miRTarBase - #MIRT303878


—
pre-miRNA Information
pre-miRNA hsa-mir-4524b   
Genomic Coordinates chr17: 69099542 - 69099656
Description Homo sapiens miR-4524b stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4524b-3p
Sequence 66| GAGACAGGUUCAUGCUGCUA |85
Evidence Experimental
Experiments SOLiD
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1263495678 1 dbSNP
rs1350790266 9 dbSNP
rs1322445998 14 dbSNP
Putative Targets

Gene Information
Gene Symbol VAMP8   
Synonyms EDB, VAMP-8
Description vesicle associated membrane protein 8
Transcript NM_003761   
Expression
Putative miRNA Targets on VAMP8
3'UTR of VAMP8
(miRNA target sites are highlighted)		 
>VAMP8|NM_003761|3'UTR
   1 GTAACAGGGAACCTCTCCCACCTGCCCTTCTCTTCAGGGACAACCCTCCATAAATGTGTGCCAAGAGGGTCTCCTTTCCT
  81 GTCTTCCTCTACAGAGAATGCTGCTCGGTCCTCCTACCCCTCTTCCCGAGGCCCTGCTGCCATGTTGTATGCCCCAGAAG
 161 GTACCTTGGTCCCCCGGAAGGAGAGAAAAAAGAGAGATGGACTGTGGCTGCATTTCTTGGGTCCTTAGAGTGGGCTGGAG
 241 AGACCTAGAGGGCCCAGCATGTGGCTGGGAAACTGTTGGTGGCCAGTGGGTAATAAAGACCTTTCAGTATCCCTATAAAA
 321 AAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aucgucguacuuGGACAGAg 5'
                      ||||||| 
Target 5' agggtctcctttCCTGTCTt 3'
 66 - 85 140.00 -12.30
2 
miRNA  3' auCGUCGU-ACUUGGACAGag 5'
            |:| ||  |||||| ||  
Target 5' --GTAACAGGGAACCTCTCcc 3'
 1 - 19 110.00 -13.50
3 
miRNA  3' auCGUCGUACUUGGACAGag 5'
            |:| :|  :|||| ||  
Target 5' ggGTAATAAAGACCTTTCag 3'
 288 - 307 102.00 -6.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1182311 144 ClinVar
COSN30145716 31 COSMIC
COSN30167972 31 COSMIC
COSN166155 33 COSMIC
COSN30527736 47 COSMIC
COSN30514886 79 COSMIC
COSN19705760 97 COSMIC
COSN8868361 144 COSMIC
COSN30153591 158 COSMIC
COSN30146925 161 COSMIC
COSN31491929 198 COSMIC
COSN30121951 212 COSMIC
COSN28722808 243 COSMIC
COSN27057701 261 COSMIC
rs1058588 33 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs750786954 12 dbSNP
rs756626061 13 dbSNP
rs1306419631 24 dbSNP
rs374885779 25 dbSNP
rs769248839 25 dbSNP
rs780472707 27 dbSNP
rs748826364 29 dbSNP
rs1058588 33 dbSNP
rs1366472797 34 dbSNP
rs373128758 36 dbSNP
rs1475418559 39 dbSNP
rs1259093670 40 dbSNP
rs747794132 41 dbSNP
rs771746704 42 dbSNP
rs1215482144 43 dbSNP
rs921041259 44 dbSNP
rs1436708367 46 dbSNP
rs772934233 49 dbSNP
rs1045962196 50 dbSNP
rs760483126 51 dbSNP
rs932305018 57 dbSNP
rs540788598 61 dbSNP
rs912242052 66 dbSNP
rs751059812 69 dbSNP
rs1248355940 70 dbSNP
rs372287198 76 dbSNP
rs1476376336 92 dbSNP
rs1234223905 104 dbSNP
rs555097033 107 dbSNP
rs1037366966 108 dbSNP
rs898312651 111 dbSNP
rs995767979 122 dbSNP
rs1415125263 125 dbSNP
rs1331026438 128 dbSNP
rs1178244322 129 dbSNP
rs768980708 134 dbSNP
rs1388411242 141 dbSNP
rs1010 144 dbSNP
rs1434585880 145 dbSNP
rs1156475070 148 dbSNP
rs1469344876 150 dbSNP
rs894598268 154 dbSNP
rs1183284864 156 dbSNP
rs1430965222 165 dbSNP
rs748414983 169 dbSNP
rs559336958 170 dbSNP
rs1024220190 173 dbSNP
rs770220308 176 dbSNP
rs577290122 177 dbSNP
rs533171168 186 dbSNP
rs1435030458 189 dbSNP
rs966675476 192 dbSNP
rs1058615 193 dbSNP
rs773644224 198 dbSNP
rs1351629759 218 dbSNP
rs1231071417 227 dbSNP
rs999089304 227 dbSNP
rs545275900 233 dbSNP
rs976304226 235 dbSNP
rs1441607644 246 dbSNP
rs1346255806 247 dbSNP
rs1219304982 249 dbSNP
rs1029138045 259 dbSNP
rs957544097 260 dbSNP
rs1385155485 261 dbSNP
rs953510063 262 dbSNP
rs990765760 269 dbSNP
rs563571017 274 dbSNP
