pre-miRNA Information
pre-miRNA hsa-mir-367   
Genomic Coordinates chr4: 112647874 - 112647941
Synonyms MIRN367, hsa-mir-367, MIR367
Description Homo sapiens miR-367 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-367-3p
Sequence 44| AAUUGCACUUUAGCAAUGGUGA |65
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN24411246 17 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs535597757 1 dbSNP
rs1013348949 11 dbSNP
rs896333735 12 dbSNP
rs751269136 14 dbSNP
rs1163501507 16 dbSNP
rs757092597 21 dbSNP
Putative Targets

Gene Information
Gene Symbol ARID1B   
Synonyms 6A3-5, BAF250B, BRIGHT, CSS1, DAN15, ELD/OSA1, MRD12, OSA2, P250R
Description AT-rich interaction domain 1B
Transcript NM_017519   
Other Transcripts NM_020732   
Expression
Putative miRNA Targets on ARID1B
3'UTR of ARID1B
(miRNA target sites are highlighted)
>ARID1B|NM_017519|3'UTR
   1 CATAAGTGAGAAGGCAAGCATGTGTGAGTGAAGATTAGAGGGTCACATATAACTGGCTGTTTTCTGTTCTTGTTTATCCA
  81 GCGTAGGAAGAAGGAAAAGAAAATCTTTGCTCCTCTGCCCCATTCACTATTTACCAATTGGGAATTAAAGAAATAATTAA
 161 TTTGAACAGTTATGAAATTAATATTTGCTGTCTGTGTGTATAAGTACATCCTTTGGGGTTTTTTTTTTCTCTTTTTTTTA
 241 ACCAAAGTTGCTGTCTAGTGCATTCAAAGGTCACTTTTTGTTCTTCACAGATCTTTTTAATGTTCTTTCCCATGTTGTAT
 321 TGCATTTTTGGGGGAAGCAAATTGACTTTAAAGAAAAAAGTTGTGGCAAAAGATGCTAAGATGCGAAAATTTCACCACAC
 401 TGAGTCAAAAAGGTGAAAAATTATCCATTTCCTATGCGTTTTACTCCTCAGAGAATGAAAAAAACTGCATCCCATCACCC
 481 AAAGTTCTGTGCAATAGAAATTTCTACAGATACAGGTATAGGGGCTCAAGGAGGTATGTCGGTCAGTAGTCAAAACTATG
 561 AAATGATACTGGTTTCTCCACAGGAATATGGTTCCATTAGGCTGGGAGCAAAAACAATGTTTTTTAAGATTGAGAATACA
 641 TACCTGACAACGATCCGGAAACTGCTCCTCACCACTCCCGTCATGCCTGCTGTCGGCGTTTGACCTTCCACGTGACAGTT
 721 CTTCACAATTCCTTTCATCATTTTTTAAATATTTTTTTTACTGCCTATGGGCTGTGATGTATATAGAAGTTGTACATTAA
 801 ACATACCCTCATTTTTTTCTTTTCTTTTTTTTTTTTTTTTTTAGTACAAAGTTTTAGTTTCTTTTTCATGATGTGGTAAC
 881 TACGAAGTGATGGTAGATTTAAATAATTTTTTATTTTTATTTTATATATTTTTTCATTAGGGCCATATCTCCAAAAAAAG
 961 AAAGAAAAAATACAAAAAACAAAAACAAAAAAAAAAGAGGGTAATGTACAAGTTTCTGTATGTATAAAGTCATGCTCGAT
1041 TTCAGGAGAGCAGCTGATCACAATTTGCTTCATGAATCAAGGTGTGGAAATGGTTATATATGGATTGATTTAGAAAATGG
1121 TTACCAGTACAGTCAAAAAAGAGAAAATGAAAAAAATACAACTAAAAGGAAGAAACACAACTTCAAAGATTTTTCAGTGA
1201 TGAGAATCCACATTTGTATTTCAAGATAATGTAGTTTAAAAAAAAAAAAAAGAAAAAAACTTGATGTAAATTCCTCCTTT
1281 TCCTCTGGCTTAATGAATATCATTTATTCAGTATAAAATCTTTATATGTTCCACATGTTAAGAATAAATGTACATTAAAT
1361 CTTGTTAAGCACTGTGATGGGTGTTCTTGAATACTGTTCTAGTTTCCTTAAAGTGGTTTCCTAGTAATCAAGTTATTTAC
1441 AAGAAATAGGGGAATGCAGCAGTGTATTCACATTATAAAACCCTACATTTGGAAGAGACCTTTAGGGGTTACCTACTTTA
1521 GAGTGGGGAGCAACAGTTTGATTTTCTCAAATTACTTAGCTAATTAGTCTTTCTTTGAAGCAATTAACTCTAACGACATT
1601 GAGGTATGATCATTTTCAGTATTTATGGGAGGTGGCTGCTGACCCACTTGAGGTGAGATCTCAGAAGCTTAACTGGCCTG
1681 AAAATGTAACATTCTGCCTTTTACTAACTCCATCTTAGTTTAATCAAAGTTCAATCTATTCCTTGTTTCTTCTGTGTGCC
1761 TCAGAGTTATTTTGCATTTAGTTTACTCCACCGTGTATAATATTTATACTGTGCAATGTTAAAAAAGAATCTGTTATATT
1841 GTATGTGGTGTACATAGTGCAAAGTGATGATTTCTATTTCAGGGCATATTATGGTTCTCATATTCCTTCCTACCTGGTGC
1921 ACAGTAGCTTTTTAATACTAGTCACTTCTAATTTAAACTTTCTCTTCCTGGGTCATTGACTGTTACTGTGTAATAATCGA
2001 TTTCTTTGAAACTGCTGCATAATTATGCTGTTAGTGGACCTCTACCTCTTCTCTTCCCTCTCCCAATCACAGTATACTCA
2081 GAATCCCCAGCCCCTCGCATACATTGTGTCGGTTCACATTACTCACAGTAATATATGGAAGAGTTAGACAAGAACATGCA
2161 GTTACAGTCATTGTGAGACGTGACTCTCCAGTGTCACGAGGAAAAAAATCATCTTTTCTGCAAACAGTCTCTCATCTGTC
2241 AACTCCCACATTACTGAGTCAAACAGTCTTCTTACATAACAATGCAACCAAATATATGTTGAATTAAAGACCCATTTATA
2321 ATTCTGCTTTAAATACATCTGCTTGCTAAGAACAGATTTCAGTGCTCCAAGCTTCAAATATGGAGATTTGTAAGAGGGAA
2401 TTCAATATTATTCTAATTTCTCTCTTACAGAGTACAAATAAAAGGTGTATACAAACTCCGAACATATCCAGTATTCCAAT
2481 TCCTTTGTCAATCAGAAGAGTAAAATAATTAACAAAAGACTGTTGTTATGGTTTGCATTGTAACCGATACGCAGAGTCTG
2561 ACCGTTGGGCAACAAGTTTTTCTATCCTGATGCGCAACACAGTCTCTAGAGACTAATCCAGGAAGACTTTAGCCTCCTTT
2641 CCATATTCTCACCCCCGAATCAAGATTTACAGAAGCCCACGAAGAATTTACAGCCTGCTTGAGATCATCTTGCCTATAAA
2721 CTGAGTTATTGCTTTGTCCTAAAAATTAGTCGGTTTTTTTTTTTCTATGAGGCTTTTCAGAAATTTACAGGATGCCCAGA
2801 CTTTACATGTGTACCAAAAAAAAAAAAAAGATAAAAAATAAAGGTGCAAAGAAAGTTTAGTATTTTGGAATGGTGCTATA
2881 AAGTTGAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' agUGGUAACGAUUUCACGUUAa 5'
            | :|||  ||  ||||||| 
Target 5' atAATATTTATACTGTGCAATg 3'
1797 - 1818 156.00 -6.80
2
miRNA  3' aguGGUA-ACGAUUU-----CACGUUAa 5'
             ||||   | |||     ||||||| 
Target 5' atcCCATCACCCAAAGTTCTGTGCAATa 3'
469 - 496 147.00 -12.60
3
miRNA  3' agUGGUA----ACGAUUUCACGUUAa 5'
            ::|||    ||:||  |||:||| 
Target 5' ggGTCATTGACTGTTACTGTGTAATa 3'
1970 - 1995 142.00 -11.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1180319 201 ClinVar
1189044 219 ClinVar
COSN30468914 6 COSMIC
COSN30543826 12 COSMIC
COSN30157380 31 COSMIC
COSN26966731 87 COSMIC
COSN31579952 94 COSMIC
COSN32053573 100 COSMIC
COSN31608907 106 COSMIC
COSN30451876 113 COSMIC
COSN31609188 159 COSMIC
