miRTarBase - #MIRT308266


—
pre-miRNA Information
pre-miRNA hsa-mir-4753   
Genomic Coordinates chr1: 235190034 - 235190116
Description Homo sapiens miR-4753 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4753-5p
Sequence 10| CAAGGCCAAAGGAAGAGAACAG |31
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs547986869 3 dbSNP
rs1007787337 7 dbSNP
rs1224263160 12 dbSNP
rs1256249071 13 dbSNP
rs1484015538 14 dbSNP
rs535678819 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol LRIG1   
Synonyms LIG-1, LIG1
Description leucine rich repeats and immunoglobulin like domains 1
Transcript NM_015541   
Expression
Putative miRNA Targets on LRIG1
3'UTR of LRIG1
(miRNA target sites are highlighted)		 
>LRIG1|NM_015541|3'UTR
   1 GTTTTGTCTACCTCAGTTCTTGTCATACCAATCTCTACGGGAAAGAGAGGTAGGAGAGGCTGCGAGGAAGCTTGGGTTCA
  81 AGCGTCACTCATCTGTACATAGTTGTAACTCCCATGTGGAGTATCAGTCGCTCACAGGACTTGGATCTGAAGCACAGTAA
 161 ACGCAAGAGGGGATTTGTGTACAAAAGGCAAAAAAAGTATTTGATATCATTGTACATAAGAGTTTTCAGAGATTTCATAT
 241 ATATCTTTTACAGAGGCTATTTTAATCTTTAGTGCATGGTTAACAGAAAAAAATTATACAATTTTGACAATATTATTTTT
 321 CGTATCAGGTTGCTGTTTAATTTTGGAGGGGGTGGGGAAATAGTTCTGGTGCCTTAACGCATGGCTGGAATTTATAGAGG
 401 CTACAACCACATTTGTTCACAGGAGTTTTTGGTGCGGGGTGGGAAGGATGGAAGGCCTTGGATTTATATTGCACTTCATA
 481 GACCCCTAGGCTGCTGTGCGGTGGGACTCCACATGCGCCGGAAGGAGCTTCAGGTGAGCACTGCTCATGTGTGGATGCCC
 561 CTGCAACAGGCTTCCCTGTCTGTAGAGCCAGGGGTGCAAGTGCCATCCACACTTGCAGTGAATGGCTTTTCCTTTTAGGT
 641 TTAAGTCCTGTCTGTCTGTAAGGCGTAGAATCTGTCCGTCTGTAAGGCGTAGAATGAGGGTTGTTAATCCATCACAAGCA
 721 AAAGGTCAGAACAGTTAAACACTGCCTTTCCTCCTCCTCTTATTTTATGATAAAAGCAAATGTGGCCTTCTCAGTATCAT
 801 TCGATTGCTATTTGAGACTTTTAAATTAAGGTAAAGGCTGCTGGTGTTGGTACCTGTGGATTTTTCTATACTGATGTTTT
 881 CGTTTTGCCAATATAATGAGTATTACATTGGCCTTGGGGGACAGAAAGGAGGAAGTTCTGACTTTTCAGGGCTACCTTAT
 961 TTCTACTAAGGACCCAGAGCAGGCCTGTCCATGCCATTCCTTCGCACAGATGAAACTGAGCTGGGACTGGAAAGGACAGC
1041 CCTTGACCTGGGTTCTGGGTATAATTTGCACTTTTGAGACTGGTAGCTAACCATCTTATGAGTGCCAATGTGTCATTTAG
1121 TAAAACTTAAATAGAAACAAGGTCCTTCAAATGTTCCTTTGGCCAAAAGCTGAAGGGAGTTACTGAGAAAATAGTTAACA
1201 ATTACTGTCAGGTGTCATCACTGTTCAAAAGGTAAGCACATTTAGAATTTTGTTCTTGACAGTTAACTGACTAATCTTAC
1281 TTCCACAAAATATGTGAATTTGCTGCTTCTGAGAGGCAATGTGAAAGAGGGAGTATTACTTTTATGTACAAAGTTATTTA
1361 TTTATAGAAATTTTGGTACAGTGTACATTGAAAACCATGTAAAATATTGAAGTGTCTAACAAATGGCATTGAAGTGTCTT
1441 TAATAAAGGTTCATTTATAAATGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gacaagAGAAGGAAACCGGAAc 5'
                | || | |||||||| 
Target 5' aatgagTATTACATTGGCCTTg 3'
 895 - 916 156.00 -13.90
2 
miRNA  3' gacaagagaaggAAACCGGAAc 5'
                      | ||||||| 
Target 5' gataaaagcaaaTGTGGCCTTc 3'
 769 - 790 142.00 -8.80
3 
miRNA  3' gacAAG---AGAAGGAAACCGGaac 5'
             |||   | |||||||||||   
Target 5' tccTTCAAATGTTCCTTTGGCCaaa 3'
 1143 - 1167 135.00 -17.02
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30500900 2 COSMIC
COSN30458959 64 COSMIC
COSN5046517 104 COSMIC
COSN31579417 163 COSMIC
