSMIC
COSN31530735 1122 COSMIC
COSN30530992 1285 COSMIC
COSN31538982 1297 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs146160188 1 dbSNP
rs768401002 6 dbSNP
rs1225397323 10 dbSNP
rs774186504 18 dbSNP
rs1283733563 22 dbSNP
rs762259985 24 dbSNP
rs570336122 25 dbSNP
rs138998287 26 dbSNP
rs1265676937 27 dbSNP
rs773794716 28 dbSNP
rs1191045871 32 dbSNP
rs756753426 35 dbSNP
rs761246811 35 dbSNP
rs766331465 42 dbSNP
rs1157407815 52 dbSNP
rs1032286853 56 dbSNP
rs1306545373 58 dbSNP
rs1377714912 63 dbSNP
rs541814813 64 dbSNP
rs892493686 65 dbSNP
rs1311790559 68 dbSNP
rs1009623533 79 dbSNP
rs1010695162 81 dbSNP
rs1304292542 82 dbSNP
rs3811616 83 dbSNP
rs971213945 103 dbSNP
rs1317359109 114 dbSNP
rs978013536 115 dbSNP
rs1362036182 119 dbSNP
rs6759249 121 dbSNP
rs187780923 135 dbSNP
rs577604070 145 dbSNP
rs544957050 149 dbSNP
rs1226168460 153 dbSNP
rs558107673 157 dbSNP
rs571842735 158 dbSNP
rs1282196130 172 dbSNP
rs975649876 173 dbSNP
rs958611053 178 dbSNP
rs141982185 179 dbSNP
rs3842562 182 dbSNP
rs201479976 184 dbSNP
rs931304740 184 dbSNP
rs770690918 187 dbSNP
rs542424382 188 dbSNP
rs1269569074 189 dbSNP
rs775513869 192 dbSNP
rs940097005 193 dbSNP
rs1136151 195 dbSNP
rs927779913 196 dbSNP
rs192525393 198 dbSNP
rs1055041158 203 dbSNP
rs769951436 208 dbSNP
rs893505894 209 dbSNP
rs915389126 211 dbSNP
rs1417964562 226 dbSNP
rs368359477 228 dbSNP
rs1010559458 231 dbSNP
rs1050549806 231 dbSNP
rs910743287 232 dbSNP
rs1485460726 236 dbSNP
rs1466825713 237 dbSNP
rs1238335800 240 dbSNP
rs1212295804 242 dbSNP
rs945143834 249 dbSNP
rs1305892471 254 dbSNP
rs1272410868 258 dbSNP
rs1219124753 259 dbSNP
rs1319922309 260 dbSNP
rs1172395323 262 dbSNP
rs1291194362 268 dbSNP
rs753452324 277 dbSNP
rs1379399012 280 dbSNP
rs1008616408 283 dbSNP
rs1042109593 284 dbSNP
rs1400259615 286 dbSNP
rs1384150847 297 dbSNP
rs1321287898 300 dbSNP
rs559763293 303 dbSNP
rs1163220351 304 dbSNP
rs771215608 318 dbSNP
rs1414777014 319 dbSNP
rs892441291 322 dbSNP
rs1009984245 326 dbSNP
rs1479800225 330 dbSNP
rs150823555 331 dbSNP
rs906604539 334 dbSNP
rs11897899 335 dbSNP
rs1271235668 342 dbSNP
rs1034168146 344 dbSNP
rs1322048209 345 dbSNP
rs185113508 346 dbSNP
rs1312726585 354 dbSNP
rs1221649313 357 dbSNP
rs1372174021 360 dbSNP
rs952736694 375 dbSNP
rs1448440107 380 dbSNP
rs958557355 384 dbSNP
rs1006114525 388 dbSNP
rs908522245 391 dbSNP
rs1197027551 396 dbSNP
rs1254043429 411 dbSNP
rs531270418 418 dbSNP
rs1016208468 421 dbSNP
rs1352375216 429 dbSNP
rs371596760 430 dbSNP
rs961698313 434 dbSNP
rs972130612 437 dbSNP
rs1251238061 444 dbSNP
rs923000915 459 dbSNP
rs1266928370 467 dbSNP
rs1488768985 467 dbSNP
rs1266901636 473 dbSNP
rs927822918 490 dbSNP
rs937848021 504 dbSNP
rs954593409 506 dbSNP
rs1055072776 508 dbSNP
rs1368088195 512 dbSNP
rs1302105001 516 dbSNP
rs1386641804 520 dbSNP
rs915181479 530 dbSNP
rs985871580 532 dbSNP
rs1295645056 539 dbSNP
rs1452133334 542 dbSNP
rs1194975811 551 dbSNP
rs910689114 554 dbSNP
rs936857862 556 dbSNP
rs1053922380 557 dbSNP
rs150012028 567 dbSNP
rs199542169 569 dbSNP
rs756766802 586 dbSNP
rs1160236451 588 dbSNP
rs1009100087 590 dbSNP
rs764724612 595 dbSNP
rs1485449788 604 dbSNP
rs1455664836 607 dbSNP
rs761826180 608 dbSNP
rs765396282 609 dbSNP
rs1046829749 614 dbSNP
rs190154708 615 dbSNP
rs192908054 618 dbSNP
rs1016049866 619 dbSNP
rs961394526 621 dbSNP
rs1381041573 623 dbSNP
rs1299193914 632 dbSNP
rs982635033 632 dbSNP
rs552811124 636 dbSNP
rs1002688541 645 dbSNP
rs1055228650 648 dbSNP
rs894290371 662 dbSNP
rs928053996 664 dbSNP
rs1466653622 679 dbSNP
rs571295337 682 dbSNP
rs1168172658 704 dbSNP
rs763280851 714 dbSNP
rs1263554871 716 dbSNP