COSN19658962 195 COSMIC
COSN26642972 201 COSMIC
COSN31530079 207 COSMIC
COSN19661698 211 COSMIC
COSN22788882 228 COSMIC
COSN28836058 229 COSMIC
COSN31549924 289 COSMIC
COSN31607201 296 COSMIC
COSN20835042 335 COSMIC
COSN31555096 427 COSMIC
COSN31556511 537 COSMIC
COSN26552733 686 COSMIC
COSN31543012 688 COSMIC
COSN31545070 761 COSMIC
COSN32064977 820 COSMIC
COSN31547858 1118 COSMIC
COSN31489527 1229 COSMIC
COSN7696171 1249 COSMIC
COSN27306997 1252 COSMIC
COSN28967949 1252 COSMIC
COSN31520978 1330 COSMIC
COSN31480641 1343 COSMIC
COSN22503647 1559 COSMIC
COSN25278483 1968 COSMIC
COSN20907773 2565 COSMIC
COSN26179646 2753 COSMIC
COSN25541170 2774 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs756796465 2 dbSNP
rs367616374 4 dbSNP
rs1212358341 7 dbSNP
rs1334692581 13 dbSNP
rs1024749102 19 dbSNP
rs1457372372 35 dbSNP
rs749918218 42 dbSNP
rs535044026 48 dbSNP
rs779930852 49 dbSNP
rs753674523 50 dbSNP
rs1391668314 58 dbSNP
rs1378456252 65 dbSNP
rs977941470 70 dbSNP
rs926044618 78 dbSNP
rs1164961753 80 dbSNP
rs1451317807 82 dbSNP
rs980457505 83 dbSNP
rs777151757 84 dbSNP
rs1440616433 95 dbSNP
rs1240264213 96 dbSNP
rs939553312 97 dbSNP
rs1036516620 100 dbSNP
rs1291173147 101 dbSNP
rs1311951855 103 dbSNP
rs570884566 106 dbSNP
rs986277588 111 dbSNP
rs1352995725 114 dbSNP
rs1240418765 129 dbSNP
rs910782464 130 dbSNP
rs1234636427 139 dbSNP
rs1371142187 147 dbSNP
rs567421133 147 dbSNP
rs1316214815 150 dbSNP
rs1325417877 151 dbSNP
rs1380516612 165 dbSNP
rs1236804488 173 dbSNP
rs1383960638 181 dbSNP
rs1421298768 185 dbSNP
rs774413188 195 dbSNP
rs1172044353 197 dbSNP
rs1488531626 197 dbSNP
rs1210416652 198 dbSNP
rs188107152 201 dbSNP
rs1247419389 216 dbSNP
rs1049541242 219 dbSNP
rs370046956 219 dbSNP
rs376411414 219 dbSNP
rs918951615 219 dbSNP
rs565384835 220 dbSNP
rs1182475488 229 dbSNP
rs1407369950 230 dbSNP
rs1224613650 232 dbSNP
rs1276174926 232 dbSNP
rs1325722326 238 dbSNP
rs1417784350 243 dbSNP
rs1161998838 247 dbSNP
rs1401578268 251 dbSNP
rs929068226 253 dbSNP
rs1007651183 257 dbSNP
rs1434402995 259 dbSNP
rs1425953967 263 dbSNP
rs1174323913 268 dbSNP
rs767184498 271 dbSNP
rs539499874 272 dbSNP
rs1195081203 275 dbSNP
rs1048803607 277 dbSNP
rs573082485 284 dbSNP
rs887533818 289 dbSNP
rs1442565812 291 dbSNP
rs535701795 292 dbSNP
rs1193517579 294 dbSNP
rs760431796 303 dbSNP
rs1338213876 305 dbSNP
rs1311864878 311 dbSNP
rs1278731537 313 dbSNP
rs763769394 322 dbSNP
rs190173514 333 dbSNP
rs1292523748 335 dbSNP
rs998456892 338 dbSNP
rs1054982476 348 dbSNP
rs1336427666 349 dbSNP
rs1359903706 349 dbSNP
rs1030816385 355 dbSNP
rs577336040 360 dbSNP
rs754164564 368 dbSNP
rs1171992891 374 dbSNP
rs1479126532 375 dbSNP
rs1010796242 385 dbSNP
rs1309130311 386 dbSNP
rs1473340970 388 dbSNP
rs1238803076 391 dbSNP
rs1179273289 394 dbSNP
rs868751244 400 dbSNP
rs1258213013 411 dbSNP
rs1200454725 414 dbSNP
rs544504579 418 dbSNP
rs1354114691 423 dbSNP
rs1021926956 425 dbSNP
rs556846733 438 dbSNP
rs1277955860 439 dbSNP
rs1440365256 440 dbSNP
rs1376246368 442 dbSNP
rs980394065 447 dbSNP
rs998822282 448 dbSNP
rs1392854569 466 dbSNP
rs927744241 475 dbSNP
rs1164728748 482 dbSNP
rs1406286005 485 dbSNP
rs1416474821 488 dbSNP
rs960467735 501 dbSNP
rs1033030926 508 dbSNP
rs972658266 511 dbSNP
rs757700329 513 dbSNP
rs1466770316 516 dbSNP
rs1252258296 519 dbSNP
rs1279731928 520 dbSNP
rs1222269517 523 dbSNP
rs1323269701 537 dbSNP
rs779144270 541 dbSNP
rs1049274914 542 dbSNP
rs575217434 547 dbSNP
rs1310293061 559 dbSNP
rs910804530 563 dbSNP
rs966313924 578 dbSNP
rs943385095 583 dbSNP
rs1368920819 587 dbSNP
rs1040386365 595 dbSNP
rs1293432950 596 dbSNP
rs901956638 606 dbSNP
rs1437881955 616 dbSNP
rs1454246502 616 dbSNP
rs1157293889 617 dbSNP
rs139857885 618 dbSNP
rs919520749 620 dbSNP
rs531525517 634 dbSNP
rs759558356 642 dbSNP
rs928930655 648 dbSNP
rs1052715080 649 dbSNP
rs758813647 652 dbSNP
rs1011245983 653 dbSNP
rs1191697153 654 dbSNP
rs1489382592 657 dbSNP
rs1240293706 658 dbSNP
rs1214748174 662 dbSNP
rs1022201277 668 dbSNP
rs550131581 671 dbSNP
rs1286970616 673 dbSNP
rs1242645837 674 dbSNP
rs1436121523 679 dbSNP
rs575277747 680 dbSNP
rs937767367 681 dbSNP
rs1219892298 686 dbSNP
rs1001856876 687 dbSNP
rs1034621461 695 dbSNP
rs527713858 696 dbSNP
rs960757501 699 dbSNP
rs149835997 704 dbSNP
rs1399743740 706 dbSNP
rs1026907446 712 dbSNP
rs146453054 713 dbSNP
rs1300901140 728 dbSNP
rs1432549252 741 dbSNP
rs1042666510 746 dbSNP
rs1242724902 750 dbSNP
rs902442942 751 dbSNP
rs1417249982 752 dbSNP
rs1434415769 752 dbSNP
rs1192905893 755 dbSNP
rs1372999806 756 dbSNP
rs1478012733 762 dbSNP
rs1265133174 765 dbSNP
rs182437712 768 dbSNP
rs7765775 775 dbSNP
rs377406756 776 dbSNP
rs1210852158 796 dbSNP
rs1305805098 798 dbSNP
rs976093606 804 dbSNP
rs549575132 806 dbSNP
rs1258820580 811 dbSNP