COSN20098599 348 COSMIC
COSN29705969 354 COSMIC
COSN20090833 435 COSMIC
COSN1957922 778 COSMIC
COSN1957920 793 COSMIC
COSN30539112 994 COSMIC
COSN21638902 1010 COSMIC
COSN31551187 1039 COSMIC
COSN30543422 1060 COSMIC
COSN9557973 1080 COSMIC
COSN31518173 1230 COSMIC
COSN9557972 1278 COSMIC
COSN31778342 1290 COSMIC
COSN7704768 1333 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs760319481 6 dbSNP
rs780200837 6 dbSNP
rs11553627 8 dbSNP
rs1392946128 9 dbSNP
rs1010797103 10 dbSNP
rs772566555 11 dbSNP
rs772079489 12 dbSNP
rs761607455 16 dbSNP
rs1486829733 18 dbSNP
rs549095514 21 dbSNP
rs373168471 23 dbSNP
rs1056654450 24 dbSNP
rs768375949 25 dbSNP
rs1213785561 27 dbSNP
rs939106788 27 dbSNP
rs185195965 29 dbSNP
rs781455365 31 dbSNP
rs771124144 32 dbSNP
rs747127546 33 dbSNP
rs1324641964 35 dbSNP
rs758963802 38 dbSNP
rs369266860 39 dbSNP
rs1413647455 40 dbSNP
rs375738880 41 dbSNP
rs1314365092 42 dbSNP
rs1466187911 45 dbSNP
rs758404611 50 dbSNP
rs946338659 56 dbSNP
rs915173033 60 dbSNP
rs753591119 63 dbSNP
rs956747271 64 dbSNP
rs1242665009 65 dbSNP
rs1001536336 66 dbSNP
rs1303363782 72 dbSNP
rs549868542 73 dbSNP
rs1046271444 75 dbSNP
rs1163567083 76 dbSNP
rs929973027 79 dbSNP
rs1018778255 81 dbSNP
rs987995754 83 dbSNP
rs1295569130 84 dbSNP
rs1356318243 84 dbSNP
rs1038587295 86 dbSNP
rs533680845 88 dbSNP
rs1291478113 98 dbSNP
rs571029652 99 dbSNP
rs953452340 102 dbSNP
rs1028974450 105 dbSNP
rs1284795566 106 dbSNP
rs1446363716 109 dbSNP
rs1214174503 110 dbSNP
rs1259424041 111 dbSNP
rs767027982 111 dbSNP
rs180885012 112 dbSNP
rs899144519 115 dbSNP
rs148336664 117 dbSNP
rs934181346 119 dbSNP
rs978268889 121 dbSNP
rs1407884025 122 dbSNP
rs966380656 125 dbSNP
rs113381069 126 dbSNP
rs570109765 129 dbSNP
rs556362563 130 dbSNP
rs1432002987 131 dbSNP
rs939104230 135 dbSNP
rs904959492 140 dbSNP
rs1217436522 143 dbSNP
rs1337765537 145 dbSNP
rs1239773712 147 dbSNP
rs1349855554 148 dbSNP
rs989317354 149 dbSNP
rs1282164426 162 dbSNP
rs189303652 162 dbSNP
rs773224257 163 dbSNP
rs1439259462 165 dbSNP
rs914870111 170 dbSNP
rs772191919 171 dbSNP
rs1231855880 179 dbSNP
rs1204289917 182 dbSNP
rs1345418058 187 dbSNP
rs1257595538 188 dbSNP
rs1230960966 189 dbSNP
rs935255536 193 dbSNP
rs1434425182 197 dbSNP
rs796507004 197 dbSNP
rs1398903559 202 dbSNP
rs1392244916 204 dbSNP
rs1328244106 208 dbSNP
rs1374819459 208 dbSNP
rs1344879057 209 dbSNP
rs1278203614 210 dbSNP
rs1443239164 210 dbSNP
rs1305478694 215 dbSNP
rs531392346 216 dbSNP
rs1233213021 218 dbSNP
rs75713402 219 dbSNP
rs1341007473 220 dbSNP
rs146526780 220 dbSNP
rs1414729448 227 dbSNP
rs897116231 231 dbSNP
rs1038388426 233 dbSNP
rs1194970311 236 dbSNP
rs375444744 241 dbSNP
rs768954423 245 dbSNP
rs1464921964 247 dbSNP
rs1429211342 251 dbSNP
rs1194421325 253 dbSNP
rs1478863673 255 dbSNP
rs553818295 264 dbSNP
rs1197185458 265 dbSNP
rs1375191348 266 dbSNP
rs1379009389 267 dbSNP
rs963352755 268 dbSNP
rs540502064 269 dbSNP