rs544654847 285 dbSNP
rs921010190 301 dbSNP
rs984849966 307 dbSNP
rs1194767840 308 dbSNP
rs1207681812 309 dbSNP
rs953744495 316 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aucgucguacuuGGACAGAg 5'
                      ||||||| 
Target 5' ----ucuccuuuCCUGUCUu 3'
 		1 - 16
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000263864.5 | 3UTR | UCUCCUUUCCUGUCUUCCUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
175 hsa-miR-4524b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT064889 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT075345 SF3B3 splicing factor 3b subunit 3 2 2
MIRT094174 PCGF3 polycomb group ring finger 3 2 6
MIRT100109 ABT1 activator of basal transcription 1 2 8
MIRT102242 HBP1 HMG-box transcription factor 1 2 2
MIRT124918 HCCS holocytochrome c synthase 2 2
MIRT140195 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT193891 HACD3 3-hydroxyacyl-CoA dehydratase 3 2 2
MIRT265634 LDHA lactate dehydrogenase A 2 2
MIRT303878 VAMP8 vesicle associated membrane protein 8 2 2
MIRT409756 CRTAP cartilage associated protein 2 4
MIRT441503 SPG20 spartin 2 6
MIRT446882 ZNF554 zinc finger protein 554 2 2
MIRT447093 COPRS coordinator of PRMT5 and differentiation stimulator 2 2
MIRT449987 AEN apoptosis enhancing nuclease 2 2
MIRT452116 IFITM1 interferon induced transmembrane protein 1 2 2
MIRT452654 ZNF33A zinc finger protein 33A 2 2
MIRT453886 IFRD1 interferon related developmental regulator 1 2 12
MIRT454143 FOXRED2 FAD dependent oxidoreductase domain containing 2 2 2
MIRT454501 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 2
MIRT456633 ARMCX6 armadillo repeat containing, X-linked 6 2 2
MIRT457021 ACADSB acyl-CoA dehydrogenase, short/branched chain 2 2
MIRT457055 NEGR1 neuronal growth regulator 1 2 2
MIRT457335 REG4 regenerating family member 4 2 2
MIRT457421 CASC5 kinetochore scaffold 1 2 2
MIRT457940 LCE1A late cornified envelope 1A 2 2
MIRT458486 RMI1 RecQ mediated genome instability 1 2 10
MIRT458662 PAGR1 PAXIP1 associated glutamate rich protein 1 2 12
MIRT459784 IDH3A isocitrate dehydrogenase 3 (NAD(+)) alpha 2 2
MIRT459864 SVOP SV2 related protein 2 2
MIRT460575 FEM1A fem-1 homolog A 2 2
MIRT460987 STK17B serine/threonine kinase 17b 2 2
MIRT462315 TMEM109 transmembrane protein 109 2 2
MIRT464407 URM1 ubiquitin related modifier 1 2 2
MIRT465148 TSC22D2 TSC22 domain family member 2 2 2
MIRT466312 TIMM22 translocase of inner mitochondrial membrane 22 2 2
MIRT466718 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT468258 SFXN4 sideroflexin 4 2 2
MIRT469140 RNF126 ring finger protein 126 2 2
MIRT471783 NUP153 nucleoporin 153 2 2
MIRT472506 NACC2 NACC family member 2 2 2
MIRT474588 KLF6 Kruppel like factor 6 2 2
MIRT475049 JOSD1 Josephin domain containing 1 2 2
MIRT476900 FBXO21 F-box protein 21 2 2
MIRT476972 FAM83G family with sequence similarity 83 member G 2 4
MIRT477433 EMP1 epithelial membrane protein 1 2 2
MIRT480334 C5orf51 chromosome 5 open reading frame 51 2 10
MIRT481179 AVL9 AVL9 cell migration associated 2 6
MIRT481693 AR androgen receptor 2 2
MIRT483280 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 2 4
MIRT485775 B4GALT5 beta-1,4-galactosyltransferase 5 2 2
MIRT487424 CACNB1 calcium voltage-gated channel auxiliary subunit beta 1 2 2
MIRT488002 RXRB retinoid X receptor beta 2 2
MIRT488259 DNLZ DNL-type zinc finger 2 4
MIRT490360 DPYSL5 dihydropyrimidinase like 5 2 2
