>NAGK|NM_017567|3'UTR
   1 GGGGCTGGTCCCGGCTCCACCCCCTCCAAGCTCAGTGGACACTGGGTCTGAAAGGAAGGAGTCTTTTGCTTCCTTTCTCC
  81 TTTTTACAAAAACAAACATAGAAGAAAATAAATGCACTTTATCCACTCCCCAATTGGACTGCATTATCAAACACATGTGC
 161 TATGTACATCCTCAGTGCACCTGCCAGCAGATATCCTGGAGGGCTCATGAGTGAATTTAGTCCAAGATTTAAAGCCCTGC
 241 CCCCAGGTGCTCAGCCTGTGATCTGTATCCACTCAGCATGCACTTGGGCAGATGATTTGTCTGTGTGCTACCCTTCCCCC
 321 CATATTACCATACATATGCACTGTGTGGCTGCCAGTTAAT

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' aucgaAGGGUUGUC----UAUUUACu 5' |||::: :| ||:|:|| Target 5' agataTCCTGGAGGGCTCATGAGTGa 3'	189 - 214	115.00	-8.80
2	miRNA 3' aucGAAGGGUUGU------CUAUUUAcu 5' |||||| || ||| || Target 5' accCTTCCCCCCATATTACCATACATat 3'	310 - 337	101.00	-6.81
3	miRNA 3' auCGAAGGGUUGUCUAUUUAcu 5' || :: ::|||||:| | Target 5' atGCACTTGGGCAGATGATTtg 3'	278 - 299	92.00	-9.90

Mutant ID	Mutant Position	Mutant Source
COSM5018295	5	COSMIC
COSN31604021	47	COSMIC
COSN8609514	122	COSMIC
COSN26577241	176	COSMIC
COSN5955569	283	COSMIC
COSN19138063	736	COSMIC
COSN21544459	867	COSMIC
COSN21021832	1038	COSMIC
COSN37241	1295	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs753713095	2	dbSNP
rs755018585	3	dbSNP
rs778825658	4	dbSNP
rs1173771994	5	dbSNP
rs760326190	5	dbSNP
rs1393267045	6	dbSNP
rs747999929	13	dbSNP
rs1166652739	14	dbSNP
rs1398483092	17	dbSNP
rs758087628	17	dbSNP
rs368258937	18	dbSNP
rs995873707	19	dbSNP
rs796864173	22	dbSNP
rs145881172	23	dbSNP
rs112773895	24	dbSNP
rs1301882664	25	dbSNP
rs1013827567	28	dbSNP
rs1445881075	29	dbSNP
rs535977627	31	dbSNP
rs1283627077	36	dbSNP
rs754190135	39	dbSNP
rs1336747964	44	dbSNP
rs1235300669	48	dbSNP
rs1025166773	49	dbSNP
rs1256418577	52	dbSNP
rs1390009344	55	dbSNP
rs966841686	56	dbSNP
rs999293400	60	dbSNP
rs1391792083	69	dbSNP
rs1430125020	80	dbSNP
rs1169495516	81	dbSNP
rs112601471	88	dbSNP
rs1363125025	90	dbSNP
rs565861387	93	dbSNP
rs755268543	99	dbSNP
rs1476056076	114	dbSNP
rs1259952639	124	dbSNP
rs745529513	127	dbSNP
rs369905188	134	dbSNP
rs1278222742	138	dbSNP
rs1436404681	147	dbSNP
rs555431685	155	dbSNP
rs1344794930	157	dbSNP
rs1229532476	159	dbSNP
rs769518412	160	dbSNP
rs536096062	163	dbSNP
rs1293546635	170	dbSNP
rs77436320	175	dbSNP
rs1211178475	176	dbSNP
rs987325219	181	dbSNP
rs1289987684	182	dbSNP
rs907726326	194	dbSNP
rs1156735809	196	dbSNP
rs569882550	204	dbSNP
rs940484965	220	dbSNP
rs1418232256	223	dbSNP
rs1165952302	225	dbSNP
rs1474979968	233	dbSNP
rs1450473454	239	dbSNP
rs1195491055	243	dbSNP
rs1447653444	244	dbSNP
rs1261648277	254	dbSNP
rs972844329	261	dbSNP
rs1337434894	263	dbSNP
rs920039653	266	dbSNP