rs1280412834 812 dbSNP
rs1483164319 812 dbSNP
rs1413332859 815 dbSNP
rs1468383840 815 dbSNP
rs1303098813 817 dbSNP
rs879242544 820 dbSNP
rs1192308673 823 dbSNP
rs1352310511 824 dbSNP
rs878952162 824 dbSNP
rs1198092039 825 dbSNP
rs1256306319 825 dbSNP
rs1260571639 825 dbSNP
rs1319137514 825 dbSNP
rs139366986 825 dbSNP
rs1466138454 825 dbSNP
rs878880822 825 dbSNP
rs1255276932 827 dbSNP
rs1007632226 828 dbSNP
rs1397474047 830 dbSNP
rs966572446 833 dbSNP
rs1370532547 843 dbSNP
rs1191389377 844 dbSNP
rs1418305669 845 dbSNP
rs1426395159 848 dbSNP
rs1172127255 852 dbSNP
rs1400401949 853 dbSNP
rs1460855168 857 dbSNP
rs1162748528 858 dbSNP
rs371782923 862 dbSNP
rs1368888615 866 dbSNP
rs1396383021 867 dbSNP
rs1436978038 868 dbSNP
rs1425710377 873 dbSNP
rs976284586 873 dbSNP
rs1360071715 884 dbSNP
rs1468499760 890 dbSNP
rs1240537724 891 dbSNP
rs1216563700 892 dbSNP
rs1208630753 893 dbSNP
rs1356073989 907 dbSNP
rs1278846334 914 dbSNP
rs1247451493 923 dbSNP
rs1350980403 923 dbSNP
rs1334343499 927 dbSNP
rs1212350471 929 dbSNP
rs1308108576 930 dbSNP
rs1026953196 931 dbSNP
rs1446830603 945 dbSNP
rs1378530245 946 dbSNP
rs1275652333 953 dbSNP
rs1323788168 953 dbSNP
rs1386200196 953 dbSNP
rs1391185643 961 dbSNP
rs1295008337 965 dbSNP
rs1378652292 965 dbSNP
rs1451383190 965 dbSNP
rs950962702 972 dbSNP
rs1382307574 974 dbSNP
rs1452727429 974 dbSNP
rs770195764 974 dbSNP
rs1197361046 980 dbSNP
rs984436982 981 dbSNP
rs1487530861 983 dbSNP
rs186673230 983 dbSNP
rs1272643550 987 dbSNP
rs1284832556 987 dbSNP
rs200471587 987 dbSNP
rs749328123 987 dbSNP
rs796237569 987 dbSNP
rs1474184582 988 dbSNP
rs1195488781 990 dbSNP
rs934741854 990 dbSNP
rs1053174857 994 dbSNP
rs1380278200 995 dbSNP
rs1359718582 996 dbSNP
rs1297806802 999 dbSNP
rs917676120 1004 dbSNP
rs949215374 1006 dbSNP
rs1170837205 1013 dbSNP
rs1378678070 1014 dbSNP
rs1423709498 1019 dbSNP
rs1477035419 1025 dbSNP
rs1262994947 1026 dbSNP
rs1216882551 1027 dbSNP
rs1489030395 1029 dbSNP
rs1042243314 1039 dbSNP
rs1425844356 1040 dbSNP
rs768872927 1070 dbSNP
rs1345154580 1087 dbSNP
rs893200736 1088 dbSNP
rs781449234 1091 dbSNP
rs748312179 1095 dbSNP
rs1278526662 1107 dbSNP
rs1401629970 1108 dbSNP
rs1328373662 1128 dbSNP
rs1405901975 1130 dbSNP
rs529147371 1131 dbSNP
rs11858 1134 dbSNP
rs1403064682 1135 dbSNP
rs1343214890 1148 dbSNP
rs1043530634 1150 dbSNP
rs557239005 1150 dbSNP
rs1174818564 1165 dbSNP
rs1464584006 1172 dbSNP
rs905134035 1182 dbSNP
rs1423550073 1185 dbSNP
rs1194776673 1187 dbSNP
rs936622448 1189 dbSNP
rs1002054875 1190 dbSNP
rs1235349494 1198 dbSNP
rs1186456580 1201 dbSNP
rs565319277 1211 dbSNP
rs1054378315 1212 dbSNP
rs893177679 1213 dbSNP
rs1433147851 1216 dbSNP
rs1007519442 1231 dbSNP
rs1317160816 1235 dbSNP
rs1034652597 1238 dbSNP
rs1395908204 1238 dbSNP
rs545023901 1238 dbSNP
rs879202720 1238 dbSNP
rs1447653015 1239 dbSNP
rs901938988 1245 dbSNP
rs191127408 1246 dbSNP
rs998069124 1247 dbSNP
rs557803073 1248 dbSNP
rs1172061513 1249 dbSNP
rs1400154150 1249 dbSNP
rs1231572985 1250 dbSNP
rs1295226338 1251 dbSNP
rs1162278776 1252 dbSNP
rs1026507298 1253 dbSNP
rs1176179981 1253 dbSNP
rs1341713309 1253 dbSNP
rs950931904 1253 dbSNP
rs993562663 1254 dbSNP
rs774742301 1261 dbSNP
rs148830183 1279 dbSNP
rs960108795 1286 dbSNP
rs1223720773 1287 dbSNP
rs958986298 1300 dbSNP
rs538397336 1303 dbSNP
rs951868351 1305 dbSNP
rs1288967567 1307 dbSNP
rs1228680312 1312 dbSNP
rs1357252614 1319 dbSNP
rs1282592435 1324 dbSNP
rs990506200 1330 dbSNP
rs879131012 1333 dbSNP
rs984985479 1338 dbSNP
rs556787824 1343 dbSNP
rs759536456 1354 dbSNP
rs1376310495 1355 dbSNP
rs1332612589 1366 dbSNP
rs1445074517 1370 dbSNP
rs1218319159 1371 dbSNP
rs1348649090 1374 dbSNP
rs1323240127 1375 dbSNP
rs1406340678 1379 dbSNP
rs143593587 1384 dbSNP
rs1386667260 1396 dbSNP
rs373433267 1400 dbSNP
rs1156501160 1420 dbSNP
rs767869843 1421 dbSNP
rs970529590 1428 dbSNP
rs1438519800 1454 dbSNP
rs1263509695 1456 dbSNP
rs1485160032 1457 dbSNP
rs1017756864 1458 dbSNP
rs964976173 1463 dbSNP
rs976290530 1468 dbSNP
rs1487428302 1483 dbSNP
rs561157807 1499 dbSNP
rs1221971374 1500 dbSNP
rs1238712123 1502 dbSNP
rs1294187531 1504 dbSNP
rs1473044800 1505 dbSNP
rs923271333 1508 dbSNP
rs1214790793 1509 dbSNP
rs773598694 1514 dbSNP
rs1157991420 1524 dbSNP
rs1353070134 1527 dbSNP
rs923810515 1530 dbSNP
rs772090638 1549 dbSNP
rs1225549697 1551 dbSNP
rs1405503610 1557 dbSNP
rs1421338563 1564 dbSNP
rs151019751 1565 dbSNP
rs866024665 1566 dbSNP
rs1159440340 1575 dbSNP
rs55734286 1578 dbSNP
rs1274808384 1585 dbSNP
rs1437592919 1588 dbSNP
rs140822829 1589 dbSNP
rs1413183824 1591 dbSNP
rs1418784407 1591 dbSNP
rs1360775924 1595 dbSNP
rs989213283 1599 dbSNP
rs911145897 1603 dbSNP
rs1341215498 1608 dbSNP
rs146042542 1611 dbSNP
rs947447830 1612 dbSNP
rs1191745204 1635 dbSNP