rs1267038930 718 dbSNP
rs915046566 726 dbSNP
rs1256413512 731 dbSNP
rs1326670792 732 dbSNP
rs564695399 744 dbSNP
rs1346440343 747 dbSNP
rs946621520 761 dbSNP
rs1214945303 762 dbSNP
rs1016155740 771 dbSNP
rs543368346 772 dbSNP
rs977997691 773 dbSNP
rs77626683 776 dbSNP
rs923633791 777 dbSNP
rs944373533 779 dbSNP
rs144260379 794 dbSNP
rs993451314 800 dbSNP
rs1030397071 802 dbSNP
rs750869049 807 dbSNP
rs1296530726 808 dbSNP
rs954416102 809 dbSNP
rs1265670893 810 dbSNP
rs1473805471 811 dbSNP
rs931703974 813 dbSNP
rs1049892630 838 dbSNP
rs985818293 842 dbSNP
rs1187761650 849 dbSNP
rs888612578 852 dbSNP
rs1247731426 853 dbSNP
rs1183381387 859 dbSNP
rs1194789847 862 dbSNP
rs1457707788 873 dbSNP
rs13393608 874 dbSNP
rs1220829105 875 dbSNP
rs958164648 902 dbSNP
rs1284007925 908 dbSNP
rs1166983986 910 dbSNP
rs577189020 912 dbSNP
rs1245712713 913 dbSNP
rs1342502736 915 dbSNP
rs989599092 917 dbSNP
rs1350605738 921 dbSNP
rs1457315204 923 dbSNP
rs1446226144 926 dbSNP
rs1400912647 927 dbSNP
rs1333226005 931 dbSNP
rs897172310 935 dbSNP
rs1389659316 942 dbSNP
rs35089607 951 dbSNP
rs1163636258 954 dbSNP
rs1473566308 960 dbSNP
rs1361771468 964 dbSNP
rs1372352053 976 dbSNP
rs1177433739 977 dbSNP
rs1439826920 978 dbSNP
rs542561167 989 dbSNP
rs768204871 990 dbSNP
rs1035404971 1004 dbSNP
rs766849282 1023 dbSNP
rs990866614 1031 dbSNP
rs1210875731 1033 dbSNP
rs1358737844 1034 dbSNP
rs1348183578 1046 dbSNP
rs1278045518 1052 dbSNP
rs1022174790 1053 dbSNP
rs967863152 1079 dbSNP
rs150393218 1080 dbSNP
rs1438546634 1085 dbSNP
rs982416674 1090 dbSNP
rs978441957 1091 dbSNP
rs1406916638 1093 dbSNP
rs1312809977 1099 dbSNP
rs927927975 1101 dbSNP
rs1320636425 1107 dbSNP
rs1381558728 1108 dbSNP
rs758357319 1112 dbSNP
rs923861469 1112 dbSNP
rs1244673395 1113 dbSNP
rs1199992978 1123 dbSNP
rs536402558 1123 dbSNP
rs938012928 1123 dbSNP
rs1055175159 1125 dbSNP
rs1264155329 1125 dbSNP
rs11551407 1127 dbSNP
rs975785813 1128 dbSNP
rs1484341954 1129 dbSNP
rs1288236082 1135 dbSNP
rs1206240642 1145 dbSNP
rs888540800 1149 dbSNP
rs774845985 1158 dbSNP
rs1251620873 1159 dbSNP
rs941464687 1161 dbSNP
rs1438551793 1168 dbSNP
rs554421380 1170 dbSNP
rs931735243 1171 dbSNP
rs1400171314 1172 dbSNP
rs1048789871 1187 dbSNP
rs1171197688 1190 dbSNP
rs545299625 1192 dbSNP
rs1414593921 1193 dbSNP
rs1425059584 1193 dbSNP
rs1479290164 1196 dbSNP
rs139684271 1201 dbSNP
rs1037584731 1211 dbSNP
rs1391863589 1213 dbSNP
rs754622809 1215 dbSNP
rs184890970 1220 dbSNP
rs1279462697 1224 dbSNP
rs1030264758 1226 dbSNP
rs757704988 1227 dbSNP
rs73934339 1229 dbSNP
rs1449732328 1232 dbSNP
rs1303118217 1233 dbSNP
rs1378019074 1239 dbSNP
rs1341957673 1242 dbSNP
rs1310752247 1245 dbSNP
rs1007187185 1250 dbSNP
rs1226080606 1257 dbSNP
rs1017257761 1264 dbSNP
rs957781698 1266 dbSNP
rs34218417 1277 dbSNP
rs1299184158 1279 dbSNP
rs145198063 1290 dbSNP
rs1416639289 1291 dbSNP
rs1229868377 1297 dbSNP
rs1274327067 1313 dbSNP
rs1422187959 1316 dbSNP
rs1170370881 1318 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' agggAGUGUGUCUUAAGGUCUu 5'
              |::| || | ||:|| | 
Target 5' auuaUUGC-CAUAUUUUCACAu 3'
 		6 - 26
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 10678.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000301998.4 | 3UTR | AAUUUAUUAUUGCCAUAUUUUCACAUGCUGCUUAUACA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000301998.4 | 3UTR | UCAAUUUAAAAUUCCAGAAUUUAUUAUUGCCAUAUUUUCACAUGCUGCUUAUACAAGAUUAUUAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38226 Liver fibrosis 0.578 3.0e-3 0.502 1.0e-2 21 Click to see details
GSE42095 Differentiated embryonic stem cells -0.456 1.4e-2 -0.486 9.4e-3 23 Click to see details