MIRT491593 USB1 U6 snRNA biogenesis phosphodiesterase 1 2 2
MIRT495269 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 2 4
MIRT495619 ZNF736 zinc finger protein 736 2 2
MIRT496167 ELP3 elongator acetyltransferase complex subunit 3 2 2
MIRT496250 GJB2 gap junction protein beta 2 2 2
MIRT496915 RTKN rhotekin 2 2
MIRT498713 PGAM5 PGAM family member 5, mitochondrial serine/threonine protein phosphatase 2 10
MIRT501106 SLC5A6 solute carrier family 5 member 6 2 4
MIRT501831 NCOA3 nuclear receptor coactivator 3 2 2
MIRT507142 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT510991 PER1 period circadian clock 1 2 4
MIRT512283 ARHGDIA Rho GDP dissociation inhibitor alpha 2 6
MIRT513152 CSDC2 cold shock domain containing C2 2 2
MIRT513327 KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 2 6
MIRT515090 FAM120AOS family with sequence similarity 120A opposite strand 2 2
MIRT516113 OARD1 O-acyl-ADP-ribose deacylase 1 2 8
MIRT516657 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT516892 PLEKHS1 pleckstrin homology domain containing S1 2 2
MIRT517966 ZMIZ2 zinc finger MIZ-type containing 2 2 4
MIRT519492 PNPLA3 patatin like phospholipase domain containing 3 2 2
MIRT519799 ZNF226 zinc finger protein 226 2 2
MIRT524309 CTC1 CST telomere replication complex component 1 2 8
MIRT524425 CNKSR3 CNKSR family member 3 2 2
MIRT525927 KIAA0391 KIAA0391 2 2
MIRT528022 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT528227 METTL8 methyltransferase like 8 2 2
MIRT528686 CEP57L1 centrosomal protein 57 like 1 2 2
MIRT528774 CD1D CD1d molecule 2 2
MIRT529935 P2RX7 purinergic receptor P2X 7 2 2
MIRT530642 PPIC peptidylprolyl isomerase C 2 4
MIRT530683 CHRNB1 cholinergic receptor nicotinic beta 1 subunit 2 4
MIRT531922 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT532181 SEC14L5 SEC14 like lipid binding 5 2 4
MIRT534996 PRR11 proline rich 11 2 6
MIRT535452 PDCL phosducin like 2 4
MIRT544682 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT553757 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 4
MIRT560724 ZNF749 zinc finger protein 749 2 2
MIRT561518 SPTY2D1 SPT2 chromatin protein domain containing 1 2 2
MIRT561578 SLC30A1 solute carrier family 30 member 1 2 2
MIRT562483 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT565039 VAV2 vav guanine nucleotide exchange factor 2 2 2
MIRT565348 TMED4 transmembrane p24 trafficking protein 4 2 2
MIRT567104 KANSL1 KAT8 regulatory NSL complex subunit 1 2 2
MIRT568879 LY6H lymphocyte antigen 6 family member H 2 2
MIRT569141 NAP1L4 nucleosome assembly protein 1 like 4 2 2
MIRT569199 LRRC3C leucine rich repeat containing 3C 2 2
MIRT573559 TMEM120B transmembrane protein 120B 2 2
MIRT575931 Mrrf mitochondrial ribosome recycling factor 2 6
MIRT607035 MRRF mitochondrial ribosome recycling factor 2 9
MIRT607194 SPRY4 sprouty RTK signaling antagonist 4 2 2
MIRT609682 TMEM213 transmembrane protein 213 2 2
MIRT611227 ZNF274 zinc finger protein 274 2 2
MIRT611370 PLXDC1 plexin domain containing 1 2 4
MIRT611640 SCRG1 stimulator of chondrogenesis 1 2 2
MIRT613011 GABRB1 gamma-aminobutyric acid type A receptor beta1 subunit 2 2
MIRT613532 GTSE1 G2 and S-phase expressed 1 2 2
MIRT614459 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT616492 CD300E CD300e molecule 2 2
MIRT617288 GTF2H3 general transcription factor IIH subunit 3 2 2
MIRT618356 CDKL1 cyclin dependent kinase like 1 2 2