rs1398409185 271 dbSNP
rs1050029223 273 dbSNP
rs1326672100 275 dbSNP
rs1005573873 279 dbSNP
rs1443272447 288 dbSNP
rs574341008 292 dbSNP
rs1298876166 296 dbSNP
rs142174342 297 dbSNP
rs1042115100 298 dbSNP
rs113003716 306 dbSNP
rs35995091 307 dbSNP
rs1215013537 309 dbSNP
rs35750410 309 dbSNP
rs914877706 309 dbSNP
rs34273627 310 dbSNP
rs111743305 311 dbSNP
rs749671698 311 dbSNP
rs1429436526 312 dbSNP
rs959068637 312 dbSNP
rs1044838423 313 dbSNP
rs547858636 314 dbSNP
rs1448290961 315 dbSNP
rs1165716554 318 dbSNP
rs189899496 321 dbSNP
rs147601936 322 dbSNP
rs1291661884 323 dbSNP
rs1052095273 327 dbSNP
rs1450946700 328 dbSNP
rs970565575 332 dbSNP
rs775991889 333 dbSNP
rs79215032 339 dbSNP
rs1234802913 345 dbSNP
rs1293335189 348 dbSNP
rs199650108 348 dbSNP
rs1171976682 350 dbSNP
rs1467690751 351 dbSNP
rs200733047 352 dbSNP
rs3832189 353 dbSNP
rs397989935 353 dbSNP
rs535444770 363 dbSNP
rs1473210821 364 dbSNP
rs911831650 368 dbSNP
rs796098835 369 dbSNP
rs1239446136 371 dbSNP
rs1261537644 373 dbSNP
rs548370747 378 dbSNP
rs931826747 379 dbSNP
rs531428051 381 dbSNP
rs573168060 382 dbSNP
rs772938431 385 dbSNP
rs1260717572 386 dbSNP
rs1454299533 388 dbSNP
rs1200438262 392 dbSNP
rs1456438907 393 dbSNP
rs757902321 394 dbSNP
rs1358433981 398 dbSNP
rs1271595149 404 dbSNP
rs763614094 408 dbSNP
rs1005537359 410 dbSNP
rs963415828 411 dbSNP
rs568677164 415 dbSNP
rs983487589 419 dbSNP
rs562730870 421 dbSNP
rs1318037398 424 dbSNP
rs1240110177 426 dbSNP
rs1284537605 427 dbSNP
rs1350437872 429 dbSNP
rs1212057031 430 dbSNP
rs747561805 435 dbSNP
rs371892963 436 dbSNP
rs185349549 437 dbSNP
rs998861234 437 dbSNP
rs901301019 438 dbSNP
rs1419569918 439 dbSNP
rs545563476 440 dbSNP
rs1378432333 443 dbSNP
rs755981502 444 dbSNP
rs79203552 451 dbSNP
rs1174038398 454 dbSNP
rs914988111 456 dbSNP
rs1021792906 461 dbSNP
rs1299351514 462 dbSNP
rs562406243 470 dbSNP
rs76280408 472 dbSNP
rs1161877748 475 dbSNP
rs1307631889 478 dbSNP
rs1444297433 479 dbSNP
rs532042294 484 dbSNP
rs1380676177 487 dbSNP
rs1180278978 488 dbSNP
rs1310639723 489 dbSNP
rs1206939392 493 dbSNP
rs1252140963 496 dbSNP
rs1457335727 498 dbSNP
rs368567936 499 dbSNP
rs560091864 500 dbSNP
rs145310025 501 dbSNP
rs1221616461 502 dbSNP
rs1194020005 509 dbSNP
rs62243244 513 dbSNP
rs554347612 516 dbSNP
rs565120209 517 dbSNP
rs931898795 518 dbSNP
rs921795968 519 dbSNP
rs539843674 520 dbSNP
rs374353568 521 dbSNP
rs1242784846 528 dbSNP
rs1017018459 533 dbSNP
rs941833260 538 dbSNP
rs907963927 539 dbSNP
rs1274597881 542 dbSNP
rs1365881419 543 dbSNP
rs1005651901 545 dbSNP
rs543974878 546 dbSNP
rs1279455442 549 dbSNP
rs576145136 551 dbSNP
rs1317526472 553 dbSNP
rs34022790 558 dbSNP
rs1275194218 560 dbSNP
rs539918191 561 dbSNP
rs998413621 563 dbSNP
rs1246071201 569 dbSNP
rs570796574 570 dbSNP
rs1476883710 571 dbSNP
rs1188051037 574 dbSNP
rs1423889854 576 dbSNP
rs554094557 577 dbSNP
rs1477323967 580 dbSNP
rs901412808 582 dbSNP