rs1249765713	267	dbSNP
rs1332284296	269	dbSNP
rs1271553514	275	dbSNP
rs537375700	280	dbSNP
rs1449906403	284	dbSNP
rs779360259	287	dbSNP
rs1430910547	292	dbSNP
rs1187658972	297	dbSNP
rs931402200	300	dbSNP
rs1442946305	309	dbSNP
rs1394984824	312	dbSNP
rs1055155333	313	dbSNP
rs558960318	317	dbSNP
rs1459667433	318	dbSNP
rs895124536	323	dbSNP
rs577320613	324	dbSNP
rs1475791521	326	dbSNP
rs1372529850	331	dbSNP
rs1187265694	332	dbSNP
rs193266149	338	dbSNP
rs1046651193	340	dbSNP
rs1391549161	346	dbSNP
rs1404797147	378	dbSNP
rs1450229459	383	dbSNP
rs553551096	384	dbSNP
rs1338203897	386	dbSNP
rs1324494125	399	dbSNP
rs1235809449	400	dbSNP
rs1367946504	402	dbSNP
rs1436366005	404	dbSNP
rs1297305655	409	dbSNP
rs148579329	414	dbSNP
rs142520366	432	dbSNP
rs1416160959	434	dbSNP
rs1356004079	438	dbSNP
rs1032501968	440	dbSNP
rs893573649	442	dbSNP
rs995919328	449	dbSNP
rs1028632545	453	dbSNP
rs1455629659	470	dbSNP
rs557553851	471	dbSNP
rs575812256	472	dbSNP
rs1465285145	478	dbSNP
rs1193481586	480	dbSNP
rs1207936584	496	dbSNP
rs987356245	512	dbSNP
rs772478607	517	dbSNP
rs961984088	520	dbSNP
rs1436903328	522	dbSNP
rs1272013792	531	dbSNP
rs544281268	533	dbSNP
rs1347889563	536	dbSNP
rs1302602585	540	dbSNP
rs1217360474	544	dbSNP
rs920422244	546	dbSNP
rs1279967446	563	dbSNP
rs1441185206	566	dbSNP
rs1335463652	568	dbSNP
rs1189914477	569	dbSNP
rs1436662906	573	dbSNP
rs546096562	576	dbSNP
rs931407683	580	dbSNP
rs1413223390	588	dbSNP
rs1410759669	592	dbSNP
rs763193738	597	dbSNP
rs1469944338	598	dbSNP
rs1472537306	598	dbSNP
rs1249171077	601	dbSNP
rs990874985	608	dbSNP
rs1485726693	620	dbSNP
rs916593786	623	dbSNP
rs1207380427	624	dbSNP
rs1318713789	625	dbSNP
rs184414643	629	dbSNP
rs1223064952	635	dbSNP
rs764707688	639	dbSNP
rs1391546160	643	dbSNP
rs1286695798	645	dbSNP
rs878987081	653	dbSNP
rs949326844	657	dbSNP
rs1356208048	658	dbSNP
rs1383302564	661	dbSNP
rs1398107780	664	dbSNP
rs532024940	666	dbSNP
rs1347523714	667	dbSNP
rs878862000	670	dbSNP
rs376600634	673	dbSNP
rs879236248	673	dbSNP
rs1289660842	677	dbSNP
rs1166686994	679	dbSNP
rs1329166354	683	dbSNP
rs1227713162	688	dbSNP
rs1266119992	689	dbSNP
rs1486561643	693	dbSNP
rs1484124588	696	dbSNP
rs1242633446	710	dbSNP
rs1054385582	714	dbSNP
rs1326839668	724	dbSNP
rs189080906	728	dbSNP
rs866166476	736	dbSNP
rs893949274	737	dbSNP
rs866020063	744	dbSNP
rs1233639650	748	dbSNP
rs995894339	750	dbSNP
rs1312262350	757	dbSNP
rs1257173079	761	dbSNP
rs1364099934	765	dbSNP
rs559214034	774	dbSNP
rs529879313	780	dbSNP
rs1387054144	788	dbSNP
rs1414285237	816	dbSNP
rs890122410	816	dbSNP
rs1472937185	822	dbSNP