GSE28544 Breast cancer 0.318 6.5e-2 0.317 6.6e-2 24 Click to see details
GSE32688 Pancreatic cancer -0.148 2.1e-1 0.003 4.9e-1 32 Click to see details
GSE26953 Aortic valvular endothelial cells 0.095 3.3e-1 0.049 4.1e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.051 4.0e-1 -0.153 2.3e-1 25 Click to see details
GSE28260 Renal cortex and medulla -0.061 4.2e-1 -0.027 4.7e-1 13 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
75 hsa-miR-1299 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT079552 VAMP3 vesicle associated membrane protein 3 2 2
MIRT154885 GNAS GNAS complex locus 2 4
MIRT275056 SESN2 sestrin 2 2 4
MIRT303051 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 4
MIRT319158 CCDC71L coiled-coil domain containing 71 like 2 2
MIRT339620 TMPO thymopoietin 2 2
MIRT441961 BACE2 beta-site APP-cleaving enzyme 2 2 2
MIRT445113 DCAF4 DDB1 and CUL4 associated factor 4 2 2
MIRT445290 CD274 CD274 molecule 2 2
MIRT446037 HMCN1 hemicentin 1 2 2
MIRT446162 C8A complement C8 alpha chain 2 2
MIRT446175 ZNF37A zinc finger protein 37A 2 4
MIRT446414 OCA2 OCA2 melanosomal transmembrane protein 2 2
MIRT446884 TRIM25 tripartite motif containing 25 2 2
MIRT449789 C1orf109 chromosome 1 open reading frame 109 2 2
MIRT450026 EHD3 EH domain containing 3 2 2
MIRT450367 ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif 5 2 2
MIRT479739 CCND1 cyclin D1 2 2
MIRT484809 ZNFX1 zinc finger NFX1-type containing 1 2 2
MIRT485892 ZFP36 ZFP36 ring finger protein 2 2
MIRT486036 UBBP4 ubiquitin B pseudogene 4 2 2
MIRT488295 DHCR24 24-dehydrocholesterol reductase 2 2
MIRT497377 METTL8 methyltransferase like 8 2 2
MIRT508219 ZNF850 zinc finger protein 850 2 6
MIRT510923 PRRX1 paired related homeobox 1 2 4
MIRT512661 STEAP3 STEAP3 metalloreductase 2 2
MIRT520031 YOD1 YOD1 deubiquitinase 2 6
MIRT528490 AGTR2 angiotensin II receptor type 2 2 2
MIRT530083 PAGR1 PAXIP1 associated glutamate rich protein 1 2 4
MIRT531086 CCDC140 coiled-coil domain containing 140 2 2
MIRT535363 PEX5L peroxisomal biogenesis factor 5 like 2 2
MIRT535595 NUDT21 nudix hydrolase 21 2 2
MIRT538613 CCT5 chaperonin containing TCP1 subunit 5 2 4
MIRT539002 AVL9 AVL9 cell migration associated 2 2
MIRT545918 ZC3H4 zinc finger CCCH-type containing 4 2 2
MIRT548482 EEF2 eukaryotic translation elongation factor 2 2 2
MIRT555088 PURB purine rich element binding protein B 2 2
MIRT561421 TRIB3 tribbles pseudokinase 3 2 2
MIRT564965 WTAP WT1 associated protein 2 2
MIRT571686 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT574656 KLHL15 kelch like family member 15 2 2
MIRT610037 CNOT6 CCR4-NOT transcription complex subunit 6 2 6
MIRT612436 SMOC2 SPARC related modular calcium binding 2 2 2
MIRT614349 LOH12CR1 BLOC-1 related complex subunit 5 2 2
MIRT615304 CCDC158 coiled-coil domain containing 158 2 2
MIRT615771 FSD2 fibronectin type III and SPRY domain containing 2 2 2
MIRT615889 MT1A metallothionein 1A 2 2
MIRT619147 ZNF326 zinc finger protein 326 2 2
MIRT622042 SSBP2 single stranded DNA binding protein 2 2 2
MIRT637385 R3HDM2 R3H domain containing 2 2 2
MIRT640739 EPB41 erythrocyte membrane protein band 4.1 2 2
MIRT644418 PIGS phosphatidylinositol glycan anchor biosynthesis class S 2 2
MIRT647638 FAIM2 Fas apoptotic inhibitory molecule 2 2 2
MIRT654305 RBMS3 RNA binding motif single stranded interacting protein 3 2 2
MIRT654367 RBM23 RNA binding motif protein 23 2 2
MIRT655944 NDST1 N-deacetylase and N-sulfotransferase 1 2 2
MIRT655990 MYRF myelin regulatory factor 2 2
MIRT659692 CD226 CD226 molecule 2 2
MIRT665868 TIAF1 TGFB1-induced anti-apoptotic factor 1 2 2