rs1396083279 583 dbSNP
rs768698699 586 dbSNP
rs1042682716 587 dbSNP
rs1010129383 588 dbSNP
rs1348661599 589 dbSNP
rs1433248027 590 dbSNP
rs928622876 596 dbSNP
rs1271209554 599 dbSNP
rs1361422359 603 dbSNP
rs1295175339 606 dbSNP
rs1227819415 607 dbSNP
rs1160178470 611 dbSNP
rs575836250 612 dbSNP
rs555665746 613 dbSNP
rs1217660186 615 dbSNP
rs970286197 616 dbSNP
rs1407035784 617 dbSNP
rs1191687854 624 dbSNP
rs894004324 625 dbSNP
rs1021825781 631 dbSNP
rs1472808100 632 dbSNP
rs1266149583 645 dbSNP
rs1412259081 647 dbSNP
rs937767134 647 dbSNP
rs1198074910 648 dbSNP
rs1403015062 648 dbSNP
rs1488381391 650 dbSNP
rs1319369461 653 dbSNP
rs1360340155 656 dbSNP
rs1314933590 660 dbSNP
rs1356339574 660 dbSNP
rs372542815 660 dbSNP
rs904835011 660 dbSNP
rs753647399 664 dbSNP
rs534496863 665 dbSNP
rs1286691891 674 dbSNP
rs1352649204 676 dbSNP
rs1214197366 677 dbSNP
rs77570322 677 dbSNP
rs999644852 678 dbSNP
rs890169055 681 dbSNP
rs1315481501 686 dbSNP
rs972035279 688 dbSNP
rs548813383 689 dbSNP
rs1159742273 690 dbSNP
rs766150482 691 dbSNP
rs1220311807 693 dbSNP
rs1403162078 696 dbSNP
rs745898823 696 dbSNP
rs1370363449 697 dbSNP
rs1281389644 698 dbSNP
rs1404432954 702 dbSNP
rs1341315625 703 dbSNP
rs1309817292 706 dbSNP
rs1300245597 710 dbSNP
rs1451964647 716 dbSNP
rs1344375963 725 dbSNP
rs1176613346 729 dbSNP
rs1416036462 736 dbSNP
rs1427133511 740 dbSNP
rs1345258711 741 dbSNP
rs1175025135 742 dbSNP
rs900443193 750 dbSNP
rs909064242 754 dbSNP
rs984164938 756 dbSNP
rs1037551513 760 dbSNP
rs954116967 760 dbSNP
rs1264763339 762 dbSNP
rs749284075 768 dbSNP
rs1184392230 769 dbSNP
rs941879942 770 dbSNP
rs1485377594 771 dbSNP
rs1170987032 772 dbSNP
rs1398925163 776 dbSNP
rs545224126 781 dbSNP
rs1330843195 782 dbSNP
rs145610678 786 dbSNP
rs1303100842 788 dbSNP
rs1331436758 790 dbSNP
rs1211277201 794 dbSNP
rs756251126 797 dbSNP
rs550480721 799 dbSNP
rs1009842087 800 dbSNP
rs149674510 802 dbSNP
rs767545243 803 dbSNP
rs1216052321 806 dbSNP
rs1223479420 809 dbSNP
rs1268692388 810 dbSNP
rs761978647 814 dbSNP
rs1032481802 816 dbSNP
rs1002362596 823 dbSNP
rs532227511 823 dbSNP
rs904949504 823 dbSNP
rs1421632379 829 dbSNP
rs949060284 829 dbSNP
rs776779929 830 dbSNP
rs897503146 830 dbSNP
rs774536575 835 dbSNP
rs188563348 836 dbSNP
rs546142008 840 dbSNP
rs909011778 844 dbSNP
rs529960014 845 dbSNP
rs1303156522 846 dbSNP
rs1315485552 847 dbSNP
rs1234598761 850 dbSNP
rs183489492 853 dbSNP
rs781493945 854 dbSNP
rs1208425496 865 dbSNP
rs921328312 871 dbSNP
rs370690852 872 dbSNP
rs977904955 873 dbSNP
rs776938712 874 dbSNP
rs1421795807 876 dbSNP
rs1476187660 877 dbSNP
rs544086374 882 dbSNP
rs1425141612 885 dbSNP
rs191253418 891 dbSNP
rs368140694 895 dbSNP
rs1427492732 897 dbSNP
rs1414093506 898 dbSNP
rs1182761022 900 dbSNP
rs545990622 902 dbSNP
rs958277502 905 dbSNP
rs1203576816 907 dbSNP
rs1458659388 911 dbSNP
rs900140742 914 dbSNP
rs1397257021 916 dbSNP
rs1002310371 917 dbSNP
