pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-7849 |
Genomic Coordinates | chr4: 146408583 - 146408688 |
Description | Homo sapiens miR-7849 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-7849-3p | |||||||||||||||
Sequence | 64| GACAAUUGUUGAUCUUGGGCCU |85 | |||||||||||||||
Evidence | Experimental | |||||||||||||||
Experiments | Illumina | |||||||||||||||
SNPs in miRNA |
|
|||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | CTNNB1 | ||||||||||||||||||||
Synonyms | CTNNB, EVR7, MRD19, armadillo | ||||||||||||||||||||
Description | catenin beta 1 | ||||||||||||||||||||
Transcript | NM_001904 | ||||||||||||||||||||
Other Transcripts | NM_001098210 , NM_001098209 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on CTNNB1 | |||||||||||||||||||||
3'UTR of CTNNB1 (miRNA target sites are highlighted) |
>CTNNB1|NM_001904|3'UTR 1 ATCATCCTTTAGGTAAGAAGTTTTAAAAAGCCAGTTTGGGTAAAATACTTTTACTCTGCCTACAGAACTTCAGAAAGACT 81 TGGTTGGTAGGGTGGGAGTGGTTTAGGCTATTTGTAAATCTGCCACAAAAACAGGTATATACTTTGAAAGGAGATGTCTT 161 GGAACATTGGAATGTTCTCAGATTTCTGGTTGTTATGTGATCATGTGTGGAAGTTATTAACTTTAATGTTTTTTGCCACA 241 GCTTTTGCAACTTAATACTCAAATGAGTAACATTTGCTGTTTTAAACATTAATAGCAGCCTTTCTCTCTTTATACAGCTG 321 TATTGTCTGAACTTGCATTGTGATTGGCCTGTAGAGTTGCTGAGAGGGCTCGAGGGGTGGGCTGGTATCTCAGAAAGTGC 401 CTGACACACTAACCAAGCTGAGTTTCCTATGGGAACAATTGAAGTAAACTTTTTGTTCTGGTCCTTTTTGGTCGAGGAGT 481 AACAATACAAATGGATTTTGGGAGTGACTCAAGAAGTGAAGAATGCACAAGAATGGATCACAAGATGGAATTTATCAAAC 561 CCTAGCCTTGCTTGTTAAATTTTTTTTTTTTTTTTTTTAAGAATATCTGTAATGGTACTGACTTTGCTTGCTTTGAAGTA 641 GCTCTTTTTTTTTTTTTTTTTTTTTTTTTGCAGTAACTGTTTTTTAAGTCTCTCGTAGTGTTAAGTTATAGTGAATACTG 721 CTACAGCAATTTCTAATTTTTAAGAATTGAGTAATGGTGTAGAACACTAATTCATAATCACTCTAATTAATTGTAATCTG 801 AATAAAGTGTAACAATTGTGTAGCCTTTTTGTATAAAATAGACAAATAGAAAATGGTCCAATTAGTTTCCTTTTTAATAT 881 GCTTAAAATAAGCAGGTGGATCTATTTCATGTTTTTGATCAAAAACTATTTGGGATATGTATGGGTAGGGTAAATCAGTA 961 AGAGGTGTTATTTGGAACCTTGTTTTGGACAGTTTACCAGTTGCCTTTTATCCCAAAGTTGTTGTAACCTGCTGTGATAC 1041 GATGCTTCAAGAGAAAATGCGGTTATAAAAAATGGTTCAGAATTAAACTTTTAATTCATTCGATTG Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
CLIP-seq Support 1 for dataset GSM545216 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-124 transfection |
Location of target site | ENST00000349496.5 | 3UTR | AACACUAAUUCAUAAUCACUCUAAUUAAUUGU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
69 hsa-miR-7849-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT062192 | WNK1 | WNK lysine deficient protein kinase 1 | 2 | 2 | ||||||||
MIRT064755 | CCND2 | cyclin D2 | 2 | 8 | ||||||||
MIRT076594 | NUFIP2 | NUFIP2, FMR1 interacting protein 2 | 2 | 2 | ||||||||
MIRT086027 | UBR3 | ubiquitin protein ligase E3 component n-recognin 3 (putative) | 2 | 2 | ||||||||
MIRT091394 | EIF4A2 | eukaryotic translation initiation factor 4A2 | 2 | 2 | ||||||||
MIRT104730 | KLF10 | Kruppel like factor 10 | 2 | 2 | ||||||||
MIRT105345 | SLC7A2 | solute carrier family 7 member 2 | 2 | 2 | ||||||||
MIRT105672 | PNMA2 | paraneoplastic Ma antigen 2 | 2 | 6 | ||||||||
MIRT173218 | TMEM64 | transmembrane protein 64 | 2 | 2 | ||||||||
MIRT228305 | SMU1 | DNA replication regulator and spliceosomal factor | 2 | 2 | ||||||||
MIRT229503 | EIF1AX | eukaryotic translation initiation factor 1A, X-linked | 2 | 2 | ||||||||
MIRT243387 | SKIL | SKI like proto-oncogene | 2 | 2 | ||||||||
MIRT257404 | E2F3 | E2F transcription factor 3 | 2 | 2 | ||||||||
MIRT301069 | SLC16A14 | solute carrier family 16 member 14 | 2 | 4 | ||||||||
MIRT307327 | CTNNB1 | catenin beta 1 | 2 | 2 | ||||||||
MIRT443182 | DENND4C | DENN domain containing 4C | 2 | 2 | ||||||||
MIRT469272 | RHOB | ras homolog family member B | 2 | 8 | ||||||||
MIRT475106 | IRF2BP2 | interferon regulatory factor 2 binding protein 2 | 2 | 4 | ||||||||