MIRT667317 MYO18A myosin XVIIIA 2 2
MIRT684312 GTF3C4 general transcription factor IIIC subunit 4 2 2
MIRT694138 CYP27C1 cytochrome P450 family 27 subfamily C member 1 2 2
MIRT698529 TFRC transferrin receptor 2 2
MIRT698834 SSR2 signal sequence receptor subunit 2 2 2
MIRT700657 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT705377 ATP1B3 ATPase Na+/K+ transporting subunit beta 3 2 2
MIRT707314 TMEM184B transmembrane protein 184B 2 2
MIRT709027 KBTBD13 kelch repeat and BTB domain containing 13 2 2
MIRT716032 TMPRSS4 transmembrane protease, serine 4 2 2
MIRT718228 LCE1A late cornified envelope 1A 2 2
MIRT718475 TMEM151A transmembrane protein 151A 2 2
MIRT722333 BEND6 BEN domain containing 6 2 2
MIRT734096 TUG1 taurine up-regulated 1 (non-protein coding) 3 0
MIRT734099 NOTCH3 notch 3 3 0
MIRT755871 LIF LIF, interleukin 6 family cytokine 4 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1 Anthocyanin NULL 145858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Caffeic acid NULL 689043 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Ferulic acid NULL 445858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-1 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR myocardial differentiation of mouse ES cells 19521018 2009 down-regulated
miR-1 Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-1 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-1 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-1 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-1 Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 Palmitic acid approved 985 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-1 Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-1 Hydrogen peroxide (H2O2) NULL 784 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-1 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR cardia 22889704 2012 up-regulated
miR-1 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-1 Quinidine approved 441074 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 up-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 down-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR post-infarction rat cardiomyocytes 21220930 2011 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-1 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-1299 Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-1299 Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-1299 Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-1299 Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-miR-1299 Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-1299 Bromocriptine 31101 NSC169774 approved resistant Low Prolactinoma tissue
hsa-miR-1299 Bromocriptine 31101 NSC169774 approved resistant High Prolactinoma tissue
hsa-miR-1299 Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-1299 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM43)
hsa-miR-1299 Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-1299 Tamoxifen 2733525 NSC180973 approved sensitive cell line (LCC2)
hsa-miR-1299 Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-1299 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-1299 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-1299 Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-1299 Pegylated interferon alpha+Ribavirin resistant tissue (chronic hepatitis C)
hsa-miR-1299 Cisplatin 5460033 NSC119875 approved sensitive cell line (IGROV-1)
hsa-miR-1299 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-1299 Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide sensitive cell line (Bads-200)

Error report submission