rs577220735 918 dbSNP
rs1288807844 920 dbSNP
rs1025116506 924 dbSNP
rs553897605 932 dbSNP
rs764465232 934 dbSNP
rs776061906 934 dbSNP
rs1182493230 935 dbSNP
rs1230283164 936 dbSNP
rs1036035512 940 dbSNP
rs1005924322 944 dbSNP
rs1048005863 944 dbSNP
rs757555467 945 dbSNP
rs1420024494 947 dbSNP
rs1380288676 949 dbSNP
rs1050355950 950 dbSNP
rs1335917591 950 dbSNP
rs931787908 955 dbSNP
rs1398151237 956 dbSNP
rs1358225525 962 dbSNP
rs1467295332 968 dbSNP
rs1302893387 970 dbSNP
rs1447336955 971 dbSNP
rs751917625 975 dbSNP
rs534146465 979 dbSNP
rs1378304597 982 dbSNP
rs1044470252 984 dbSNP
rs923140220 985 dbSNP
rs1284380450 990 dbSNP
rs1461070287 993 dbSNP
rs1041489564 998 dbSNP
rs374681101 1003 dbSNP
rs139461814 1004 dbSNP
rs1482280688 1011 dbSNP
rs1180602227 1017 dbSNP
rs1054757319 1018 dbSNP
rs1440313631 1024 dbSNP
rs934901960 1027 dbSNP
rs538537401 1028 dbSNP
rs1378305587 1037 dbSNP
rs1434707948 1039 dbSNP
rs924834248 1048 dbSNP
rs1442462995 1052 dbSNP
rs1176280731 1056 dbSNP
rs1358220550 1061 dbSNP
rs1464052638 1063 dbSNP
rs1332855165 1065 dbSNP
rs536096932 1068 dbSNP
rs1446764038 1071 dbSNP
rs958056623 1072 dbSNP
rs758881717 1074 dbSNP
rs1370132595 1081 dbSNP
rs1220182937 1082 dbSNP
rs987392127 1083 dbSNP
rs1310723593 1087 dbSNP
rs145981923 1091 dbSNP
rs765756864 1092 dbSNP
rs1197876772 1094 dbSNP
rs1231134379 1095 dbSNP
rs1489299938 1097 dbSNP
rs1253315268 1099 dbSNP
rs1424008316 1101 dbSNP
rs974422572 1102 dbSNP
rs1431139080 1103 dbSNP
rs1172169628 1107 dbSNP
rs964384777 1108 dbSNP
rs144020583 1118 dbSNP
rs1266163009 1130 dbSNP
rs367666536 1131 dbSNP
rs369492990 1131 dbSNP
rs1357557012 1132 dbSNP
rs1437615239 1132 dbSNP
rs1006164290 1134 dbSNP
rs969938476 1134 dbSNP
rs1220745003 1139 dbSNP
rs1279102376 1141 dbSNP
rs1314033815 1146 dbSNP
rs188058550 1148 dbSNP
rs1270725066 1152 dbSNP
rs1453310116 1161 dbSNP
rs1337417376 1168 dbSNP
rs1304739165 1172 dbSNP
rs1390794091 1175 dbSNP
rs771302510 1177 dbSNP
rs1003133499 1178 dbSNP
rs1489806087 1178 dbSNP
rs1195349889 1183 dbSNP
rs1263463475 1186 dbSNP
rs554168612 1188 dbSNP
rs747661774 1191 dbSNP
rs778337898 1192 dbSNP
rs1416586055 1193 dbSNP
rs1294848847 1194 dbSNP
rs1422294510 1197 dbSNP
rs754685134 1199 dbSNP
rs1348448960 1201 dbSNP
rs1402276219 1206 dbSNP
rs748937034 1207 dbSNP
rs961812539 1209 dbSNP
rs1398211305 1210 dbSNP
rs1358358354 1212 dbSNP
rs9866872 1212 dbSNP
rs546205406 1213 dbSNP
rs1289103066 1218 dbSNP
rs1356927304 1220 dbSNP
rs1218539703 1221 dbSNP
rs115135892 1226 dbSNP
rs1365954259 1229 dbSNP
rs1050304134 1230 dbSNP
rs183795829 1231 dbSNP
rs1238751957 1232 dbSNP
rs1472853444 1236 dbSNP
rs193289939 1239 dbSNP
rs530793378 1243 dbSNP
rs934161148 1252 dbSNP
rs1421840280 1258 dbSNP
rs1040201942 1260 dbSNP
rs879465085 1262 dbSNP
rs921429355 1267 dbSNP
rs1201699507 1273 dbSNP
rs576298642 1273 dbSNP
rs1341103176 1276 dbSNP
rs945910810 1279 dbSNP
rs1489906697 1280 dbSNP
rs545158167 1280 dbSNP