rs943344524 1642 dbSNP
rs1278348703 1649 dbSNP
rs564564298 1649 dbSNP
rs1260843364 1671 dbSNP
rs531702164 1673 dbSNP
rs760202896 1685 dbSNP
rs904996796 1692 dbSNP
rs901906639 1698 dbSNP
rs937938980 1700 dbSNP
rs1056342478 1710 dbSNP
rs997639511 1720 dbSNP
rs1310559809 1727 dbSNP
rs200201116 1734 dbSNP
rs543556574 1735 dbSNP
rs1047836258 1739 dbSNP
rs887547906 1756 dbSNP
rs1346628622 1757 dbSNP
rs886644068 1762 dbSNP
rs561522527 1764 dbSNP
rs1016488683 1775 dbSNP
rs1257651019 1793 dbSNP
rs1017787863 1794 dbSNP
rs185716192 1798 dbSNP
rs1176695034 1802 dbSNP
rs376461193 1817 dbSNP
rs1421403826 1818 dbSNP
rs964838282 1819 dbSNP
rs1478043812 1820 dbSNP
rs1231144277 1822 dbSNP
rs1024674317 1827 dbSNP
rs1188558311 1832 dbSNP
rs1482309854 1837 dbSNP
rs1441499034 1849 dbSNP
rs970878124 1855 dbSNP
rs1394256901 1857 dbSNP
rs1326206188 1870 dbSNP
rs977908015 1876 dbSNP
rs1218367237 1877 dbSNP
rs1297255321 1887 dbSNP
rs923696187 1887 dbSNP
rs1393991663 1889 dbSNP
rs1377990539 1891 dbSNP
rs1302858295 1900 dbSNP
rs1454137121 1914 dbSNP
rs957835317 1915 dbSNP
rs1169924851 1917 dbSNP
rs1465926594 1923 dbSNP
rs1374641071 1934 dbSNP
rs989287939 1936 dbSNP
rs911113161 1950 dbSNP
rs1433089310 1953 dbSNP
rs763687270 1975 dbSNP
rs997675596 1981 dbSNP
rs1462739447 1999 dbSNP
rs111680620 2000 dbSNP
rs865938142 2026 dbSNP
rs755905293 2039 dbSNP
rs1481159691 2061 dbSNP
rs1253376761 2073 dbSNP
rs1243082250 2093 dbSNP
rs988843123 2097 dbSNP
rs373798478 2098 dbSNP
rs1374080165 2102 dbSNP
rs565854900 2104 dbSNP
rs532890660 2105 dbSNP
rs1447511595 2108 dbSNP
rs367557504 2109 dbSNP
rs1398555608 2112 dbSNP
rs551102216 2113 dbSNP
rs1047765889 2118 dbSNP
rs1368077912 2121 dbSNP
rs1164498603 2123 dbSNP
rs1448182003 2124 dbSNP
rs1378613844 2127 dbSNP
rs927374703 2128 dbSNP
rs1420140086 2133 dbSNP
rs1253311028 2142 dbSNP
rs937886431 2143 dbSNP
rs569676185 2157 dbSNP
rs536746196 2158 dbSNP
rs1307812097 2166 dbSNP
rs929185034 2167 dbSNP
rs1257441542 2180 dbSNP
rs1012536504 2181 dbSNP
rs1047408323 2181 dbSNP
rs1391252811 2184 dbSNP
rs1303973819 2185 dbSNP
rs1426705971 2188 dbSNP
rs887401258 2196 dbSNP
rs1025059256 2198 dbSNP
rs1005981983 2199 dbSNP
rs1030680689 2202 dbSNP
rs1432953843 2202 dbSNP
rs1270133883 2208 dbSNP
rs1202048112 2210 dbSNP
rs1487071501 2213 dbSNP
rs1284897910 2221 dbSNP
rs1038834445 2232 dbSNP
rs1270291088 2235 dbSNP
rs900247695 2240 dbSNP
rs1458985882 2249 dbSNP
rs1254155122 2259 dbSNP
rs780099478 2260 dbSNP
rs189049586 2270 dbSNP
rs1452401707 2276 dbSNP
rs559651941 2281 dbSNP
rs192960709 2283 dbSNP
rs1030889646 2289 dbSNP
rs956336830 2293 dbSNP
rs1338656311 2296 dbSNP
rs536072263 2298 dbSNP
rs989253714 2315 dbSNP
rs1378386345 2326 dbSNP
rs1401335963 2344 dbSNP
rs765687013 2346 dbSNP
rs1021637108 2348 dbSNP
rs1475222755 2349 dbSNP
rs1166171354 2358 dbSNP
rs750705367 2368 dbSNP
rs968725906 2382 dbSNP
rs1430628466 2394 dbSNP
rs1178975357 2399 dbSNP
rs980070415 2402 dbSNP
rs1193520250 2406 dbSNP
rs1448214343 2410 dbSNP
rs927406042 2412 dbSNP
rs1199397971 2414 dbSNP
rs960102027 2423 dbSNP
rs992018726 2424 dbSNP
rs1324120768 2428 dbSNP
rs1325887272 2429 dbSNP
rs1392709925 2431 dbSNP
rs917719379 2442 dbSNP
rs983462647 2444 dbSNP
rs1269812903 2447 dbSNP
rs1431835781 2449 dbSNP
rs1388927257 2450 dbSNP
rs1328431406 2455 dbSNP
rs1302447031 2460 dbSNP
rs929241539 2461 dbSNP
rs1048070823 2465 dbSNP
rs1407429971 2492 dbSNP
rs1339319371 2493 dbSNP
rs1226247508 2495 dbSNP
rs1423429879 2499 dbSNP
rs1275754489 2503 dbSNP
rs909119494 2511 dbSNP
rs1476154648 2515 dbSNP
rs907942575 2521 dbSNP
rs1186171627 2527 dbSNP
rs942123307 2530 dbSNP
rs532384403 2538 dbSNP
rs941713744 2539 dbSNP
rs1038698664 2546 dbSNP
rs1467111138 2549 dbSNP
rs900268675 2551 dbSNP
rs1341678486 2552 dbSNP
rs948223936 2552 dbSNP
rs1211365886 2553 dbSNP
rs1046610079 2555 dbSNP
rs1267810385 2559 dbSNP
rs758936560 2564 dbSNP
rs1051942331 2565 dbSNP
rs1339254959 2572 dbSNP
rs1445307014 2575 dbSNP
rs891926476 2594 dbSNP
rs780474653 2595 dbSNP
rs1412025132 2597 dbSNP
rs1388090795 2600 dbSNP
rs554477524 2605 dbSNP
rs1022334801 2607 dbSNP
rs185343380 2612 dbSNP
rs1386627889 2614 dbSNP
rs1478217277 2615 dbSNP
rs4419680 2637 dbSNP
rs904766207 2643 dbSNP
rs1416276023 2653 dbSNP
rs1001518512 2654 dbSNP
rs1030647955 2657 dbSNP
rs893543448 2658 dbSNP
rs1459916750 2663 dbSNP
rs1449697208 2677 dbSNP
rs1133802 2680 dbSNP
rs1034283508 2681 dbSNP
rs188954891 2682 dbSNP
rs1360257310 2685 dbSNP
rs557862864 2692 dbSNP
rs1010644898 2693 dbSNP
rs960133137 2695 dbSNP
rs1238034250 2698 dbSNP
rs993281422 2705 dbSNP
rs1280610145 2715 dbSNP
rs754483839 2730 dbSNP
rs576410140 2733 dbSNP
rs1302152148 2735 dbSNP
rs1341807804 2741 dbSNP
rs1218672943 2746 dbSNP
rs1156358171 2748 dbSNP
rs1399582000 2749 dbSNP
rs528680538 2750 dbSNP
rs543493577 2751 dbSNP