MIRT484134 | C14orf142 | GON7, KEOPS complex subunit homolog | 2 | 2 | ||||||||
MIRT491117 | TMTC1 | transmembrane and tetratricopeptide repeat containing 1 | 2 | 4 | ||||||||
MIRT504856 | HAUS3 | HAUS augmin like complex subunit 3 | 2 | 4 | ||||||||
MIRT505544 | SNX16 | sorting nexin 16 | 2 | 6 | ||||||||
MIRT506752 | LCOR | ligand dependent nuclear receptor corepressor | 2 | 8 | ||||||||
MIRT507358 | FAM129A | family with sequence similarity 129 member A | 2 | 6 | ||||||||
MIRT507812 | CDK6 | cyclin dependent kinase 6 | 2 | 6 | ||||||||
MIRT510730 | SON | SON DNA binding protein | 2 | 6 | ||||||||
MIRT521296 | RRAGD | Ras related GTP binding D | 2 | 4 | ||||||||
MIRT521371 | RNF11 | ring finger protein 11 | 2 | 6 | ||||||||
MIRT525860 | ARL13B | ADP ribosylation factor like GTPase 13B | 2 | 2 | ||||||||
MIRT527352 | FAM69C | family with sequence similarity 69 member C | 2 | 2 | ||||||||
MIRT528796 | RAB32 | RAB32, member RAS oncogene family | 2 | 2 | ||||||||
MIRT530417 | SULT1B1 | sulfotransferase family 1B member 1 | 2 | 2 | ||||||||
MIRT533425 | TWF1 | twinfilin actin binding protein 1 | 2 | 2 | ||||||||
MIRT539512 | ACSS3 | acyl-CoA synthetase short chain family member 3 | 2 | 2 | ||||||||
MIRT543660 | ZNF589 | zinc finger protein 589 | 2 | 4 | ||||||||
MIRT544833 | ZNF639 | zinc finger protein 639 | 2 | 2 | ||||||||
MIRT545266 | TRIM36 | tripartite motif containing 36 | 2 | 4 | ||||||||
MIRT545425 | SLC39A6 | solute carrier family 39 member 6 | 2 | 2 | ||||||||
MIRT546070 | VEZF1 | vascular endothelial zinc finger 1 | 2 | 2 | ||||||||
MIRT546896 | PTPRK | protein tyrosine phosphatase, receptor type K | 2 | 2 | ||||||||
MIRT547932 | HNRNPR | heterogeneous nuclear ribonucleoprotein R | 2 | 2 | ||||||||
MIRT548836 | CHD1 | chromodomain helicase DNA binding protein 1 | 2 | 4 | ||||||||
MIRT550937 | ZNF100 | zinc finger protein 100 | 2 | 2 | ||||||||
MIRT551840 | AASDHPPT | aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase | 2 | 2 | ||||||||
MIRT553749 | TBC1D8 | TBC1 domain family member 8 | 2 | 2 | ||||||||
MIRT554070 | SOBP | sine oculis binding protein homolog | 2 | 2 | ||||||||
MIRT554254 | SIX4 | SIX homeobox 4 | 2 | 2 | ||||||||
MIRT558254 | DYRK2 | dual specificity tyrosine phosphorylation regulated kinase 2 | 2 | 2 | ||||||||
MIRT559252 | BBX | BBX, HMG-box containing | 2 | 4 | ||||||||
MIRT561110 | OPA3 | OPA3, outer mitochondrial membrane lipid metabolism regulator | 2 | 2 | ||||||||
MIRT561412 | TSN | translin | 2 | 2 | ||||||||
MIRT562154 | ID4 | inhibitor of DNA binding 4, HLH protein | 2 | 2 | ||||||||
MIRT563324 | ORC4 | origin recognition complex subunit 4 | 2 | 2 | ||||||||
MIRT563985 | SLFN11 | schlafen family member 11 | 2 | 2 | ||||||||
MIRT571387 | JKAMP | JNK1/MAPK8-associated membrane protein | 2 | 2 | ||||||||
MIRT575040 | Fasl | Fas ligand (TNF superfamily, member 6) | 1 | 1 | ||||||||
MIRT610374 | C9orf64 | chromosome 9 open reading frame 64 | 2 | 2 | ||||||||
MIRT611045 | FASLG | Fas ligand | 2 | 3 | ||||||||
MIRT625440 | RMDN1 | regulator of microtubule dynamics 1 | 2 | 2 | ||||||||
MIRT655071 | PKIA | cAMP-dependent protein kinase inhibitor alpha | 2 | 2 | ||||||||
MIRT656139 | MSH6 | mutS homolog 6 | 2 | 2 | ||||||||
MIRT667042 | PDE3A | phosphodiesterase 3A | 2 | 2 | ||||||||
MIRT691264 | ICOSLG | inducible T-cell costimulator ligand | 2 | 2 | ||||||||
MIRT699773 | SEMA4D | semaphorin 4D | 2 | 2 | ||||||||
MIRT707809 | TSPAN6 | tetraspanin 6 | 2 | 2 | ||||||||
MIRT711125 | CYYR1 | cysteine and tyrosine rich 1 | 2 | 2 | ||||||||
MIRT714107 | RLIM | ring finger protein, LIM domain interacting | 2 | 2 | ||||||||
MIRT717792 | TGFBR2 | transforming growth factor beta receptor 2 | 2 | 2 | ||||||||
MIRT717929 | ZNF546 | zinc finger protein 546 | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|