MIRT619529 ZNF74 zinc finger protein 74 2 2
MIRT619990 ZSCAN22 zinc finger and SCAN domain containing 22 2 2
MIRT621286 ATP5E ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit 2 2
MIRT621482 GPKOW G-patch domain and KOW motifs 2 2
MIRT625456 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT626757 NDUFA9 NADH:ubiquinone oxidoreductase subunit A9 2 2
MIRT629138 CTCFL CCCTC-binding factor like 2 2
MIRT630092 DCAF10 DDB1 and CUL4 associated factor 10 2 2
MIRT633501 RNF14 ring finger protein 14 2 2
MIRT633604 APCDD1 APC down-regulated 1 2 2
MIRT633772 F2 coagulation factor II, thrombin 2 2
MIRT635605 ADAT1 adenosine deaminase, tRNA specific 1 2 2
MIRT637422 EPB41L3 erythrocyte membrane protein band 4.1 like 3 2 2
MIRT637822 PLA2G7 phospholipase A2 group VII 2 2
MIRT637978 RRP36 ribosomal RNA processing 36 2 2
MIRT638385 RABL3 RAB, member of RAS oncogene family like 3 2 2
MIRT638547 KIAA1549 KIAA1549 2 2
MIRT642019 NCKIPSD NCK interacting protein with SH3 domain 2 2
MIRT643342 MICA MHC class I polypeptide-related sequence A 2 2
MIRT644281 LRRC57 leucine rich repeat containing 57 2 2
MIRT646818 COX19 COX19, cytochrome c oxidase assembly factor 2 2
MIRT646839 TLDC1 TBC/LysM-associated domain containing 1 2 2
MIRT646976 CYP2W1 cytochrome P450 family 2 subfamily W member 1 2 2
MIRT647735 CXCR2 C-X-C motif chemokine receptor 2 2 2
MIRT648598 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT649843 LIPG lipase G, endothelial type 2 2
MIRT650031 VHL von Hippel-Lindau tumor suppressor 2 2
MIRT652082 TSPAN14 tetraspanin 14 2 2
MIRT652103 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT652902 SYNPO2L synaptopodin 2 like 2 2
MIRT653549 SLC38A7 solute carrier family 38 member 7 2 2
MIRT653981 SEMA6B semaphorin 6B 2 2
MIRT654287 RCAN1 regulator of calcineurin 1 2 2
MIRT658372 FAM63B MINDY lysine 48 deubiquitinase 2 2 2
MIRT660321 BDP1 B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB 2 2
MIRT663063 LRIF1 ligand dependent nuclear receptor interacting factor 1 2 2
MIRT663269 ATP1A2 ATPase Na+/K+ transporting subunit alpha 2 2 2
MIRT664076 ZNF417 zinc finger protein 417 2 2
MIRT664193 MYOZ2 myozenin 2 2 2
MIRT664512 POLR3K RNA polymerase III subunit K 2 2
MIRT667025 PDF peptide deformylase, mitochondrial 2 2
MIRT669621 ACSL6 acyl-CoA synthetase long chain family member 6 2 2
MIRT670530 MLLT6 MLLT6, PHD finger containing 2 2
MIRT673050 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT683339 ZNF581 zinc finger protein 581 2 2
MIRT689264 WDR83OS WD repeat domain 83 opposite strand 2 2
MIRT690902 TOP2A DNA topoisomerase II alpha 2 2
MIRT699196 SLX4IP SLX4 interacting protein 2 2
MIRT702223 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT707053 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT707080 MED29 mediator complex subunit 29 2 2
MIRT712347 NLN neurolysin 2 2
MIRT714715 KIT KIT proto-oncogene receptor tyrosine kinase 2 2
MIRT715963 CES4A carboxylesterase 4A 2 2
MIRT718224 DEFB105B defensin beta 105B 2 2
MIRT718244 DEFB105A defensin beta 105A 2 2
MIRT721960 GCK glucokinase 2 2
MIRT723098 SERINC3 serine incorporator 3 2 2
MIRT725207 PTPRT protein tyrosine phosphatase, receptor type T 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4524b Tripterygium wilfordii Hook F resistant tissue
hsa-miR-4524b-3p Tamoxifen 2733525 NSC180973 approved sensitive cell line (LCC2)

Error report submission