rs143065191 2752 dbSNP
rs1319797982 2753 dbSNP
rs111887732 2754 dbSNP
rs1476924563 2754 dbSNP
rs201177667 2754 dbSNP
rs1246901980 2755 dbSNP
rs1285593929 2765 dbSNP
rs1265804430 2766 dbSNP
rs1349756540 2767 dbSNP
rs1214693457 2768 dbSNP
rs1265666169 2769 dbSNP
rs1283108729 2770 dbSNP
rs573247570 2774 dbSNP
rs1347051510 2793 dbSNP
rs1187248355 2796 dbSNP
rs1429438741 2805 dbSNP
rs778574630 2807 dbSNP
rs1345203708 2810 dbSNP
rs1255506902 2815 dbSNP
rs1236378516 2816 dbSNP
rs1242843049 2816 dbSNP
rs1428497293 2816 dbSNP
rs201959218 2816 dbSNP
rs1426072822 2817 dbSNP
rs1218022887 2824 dbSNP
rs1311007072 2827 dbSNP
rs1263029401 2831 dbSNP
rs951392766 2831 dbSNP
rs1213553723 2833 dbSNP
rs1326036011 2833 dbSNP
rs983439669 2833 dbSNP
rs573470420 2844 dbSNP
rs992841350 2846 dbSNP
rs1290173185 2847 dbSNP
rs1160859218 2851 dbSNP
rs1445137496 2851 dbSNP
rs1362014191 2853 dbSNP
rs1400244452 2854 dbSNP
rs1311677825 2863 dbSNP
rs1337259106 2863 dbSNP
rs1376420693 2865 dbSNP
rs370688518 2871 dbSNP
rs942093794 2881 dbSNP
rs983300912 2889 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 57492.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' agUGGUAACGAUUUCACGUUAa 5'
            | :|||  ||  ||||||| 
Target 5' auAAUAUUUAUACUGUGCAAUg 3'
2 - 23
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 57492.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' agugguaacgauuuCACGUUAa 5'
                        ||||||| 
Target 5' ------------cuGUGCAAUg 3'
1 - 10
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 57492.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000346085.5 | 3UTR | UAUAAUAUUUAUACUGUGCAAUGUUAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000346085.5 | 3UTR | CUGUGCAAUGUUAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000346085.5 | 3UTR | CUGUGCAAUGUUAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000346085.5 | 3UTR | AUAAUAUUUAUACUGUGCAAUGUUAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla 0.646 8.5e-3 0.647 8.4e-3 13 Click to see details
GSE14794 Lymphoblastoid cells 0.243 1.1e-2 0.150 7.9e-2 90 Click to see details
GSE28544 Breast cancer 0.443 1.5e-2 0.541 3.2e-3 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.389 4.5e-2 -0.235 1.6e-1 20 Click to see details
GSE32688 Pancreatic cancer -0.262 7.4e-2 -0.163 1.9e-1 32 Click to see details
GSE38226 Liver fibrosis 0.214 1.8e-1 0.133 2.8e-1 21 Click to see details
GSE27834 Pluripotent stem cells 0.225 2.0e-1 0.015 4.8e-1 16 Click to see details
GSE26953 Aortic valvular endothelial cells 0.163 2.2e-1 0.175 2.1e-1 24 Click to see details
GSE21849 B cell lymphoma 0.131 2.5e-1 0.164 2.0e-1 29 Click to see details
GSE17306 Multiple myeloma -0.081 2.9e-1 0.325 1.1e-2 49 Click to see details
GSE19350 CNS germ cell tumors 0.15 3.2e-1 0.175 2.9e-1 12 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.063 3.8e-1 0.000 5.0e-1 25 Click to see details
GSE21687 Ependynoma primary tumors 0.013 4.6e-1 0.018 4.4e-1 64 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.009 4.9e-1 -0.100 4.4e-1 5 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.009 4.9e-1 -0.100 4.4e-1 5 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
255 hsa-miR-367-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055315 DUSP5 dual specificity phosphatase 5 2 8
MIRT055791 PLEKHA1 pleckstrin homology domain containing A1 2 12
MIRT057114 DDIT4 DNA damage inducible transcript 4 2 4
MIRT059663 GATAD2B GATA zinc finger domain containing 2B 2 2
MIRT059926 ZDHHC5 zinc finger DHHC-type containing 5 2 2
MIRT061610 BTG2 BTG anti-proliferation factor 2 2 6
MIRT066478 HMGA2 high mobility group AT-hook 2 2 2
MIRT069388 ZFYVE21 zinc finger FYVE-type containing 21 2 2
MIRT069972 GEMIN2 gem nuclear organelle associated protein 2 2 2
MIRT074764 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 2 2
MIRT076199 GID4 GID complex subunit 4 homolog 2 6
MIRT077512 UBE2Z ubiquitin conjugating enzyme E2 Z 2 4
MIRT077903 TOB1 transducer of ERBB2, 1 2 6
MIRT082250 MED29 mediator complex subunit 29 2 4
MIRT082434 CIC capicua transcriptional repressor 2 6
MIRT082474 PPP1R37 protein phosphatase 1 regulatory subunit 37 2 2
MIRT082778 ZNF264 zinc finger protein 264 2 2
MIRT084533 BCL2L11 BCL2 like 11 2 8
MIRT085309 UBXN4 UBX domain protein 4 2 8
MIRT086365 SSFA2 sperm specific antigen 2 2 8
MIRT087455 NF2 neurofibromin 2 2 2
MIRT088865 FOXN2 forkhead box N2 2 12
MIRT092185 ITPR1 inositol 1,4,5-trisphosphate receptor type 1 2 6
MIRT092326 EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 2 6
MIRT093533 GALNT7 polypeptide N-acetylgalactosaminyltransferase 7 2 6
MIRT096935 PAPD7 poly(A) RNA polymerase D7, non-canonical 2 8
MIRT097026 MAP1B microtubule associated protein 1B 2 4