rs757080754 1282 dbSNP
rs1217668388 1283 dbSNP
rs577280039 1283 dbSNP
rs913971499 1291 dbSNP
rs1286525651 1294 dbSNP
rs1352499465 1294 dbSNP
rs1202951511 1297 dbSNP
rs964415872 1301 dbSNP
rs1352542559 1304 dbSNP
rs751743412 1307 dbSNP
rs1043074 1309 dbSNP
rs1258799807 1310 dbSNP
rs1238241131 1312 dbSNP
rs1179613220 1316 dbSNP
rs188227632 1319 dbSNP
rs1174469672 1324 dbSNP
rs1403201096 1326 dbSNP
rs1284586498 1329 dbSNP
rs1413965434 1330 dbSNP
rs1052501478 1333 dbSNP
rs984883063 1340 dbSNP
rs1309913008 1342 dbSNP
rs1448971726 1342 dbSNP
rs765386915 1345 dbSNP
rs936648301 1346 dbSNP
rs1236615531 1353 dbSNP
rs1276192949 1353 dbSNP
rs560600717 1356 dbSNP
rs1298395524 1357 dbSNP
rs1218122781 1360 dbSNP
rs754707668 1366 dbSNP
rs1459462648 1370 dbSNP
rs540706573 1370 dbSNP
rs1026658289 1373 dbSNP
rs1238111891 1374 dbSNP
rs1017131988 1375 dbSNP
rs574934914 1377 dbSNP
rs183098067 1381 dbSNP
rs992335877 1382 dbSNP
rs1453600359 1383 dbSNP
rs568333054 1384 dbSNP
rs548482605 1396 dbSNP
rs762223895 1398 dbSNP
rs772672908 1399 dbSNP
rs1466236363 1404 dbSNP
rs962544025 1405 dbSNP
rs1178624434 1406 dbSNP
rs1479477494 1407 dbSNP
rs1014667615 1409 dbSNP
rs1005985533 1412 dbSNP
rs893209387 1414 dbSNP
rs951667026 1418 dbSNP
rs1218725701 1424 dbSNP
rs763305052 1428 dbSNP
rs999268370 1429 dbSNP
rs995878996 1431 dbSNP
rs1268328904 1434 dbSNP
rs1491123175 1437 dbSNP
rs1491142648 1438 dbSNP
rs901758970 1438 dbSNP
rs1449026949 1440 dbSNP
rs868241885 1440 dbSNP
rs570754638 1442 dbSNP
rs1051820656 1449 dbSNP
rs538168652 1451 dbSNP
rs1204350130 1453 dbSNP
rs1019304942 1458 dbSNP
rs934236195 1462 dbSNP
rs1164755887 1463 dbSNP
rs1345574706 1467 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084066. RNA binding protein: AGO2. Condition:CLIP_noemetine_SantaCruzAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_015541 | 3UTR | AGAACAGUUAAACACUGCCUUUCCUCCUCCUCUUAUUUUAUGAUAAAAGCAAAUGUGGCCUUCUCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_015541 | 3UTR | CCAUCACAAGCAAAAGGUCAGAACAGUUAAACACUGCCUUUCCUCCUCCUCUUAUUUUAUGAUAAAAGCAAAUGUGGCCUUCUCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_015541 | 3UTR | GGUCAGAACAGUUAAACACUGCCUUUCCUCCUCCUCUUAUUUUAUGAUAAAAGCAAAUGUGGCCUUCUCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_015541 | 3UTR | CAAAAGGUCAGAACAGUUAAACACUGCCUUUCCUCCUCCUCUUAUUUUAUGAUAAAAGCAAAUGUGGCCUUCUCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_015541 | 3UTR | AAACACUGCCUUUCCUCCUCCUCUUAUUUUAUGAUAAAAGCAAAUGUGGCCUUCUCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_015541 | 3UTR | UAAACACUGCCUUUCCUCCUCCUCUUAUUUUAUGAUAAAAGCAAAUGUGGCCUUCUCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1084066
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_SantaCruzAb
Location of target site ENST00000273261.3 | 3UTR | AAAAGCUGAAGGGAGUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
94 hsa-miR-4753-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT064916 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT161166 SLC25A36 solute carrier family 25 member 36 2 2
MIRT285542 CDT1 chromatin licensing and DNA replication factor 1 2 2
MIRT308266 LRIG1 leucine rich repeats and immunoglobulin like domains 1 2 2
MIRT311425 LMNB1 lamin B1 2 2
MIRT373989 PEBP1 phosphatidylethanolamine binding protein 1 2 4
MIRT383141 CRY2 cryptochrome circadian clock 2 2 2
MIRT405243 ADIPOR2 adiponectin receptor 2 2 2
MIRT441620 ROCK1 Rho associated coiled-coil containing protein kinase 1 2 6
MIRT441789 SRPK1 SRSF protein kinase 1 2 2
MIRT441804 NOC3L NOC3 like DNA replication regulator 2 2
MIRT441832 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT442005 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 2 2
MIRT442411 LIMD1 LIM domains containing 1 2 2
MIRT442708 UBE4B ubiquitination factor E4B 2 2
MIRT442714 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT442738 SERINC5 serine incorporator 5 2 2
MIRT442793 CEP170 centrosomal protein 170 2 2
MIRT442984 ZNF736 zinc finger protein 736 2 2
MIRT443055 THRB thyroid hormone receptor beta 2 2
MIRT443288 ZC3H12A zinc finger CCCH-type containing 12A 2 2
MIRT443325 SLC35G1 solute carrier family 35 member G1 2 2
MIRT443331 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT443593 ZNF439 zinc finger protein 439 2 4
MIRT443696 KCNN3 potassium calcium-activated channel subfamily N member 3 2 2
MIRT443748 ELL2 elongation factor for RNA polymerase II 2 2 2
MIRT443866 HDLBP high density lipoprotein binding protein 2 2
MIRT461185 LTBP2 latent transforming growth factor beta binding protein 2 2 2
MIRT464074 WAC WW domain containing adaptor with coiled-coil 2 2
MIRT468738 SDC4 syndecan 4 2 2
MIRT470540 COASY Coenzyme A synthase 2 2
MIRT476458 GBA2 glucosylceramidase beta 2 2 2
MIRT479470 CDK6 cyclin dependent kinase 6 2 2
MIRT486351 TACC2 transforming acidic coiled-coil containing protein 2 2 8
MIRT495126 CXorf67 chromosome X open reading frame 67 2 2
MIRT495166 CNGA2 cyclic nucleotide gated channel alpha 2 2 4
MIRT495432 ATG7 autophagy related 7 2 2
MIRT495922 FBXO41 F-box protein 41 2 2
MIRT496572 DGCR6L DiGeorge syndrome critical region gene 6 like 2 2
MIRT498277 POFUT1 protein O-fucosyltransferase 1 2 2
MIRT498431 DDX39A DExD-box helicase 39A 2 2
MIRT530149 HADHB hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit 2 2
MIRT530313 TNFRSF10D TNF receptor superfamily member 10d 2 2
MIRT530880 TRUB1 TruB pseudouridine synthase family member 1 2 4
MIRT531177 ZNF626 zinc finger protein 626 2 2
MIRT533395 TYRP1 tyrosinase related protein 1 2 2
MIRT533709 TMEM64 transmembrane protein 64 2 2
MIRT533954 TAF1D TATA-box binding protein associated factor, RNA polymerase I subunit D 2 2
MIRT535616 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT539472 ADARB2 adenosine deaminase, RNA specific B2 (inactive) 2 2
MIRT542878 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT559077 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT559465 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT561233 ZNF772 zinc finger protein 772 2 2
MIRT563477 POLE3 DNA polymerase epsilon 3, accessory subunit 2 2
MIRT563995 SLFN11 schlafen family member 11 2 2
MIRT564222 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT566017 RHOA ras homolog family member A 2 2
MIRT566028 RFX1 regulatory factor X1 2 2
MIRT566591 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT567874 CTDSP1 CTD small phosphatase 1 2 2
MIRT568552 AKT2 AKT serine/threonine kinase 2 2 2
MIRT569357 EFHC1 EF-hand domain containing 1 2 2
MIRT569973 DNAAF2 dynein axonemal assembly factor 2 2 2
MIRT614423 ZNF440 zinc finger protein 440 2 2
MIRT628831 SLC25A34 solute carrier family 25 member 34 2 2
MIRT630142 ZFYVE9 zinc finger FYVE-type containing 9 2 2
MIRT634479 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 2
MIRT634498 OR7D2 olfactory receptor family 7 subfamily D member 2 2 2
MIRT637394 R3HDM2 R3H domain containing 2 2 2
MIRT641840 TCF7L2 transcription factor 7 like 2 2 2
MIRT644397 CDKL1 cyclin dependent kinase like 1 2 2
MIRT644888 C2orf50 chromosome 2 open reading frame 50 2 2
MIRT647124 ZNF446 zinc finger protein 446 2 2
MIRT647420 SSTR3 somatostatin receptor 3 2 2
MIRT650297 PYCARD PYD and CARD domain containing 2 2
MIRT655488 PAK3 p21 (RAC1) activated kinase 3 2 2
MIRT658185 FBXO9 F-box protein 9 2 2
MIRT660931 ADAM19 ADAM metallopeptidase domain 19 2 2
MIRT665317 ZBTB3 zinc finger and BTB domain containing 3 2 2
MIRT670350 C1orf106 chromosome 1 open reading frame 106 2 4
MIRT670823 NICN1 nicolin 1 2 2
MIRT671825 TRPM6 transient receptor potential cation channel subfamily M member 6 2 2
MIRT672732 NETO2 neuropilin and tolloid like 2 2 2
MIRT674841 GLRX2 glutaredoxin 2 2 2
MIRT675930 CYP51A1 cytochrome P450 family 51 subfamily A member 1 2 2
MIRT686786 AZF1 azoospermia factor 1 2 2
MIRT697723 USP8 ubiquitin specific peptidase 8 2 2
MIRT702357 KLHL26 kelch like family member 26 2 2
MIRT704361 DBR1 debranching RNA lariats 1 2 2
MIRT709242 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT714433 SNED1 sushi, nidogen and EGF like domains 1 2 2
MIRT717000 ARL6IP4 ADP ribosylation factor like GTPase 6 interacting protein 4 2 2
MIRT720875 ADCY5 adenylate cyclase 5 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4753 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-4753-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-4753-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-4753-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-4753-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-4753-5p Platinum 23939 resistant tissue
hsa-miR-4753-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4753-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-4753-5p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission