pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-3529 |
Genomic Coordinates | chr15: 88611847 - 88611924 |
Description | Homo sapiens miR-3529 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-3529-5p | |||||||||||||||||||||||||||||||||||||||
Sequence | 10| AGGUAGACUGGGAUUUGUUGUU |31 | |||||||||||||||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||||||||||||||
Experiments | Illumina | |||||||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | SLC16A10 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | MCT10, PRO0813, TAT1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | solute carrier family 16 member 10 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_018593 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on SLC16A10 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of SLC16A10 (miRNA target sites are highlighted) |
>SLC16A10|NM_018593|3'UTR 1 TATCTTACATACCTCCACCAGACTGGACTTGCTTTTTGAATTTTAAGCAAGTTTCCTTTCCTTTTATACAAATTGCAAAT 81 TTCATATTTTTTTAATCACATCCTAGGAATAGCACAATAATTGGGAAATAGAACCCTTATCACTAGAAGAACCATTTTCT 161 GCCACTAAATATCTCTGATGTTTCCATGAGTCTGAGGGCAGAGACTCTGGTATATGAAAACGTCTGAAAGTCACATATTG 241 TGAAAATTTGAAGCTATCTCAGTAAAAAGCAGCTTTGGAAACTGTGAATGATCTTTAGCTTGTACAAATGTTTAAAAATA 321 CCTCAGGCTATACTGAAAGGGTTGCAGTTTGGTTAGGAGTGGAAATATTTTGTTTGTTAATGATGTCTTCAGTTCTGGTA 401 CCTCTGTTTTACTTTCTTATGCTCTTTGGAAACTTTTTGCAAAATTTAAGCCTGGGTTCTAGATAATACCAGATCTACCT 481 AAACCTCAAGTCTATGTTAAAGTTGCTTTCCTGCTGTTAAATAAGCTATGATATTAAGATATTCTGACTTGCTCCAGTGT 561 CAAGGGACCTTCTGGGAGCAGGTGCTAACATAGTGTTCAGAATCAATATGTGAGATGAAAAGGATCCCCTCCAGGAGGAT 641 CCTGAGCTGTTCAGAAATCATTTAAGTTTACAGCGTTGTTCCCTTTGCGTTTGCAGTGCGTTTTACTCAAGTAGCCAGAA 721 ACACCCCACGTTTCTGAATTTGTTTAAACTGTAACAATAAAGTAAAATAGAATGCATGAAAGATATTCTGGCGATTGTAA 801 CTTAGAATTTTTCTGACTTCTGGATTTGTTGGCACTAGAACCTGATATTTAAAGTCTTACTGAGCAGCTATCAAGTGGCA 881 GTTACAGGCACAAATTGGTGGAGGCTGGAGGATGGGGAGGGGAGCAAAACCCTTTATATTTGTGAAGAAAATATCTGTAG 961 CTGATAGAAATAATTGCTTAAATTGGTTTATGAAATTAATGAGTCTGAAAAGGTTAAAAGCACTTATAAAAAGAACCAAG 1041 TCCTACATTTCCAGAACTTTCTGGCAAAAATTTGCACTCATATTATTTATCCTATGAACATTCCCATTGTTTTTTTTTGC 1121 TATTTATATACAGATTATCATAAGAAAGCTCTCAGTTTGAGGACCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 117247.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
CLIP-seq Support 1 for dataset GSM1065667 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
Location of target site | ENST00000368850.3 | 3UTR | CUACCAAAAAUACAAAAUUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
66 hsa-miR-3529-5p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT068541 | NHLRC3 | NHL repeat containing 3 | 2 | 6 | ||||||||
MIRT094173 | PCGF3 | polycomb group ring finger 3 | 2 | 6 | ||||||||
MIRT100107 | ABT1 | activator of basal transcription 1 | 2 | 8 | ||||||||
MIRT120933 | PDE12 | phosphodiesterase 12 | 2 | 8 | ||||||||
MIRT179060 | PAFAH1B2 | platelet activating factor acetylhydrolase 1b catalytic subunit 2 | 2 | 6 | ||||||||
MIRT202049 | ZSWIM1 | zinc finger SWIM-type containing 1 | 2 | 2 | ||||||||
MIRT215733 | C5ORF51 | chromosome 5 open reading frame 51 | 2 | 10 | ||||||||
MIRT254619 | HIC2 | HIC ZBTB transcriptional repressor 2 | 2 | 2 | ||||||||
MIRT266230 | PEX11B | peroxisomal biogenesis factor 11 beta | 2 | 2 | ||||||||
MIRT297452 | SLC20A1 | solute carrier family 20 member 1 | 2 | 4 | ||||||||
MIRT315453 | SLC16A10 | solute carrier family 16 member 10 | 2 | 2 | ||||||||
MIRT442138 | C3orf17 | nucleolus and neural progenitor protein | 2 | 2 | ||||||||
MIRT453879 | IFRD1 | interferon related developmental regulator 1 | 2 | 12 | ||||||||
MIRT456259 | TDRKH | tudor and KH domain containing | 2 | 12 | ||||||||
MIRT456413 | MTRF1L | mitochondrial translational release factor 1 like | 2 | 2 | ||||||||
MIRT459730 | RRM1 | ribonucleotide reductase catalytic subunit M1 | 2 | 2 | ||||||||
MIRT461475 | METTL1 | methyltransferase like 1 | 2 | 2 | ||||||||
MIRT463790 | YBX1 | Y-box binding protein 1 | 2 | 6 | ||||||||
MIRT464032 | WASL | Wiskott-Aldrich syndrome like | 2 | 2 | ||||||||
MIRT464207 | VGLL4 | vestigial like family member 4 | 2 | 2 | ||||||||
MIRT466713 | SYNJ2BP | synaptojanin 2 binding protein | 2 | 2 | ||||||||
MIRT467958 | SLC16A1 | solute carrier family 16 member 1 | 2 | 4 | ||||||||
MIRT469225 | RHOBTB3 | Rho related BTB domain containing 3 | 2 | 2 | ||||||||
MIRT473960 | LRRC58 | leucine rich repeat containing 58 | 2 | 2 | ||||||||
MIRT475310 | IFNLR1 | interferon lambda receptor 1 | 2 | 2 | ||||||||
MIRT476946 | FAM83G | family with sequence similarity 83 member G | 2 | 4 | ||||||||
MIRT477746 | EDN1 | endothelin 1 | 2 | 2 | ||||||||
MIRT478261 | DDX19B | DEAD-box helicase 19B | 2 | 2 | ||||||||
MIRT478681 | CSRP2 | cysteine and glycine rich protein 2 | 2 | 4 | ||||||||
MIRT490256 | HAAO | 3-hydroxyanthranilate 3,4-dioxygenase | 2 | 2 | ||||||||
MIRT493290 | LNPEP | leucyl and cystinyl aminopeptidase | 2 | 2 | ||||||||
MIRT493565 | HSPA5 | heat shock protein family A (Hsp70) member 5 | 2 | 2 | ||||||||
MIRT495961 | TBC1D19 | TBC1 domain family member 19 | 2 | 2 | ||||||||
MIRT497107 | BEST3 | bestrophin 3 | 2 | 2 | ||||||||
MIRT498349 | CISD1 | CDGSH iron sulfur domain 1 | 2 | 2 | ||||||||
MIRT500784 | TMBIM6 | transmembrane BAX inhibitor motif containing 6 | 2 | 8 | ||||||||
MIRT501092 | SLC5A6 | solute carrier family 5 member 6 | 2 | 4 | ||||||||
MIRT505308 | TPD52 | tumor protein D52 | 2 | 2 | ||||||||
MIRT511108 | NFIB | nuclear factor I B | 2 | 4 | ||||||||
MIRT512736 | CD59 | CD59 molecule (CD59 blood group) | 2 | 4 | ||||||||
MIRT514270 | ZNF519 | zinc finger protein 519 | 2 | 2 | ||||||||
MIRT514603 | NDUFA12 | NADH:ubiquinone oxidoreductase subunit A12 | 2 | 4 | ||||||||
MIRT515379 | RPL7 | ribosomal protein L7 | 2 | 2 | ||||||||
MIRT518565 | GDPD1 | glycerophosphodiester phosphodiesterase domain containing 1 | 2 | 2 | ||||||||
MIRT520460 | TRPV2 | transient receptor potential cation channel subfamily V member 2 | 2 | 2 | ||||||||
MIRT529766 | SF3B1 | splicing factor 3b subunit 1 | 2 | 2 | ||||||||
MIRT538006 | DNAL1 | dynein axonemal light chain 1 | 2 | 2 | ||||||||
MIRT538251 | CUL3 | cullin 3 | 2 | 4 | ||||||||
MIRT543778 | RBM12B | RNA binding motif protein 12B | 2 | 4 | ||||||||
MIRT546204 | TOR1AIP2 | torsin 1A interacting protein 2 | 2 | 2 | ||||||||
MIRT547202 | PARP1 | poly(ADP-ribose) polymerase 1 | 2 | 2 | ||||||||
MIRT548441 | ELMOD2 | ELMO domain containing 2 | 2 | 2 | ||||||||
MIRT551635 | TRUB1 | TruB pseudouridine synthase family member 1 | 2 | 4 | ||||||||
MIRT553335 | TSC22D2 | TSC22 domain family member 2 | 2 | 2 | ||||||||
MIRT556170 | MCC | mutated in colorectal cancers | 2 | 2 | ||||||||
MIRT557969 | FAM222B | family with sequence similarity 222 member B | 2 | 2 | ||||||||
MIRT560717 | ZNF749 | zinc finger protein 749 | 2 | 2 | ||||||||
MIRT564115 | ZYG11B | zyg-11 family member B, cell cycle regulator | 2 | 4 | ||||||||
MIRT564375 | MRPS18B | mitochondrial ribosomal protein S18B | 2 | 2 | ||||||||
MIRT566934 | LIN28B | lin-28 homolog B | 2 | 2 | ||||||||
MIRT573339 | TUBD1 | tubulin delta 1 | 2 | 2 | ||||||||
MIRT607187 | SPRY4 | sprouty RTK signaling antagonist 4 | 2 | 2 | ||||||||
MIRT694902 | THAP6 | THAP domain containing 6 | 2 | 2 | ||||||||
MIRT698514 | TGFBR1 | transforming growth factor beta receptor 1 | 2 | 2 | ||||||||
MIRT704038 | EDEM3 | ER degradation enhancing alpha-mannosidase like protein 3 | 2 | 2 | ||||||||
MIRT714583 | PRRC1 | proline rich coiled-coil 1 | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|