MIRT099137 MYLIP myosin regulatory light chain interacting protein 2 6
MIRT099905 SOX4 SRY-box 4 2 12
MIRT102289 DNAJB9 DnaJ heat shock protein family (Hsp40) member B9 2 10
MIRT102507 KLHDC10 kelch domain containing 10 2 2
MIRT102891 INSIG1 insulin induced gene 1 2 2
MIRT109188 VMA21 VMA21, vacuolar ATPase assembly factor 2 4
MIRT124567 PRRC2B proline rich coiled-coil 2B 2 2
MIRT135568 SPRYD4 SPRY domain containing 4 2 2
MIRT161135 SLC25A36 solute carrier family 25 member 36 2 6
MIRT163995 KIAA1109 KIAA1109 2 4
MIRT164689 RNF4 ring finger protein 4 2 2
MIRT167705 HIVEP1 human immunodeficiency virus type I enhancer binding protein 1 2 8
MIRT178956 USP28 ubiquitin specific peptidase 28 2 2
MIRT185717 ARNTL2 aryl hydrocarbon receptor nuclear translocator like 2 2 2
MIRT186264 TCEB3 elongin A 2 2
MIRT186537 TWF1 twinfilin actin binding protein 1 2 4
MIRT186628 COX20 COX20, cytochrome c oxidase assembly factor 2 8
MIRT189373 TXLNA taxilin alpha 2 4
MIRT197013 EIF1 eukaryotic translation initiation factor 1 2 10
MIRT206437 YIPF4 Yip1 domain family member 4 2 2
MIRT211228 FGF2 fibroblast growth factor 2 2 10
MIRT214529 C5ORF24 chromosome 5 open reading frame 24 2 2
MIRT216034 IL6ST interleukin 6 signal transducer 2 10
MIRT218084 TULP4 tubby like protein 4 2 2
MIRT242418 CCDC113 coiled-coil domain containing 113 2 2
MIRT243162 SOX11 SRY-box 11 2 2
MIRT250943 CDK5R1 cyclin dependent kinase 5 regulatory subunit 1 2 4
MIRT253350 ZNF417 zinc finger protein 417 2 2
MIRT271968 ARF1 ADP ribosylation factor 1 2 2
MIRT273214 ZNF695 zinc finger protein 695 2 4
MIRT296114 SLC12A5 solute carrier family 12 member 5 2 2
MIRT301711 TEF TEF, PAR bZIP transcription factor 2 2
MIRT316477 ARID1B AT-rich interaction domain 1B 2 6
MIRT322174 CLN8 CLN8, transmembrane ER and ERGIC protein 2 4
MIRT341538 CNIH1 cornichon family AMPA receptor auxiliary protein 1 2 6
MIRT356062 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 2 2
MIRT443579 PPIC peptidylprolyl isomerase C 2 2
MIRT448825 FKBP1A FK506 binding protein 1A 2 4
MIRT451494 FOPNL FGFR1OP N-terminal like 2 2
MIRT452694 MDM2 MDM2 proto-oncogene 2 2
MIRT453167 CNOT4 CCR4-NOT transcription complex subunit 4 2 6
MIRT454588 SLC33A1 solute carrier family 33 member 1 2 4
MIRT455794 TAF8 TATA-box binding protein associated factor 8 2 4
MIRT456010 CYP2C19 cytochrome P450 family 2 subfamily C member 19 2 2
MIRT456044 KIAA1586 KIAA1586 2 2
MIRT456763 TMEM239 transmembrane protein 239 2 4
MIRT458068 NLRP9 NLR family pyrin domain containing 9 2 2
MIRT459230 MRPS21 mitochondrial ribosomal protein S21 2 2
MIRT459534 MFF mitochondrial fission factor 2 6
MIRT459759 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 2 2
MIRT460236 TNFRSF13C TNF receptor superfamily member 13C 2 2
MIRT461104 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT462924 ZNRF3 zinc and ring finger 3 2 2
MIRT463476 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT463516 ZBTB8B zinc finger and BTB domain containing 8B 2 4
MIRT465503 TOR1B torsin family 1 member B 2 2
MIRT469525 RBFOX2 RNA binding protein, fox-1 homolog 2 2 8
MIRT470079 PTGES2 prostaglandin E synthase 2 2 2
MIRT471581 PARD6B par-6 family cell polarity regulator beta 2 2
MIRT473451 MCOLN2 mucolipin 2 2 8
MIRT475882 H3F3C H3 histone family member 3C 2 10
MIRT475915 H3F3B H3 histone family member 3B 2 8
MIRT476195 GOLGA8A golgin A8 family member A 2 10
MIRT476318 GM2A GM2 ganglioside activator 2 2
MIRT476676 FUT11 fucosyltransferase 11 2 10
MIRT478368 DDI2 DNA damage inducible 1 homolog 2 2 2
MIRT479545 CDC5L cell division cycle 5 like 2 2
MIRT481024 BAZ2B bromodomain adjacent to zinc finger domain 2B 2 2
MIRT491009 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT493168 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 2
MIRT494345 CASKIN1 CASK interacting protein 1 2 2
MIRT499087 ZDHHC21 zinc finger DHHC-type containing 21 2 6
MIRT500029 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501298 RRN3 RRN3 homolog, RNA polymerase I transcription factor 2 4
MIRT503124 BCL11B B-cell CLL/lymphoma 11B 2 8
MIRT503301 GTF2A1 general transcription factor IIA subunit 1 2 6
MIRT504328 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT504471 EID2B EP300 interacting inhibitor of differentiation 2B 2 2
MIRT504655 RPL9 ribosomal protein L9 2 6
MIRT505331 TMF1 TATA element modulatory factor 1 2 8
MIRT505732 SERTAD3 SERTA domain containing 3 2 4
MIRT505827 RSBN1 round spermatid basic protein 1 2 8
MIRT506004 PURG purine rich element binding protein G 2 8
MIRT506308 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 2 6
MIRT506806 KLHL15 kelch like family member 15 2 6
MIRT507119 GOLGA8B golgin A8 family member B 2 6
MIRT507353 FAM129A family with sequence similarity 129 member A 2 6
MIRT507591 DDX3X DEAD-box helicase 3, X-linked 2 4