rs1008556457	824	dbSNP
rs1159106707	825	dbSNP
rs1416807593	827	dbSNP
rs1362546770	828	dbSNP
rs1467942246	832	dbSNP
rs1429784308	840	dbSNP
rs1303791573	843	dbSNP
rs1185889505	865	dbSNP
rs12615175	873	dbSNP
rs994741786	874	dbSNP
rs1265099742	888	dbSNP
rs1309395099	892	dbSNP
rs1027915353	895	dbSNP
rs746501214	919	dbSNP
rs1408633960	925	dbSNP
rs878881369	932	dbSNP
rs1304846457	933	dbSNP
rs1363722208	936	dbSNP
rs958533379	938	dbSNP
rs1442112222	946	dbSNP
rs1313850660	960	dbSNP
rs1291449198	965	dbSNP
rs1463160067	981	dbSNP
rs1354719971	983	dbSNP
rs990907538	984	dbSNP
rs1255207825	986	dbSNP
rs1453599887	987	dbSNP
rs1345389553	988	dbSNP
rs1209037384	993	dbSNP
rs1197303476	995	dbSNP
rs916707868	996	dbSNP
rs569849472	997	dbSNP
rs530787719	1002	dbSNP
rs1249122827	1003	dbSNP
rs982135558	1007	dbSNP
rs1235603636	1011	dbSNP
rs370903038	1012	dbSNP
rs1299697388	1013	dbSNP
rs144712893	1024	dbSNP
rs570857057	1026	dbSNP
rs1307023128	1031	dbSNP
rs1054009900	1035	dbSNP
rs146690093	1038	dbSNP
rs191642918	1040	dbSNP
rs28610882	1041	dbSNP
rs113766705	1044	dbSNP
rs1036457038	1052	dbSNP
rs1370763591	1056	dbSNP
rs897462187	1057	dbSNP
rs111356657	1060	dbSNP
rs1027535904	1063	dbSNP
rs575796204	1076	dbSNP
rs1344987269	1082	dbSNP
rs1254756554	1083	dbSNP
rs150342247	1088	dbSNP
rs1012793114	1089	dbSNP
rs180788060	1090	dbSNP
rs1407571030	1091	dbSNP
rs1356939588	1094	dbSNP
rs576412471	1099	dbSNP
rs1394930341	1103	dbSNP
rs970823068	1108	dbSNP
rs1160156320	1109	dbSNP
rs1454129224	1113	dbSNP
rs6546665	1131	dbSNP
rs1230313668	1132	dbSNP
rs1259851460	1134	dbSNP
rs28463322	1135	dbSNP
rs956697437	1136	dbSNP
rs1203992762	1137	dbSNP
rs1249699665	1139	dbSNP
rs756360288	1143	dbSNP
rs1192314759	1144	dbSNP
rs529721647	1145	dbSNP
rs541920894	1146	dbSNP
rs537774965	1147	dbSNP
rs769674488	1148	dbSNP
rs912038001	1153	dbSNP
rs1387783823	1164	dbSNP
rs1428720283	1181	dbSNP
rs944474267	1185	dbSNP
rs1420381818	1190	dbSNP
rs1163986239	1192	dbSNP
rs1472517810	1194	dbSNP
rs1366743298	1198	dbSNP
rs1195376720	1200	dbSNP
rs1450691234	1206	dbSNP
rs1167798392	1207	dbSNP
rs1351148941	1210	dbSNP
rs530773777	1221	dbSNP
rs1036079191	1223	dbSNP
rs1290163208	1224	dbSNP
rs552490337	1226	dbSNP
rs375589182	1229	dbSNP
rs570794347	1230	dbSNP
rs1298038683	1233	dbSNP
rs1295310920	1253	dbSNP
rs1364126547	1254	dbSNP
rs897488754	1261	dbSNP
rs772906688	1262	dbSNP
rs1293653166	1268	dbSNP
rs1323606856	1270	dbSNP
rs1222372662	1274	dbSNP
rs1273154604	1278	dbSNP
rs1169784088	1284	dbSNP
rs1450161591	1287	dbSNP
rs143657742	1298	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.