MIRT507674 CPEB4 cytoplasmic polyadenylation element binding protein 4 2 4
MIRT507703 CNOT2 CCR4-NOT transcription complex subunit 2 2 8
MIRT508012 BCAT1 branched chain amino acid transaminase 1 2 4
MIRT510439 ZIC5 Zic family member 5 2 6
MIRT510539 XKR7 XK related 7 2 4
MIRT510600 TPPP tubulin polymerization promoting protein 2 6
MIRT511060 NRAS NRAS proto-oncogene, GTPase 2 4
MIRT511855 GOLGA8J golgin A8 family member J 2 6
MIRT511865 GOLGA8I golgin A8 family member I, pseudogene 1 3
MIRT512570 CTDSPL CTD small phosphatase like 2 2
MIRT512708 ZNF134 zinc finger protein 134 2 6
MIRT513177 MOAP1 modulator of apoptosis 1 2 6
MIRT513783 PAWR pro-apoptotic WT1 regulator 2 6
MIRT515099 IRGQ immunity related GTPase Q 2 2
MIRT515481 INCENP inner centromere protein 2 4
MIRT517416 BMP8A bone morphogenetic protein 8a 2 2
MIRT518754 C1orf35 chromosome 1 open reading frame 35 2 2
MIRT519780 ZNF354B zinc finger protein 354B 2 4
MIRT519865 ZFP62 ZFP62 zinc finger protein 2 6
MIRT520510 TRAM2 translocation associated membrane protein 2 2 6
MIRT521068 SLC25A32 solute carrier family 25 member 32 2 6
MIRT526912 ZNF772 zinc finger protein 772 2 6
MIRT527134 GULP1 GULP, engulfment adaptor PTB domain containing 1 2 2
MIRT527867 SLC39A14 solute carrier family 39 member 14 2 2
MIRT528404 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 2 2
MIRT532956 ZNF24 zinc finger protein 24 2 4
MIRT533021 ZFC3H1 zinc finger C3H1-type containing 2 4
MIRT533191 WASL Wiskott-Aldrich syndrome like 2 6
MIRT534191 SLC7A11 solute carrier family 7 member 11 2 2
MIRT534961 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 2 4
MIRT536396 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT537046 GRAMD4 GRAM domain containing 4 2 2
MIRT537125 GOLGA3 golgin A3 2 4
MIRT537183 GFPT2 glutamine-fructose-6-phosphate transaminase 2 2 4
MIRT537652 ERGIC2 ERGIC and golgi 2 2 4
MIRT538632 CCSER2 coiled-coil serine rich protein 2 2 4
MIRT539231 ANP32E acidic nuclear phosphoprotein 32 family member E 2 6
MIRT540099 NPY4R neuropeptide Y receptor Y4 2 2
MIRT540998 ZNF460 zinc finger protein 460 2 4
MIRT541468 AURKA aurora kinase A 2 2
MIRT542680 SESN3 sestrin 3 2 2
MIRT542757 PRRG4 proline rich and Gla domain 4 2 2
MIRT542863 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 2
MIRT542925 HOXC8 homeobox C8 2 2
MIRT543747 SZRD1 SUZ RNA binding domain containing 1 2 2
MIRT544404 ZSCAN12 zinc finger and SCAN domain containing 12 2 2
MIRT544583 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT544662 MED19 mediator complex subunit 19 2 2
MIRT545251 GTF2E1 general transcription factor IIE subunit 1 2 2
MIRT545261 TRIM36 tripartite motif containing 36 2 4
MIRT545744 UHRF1BP1 UHRF1 binding protein 1 2 2
MIRT545999 WDR81 WD repeat domain 81 2 2
MIRT546038 VPS4B vacuolar protein sorting 4 homolog B 2 2
MIRT547170 PDZD8 PDZ domain containing 8 2 2
MIRT547273 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT547729 KIF5B kinesin family member 5B 2 2
MIRT548127 GATA6 GATA binding protein 6 2 2
MIRT548203 FNIP1 folliculin interacting protein 1 2 2
MIRT548756 CNNM4 cyclin and CBS domain divalent metal cation transport mediator 4 2 2
MIRT549641 ZNF75A zinc finger protein 75a 2 2
MIRT549684 ZNF598 zinc finger protein 598 2 2
MIRT550197 MRO maestro 2 2
MIRT550340 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT550536 MYZAP myocardial zonula adherens protein 2 2
MIRT550975 TOR4A torsin family 4 member A 2 2
MIRT551221 CIDEC cell death inducing DFFA like effector c 2 2
MIRT551355 AGBL5 ATP/GTP binding protein like 5 2 2
MIRT551571 LETM1 leucine zipper and EF-hand containing transmembrane protein 1 2 2
MIRT552277 RAB3D RAB3D, member RAS oncogene family 2 2
MIRT552661 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 2 2
MIRT553081 UCK2 uridine-cytidine kinase 2 2 2
MIRT553753 TBC1D8 TBC1 domain family member 8 2 2
MIRT554030 SPCS3 signal peptidase complex subunit 3 2 2
MIRT554099 SMU1 DNA replication regulator and spliceosomal factor 2 2
MIRT554155 SLX4 SLX4 structure-specific endonuclease subunit 2 2
MIRT554815 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT555522 PMEPA1 prostate transmembrane protein, androgen induced 1 2 2
MIRT555597 PIP5K1C phosphatidylinositol-4-phosphate 5-kinase type 1 gamma 2 2
MIRT555632 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 4
MIRT555679 PGAM4 phosphoglycerate mutase family member 4 2 4
MIRT555827 PAX9 paired box 9 2 2
MIRT555868 PAIP1 poly(A) binding protein interacting protein 1 2 2
MIRT555939 NUP43 nucleoporin 43 2 2
MIRT555994 NFYB nuclear transcription factor Y subunit beta 2 2
MIRT556340 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT556432 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT556585 LHFPL2 LHFPL tetraspan subfamily member 2 2 4
MIRT556801 KIAA1958 KIAA1958 2 2
MIRT558047 EXOC5 exocyst complex component 5 2 2
MIRT558697 CLTA clathrin light chain A 2 2
MIRT559191 BMPR1A bone morphogenetic protein receptor type 1A 2 4
MIRT559639 AKAP10 A-kinase anchoring protein 10 2 2
MIRT559707 AEN apoptosis enhancing nuclease 2 2
MIRT560673 SRFBP1 serum response factor binding protein 1 2 2
MIRT560990 GPBP1L1 GC-rich promoter binding protein 1 like 1 2 2
MIRT562170 HOXA13 homeobox A13 2 2
MIRT562275 GNAQ G protein subunit alpha q 2 2
MIRT563624 ZNF277 zinc finger protein 277 2 2
MIRT563815 FMN1 formin 1 2 2
MIRT564096 TLR3 toll like receptor 3 2 2
MIRT565320 TMEM41A transmembrane protein 41A 2 2
MIRT565986 RNF44 ring finger protein 44 2 2
MIRT566047 REV3L REV3 like, DNA directed polymerase zeta catalytic subunit 2 2
MIRT568236 C11orf24 chromosome 11 open reading frame 24 2 2
MIRT568310 BAK1 BCL2 antagonist/killer 1 2 2
MIRT572376 ATOX1 antioxidant 1 copper chaperone 2 2
MIRT574822 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 2
MIRT609212 PELP1 proline, glutamate and leucine rich protein 1 2 2
MIRT616217 RBM27 RNA binding motif protein 27 2 2
MIRT629087 FASLG Fas ligand 2 2
MIRT632124 FKBP9 FK506 binding protein 9 2 2
MIRT632576 POLQ DNA polymerase theta 2 2
MIRT634799 ENTHD1 ENTH domain containing 1 2 2
MIRT636553 ESRP1 epithelial splicing regulatory protein 1 2 2
MIRT640977 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT653875 SH2B3 SH2B adaptor protein 3 2 2
MIRT655598 OTUD7B OTU deubiquitinase 7B 2 2
MIRT659764 CCDC171 coiled-coil domain containing 171 2 2
MIRT660744 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT681037 AAED1 AhpC/TSA antioxidant enzyme domain containing 1 2 2
MIRT682305 RBM28 RNA binding motif protein 28 2 2
MIRT682573 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 2 2
MIRT686217 ZNF267 zinc finger protein 267 2 2
MIRT687209 PLXNA3 plexin A3 2 2
MIRT690630 LAX1 lymphocyte transmembrane adaptor 1 2 2
MIRT692419 AGMAT agmatinase 2 2
MIRT694437 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 2 2
MIRT700725 PNO1 partner of NOB1 homolog 2 2
MIRT701549 NARF nuclear prelamin A recognition factor 2 2
MIRT704379 DAND5 DAN domain BMP antagonist family member 5 2 2
MIRT707935 PPP1R3D protein phosphatase 1 regulatory subunit 3D 2 2
MIRT709939 MRPS16 mitochondrial ribosomal protein S16 2 2
MIRT711371 MED7 mediator complex subunit 7 2 2
MIRT712327 PER2 period circadian clock 2 2 2
MIRT714515 SHE Src homology 2 domain containing E 2 2
MIRT715520 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 2 2
MIRT724294 OSMR oncostatin M receptor 2 2
MIRT725358 MUC21 mucin 21, cell surface associated 2 2
MIRT732242 KLF4 Kruppel like factor 4 3 1
MIRT735384 SPAG5 sperm associated antigen 5 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-367 Medpor NULL NULL Microarray osteoblast-like cells line (MG-63) 18408260 2008 up-regulated
miR-367 Activin A NULL 229455 Quantitative real-time PCR Human embryonic stem (hES) cells 19885849 2010 up-regulated
miR-367 Mistletoe lectin-I NULL NULL Microarray colorectal cancer cells CLY cells 20955366 2011 down-regulated
miR-367 Doxorubicin approved 31703 Quantitative real-time PCR heart 22859947 2012 up-regulated
miR-367 Paclitaxel approved 36314 Microarray Ovarian cancer cell lines 24220856 2014 up-regulated
miR-367 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-367 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-367-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-367-3p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-367-3p Siop Treatment Protocol sensitive High Nephroblastoma tissue
hsa-miR-367-3p Paclitaxel 36314 NSC125973 approved resistant High Pan-Cancer cell line (NCI-H460, NCI-H522, NCI-H322M, HOP62, A549, EKVX, MALME-3M, NCI-H226, HT-29, HCT-116, SE-620, HCT-15, HCC2998, COLO205, HS-578T, NCI/ADR-RES, OVCAR8, OVCAR4, ACHN, SN-12C, 786-O, CAKI-1, UO-31, TK-10, A498, SK-MEL-28, UACC-257, M14, UACC-62, SK
hsa-miR-367-3p Doxorubicin 31703 NSC123127 approved sensitive High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-367-3p Mitoxantrone 4212 NSC279836 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-367-3p Sorafenib 216239 NSC747971 approved sensitive Low Hepatocellular Carcinoma cell line (SKhep1, HA22T)
hsa-miR-367-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-367-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-367-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM36)
hsa-miR-367-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-367-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-367-3p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-367-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission