miRTarBase - #MIRT316766


—
pre-miRNA Information
pre-miRNA hsa-mir-605   
Genomic Coordinates chr10: 51299573 - 51299655
Synonyms MIRN605, hsa-mir-605, MIR605
Description Homo sapiens miR-605 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-605-3p
Sequence 51| AGAAGGCACUAUGAGAUUUAGA |72
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 10 + 51299626 27587585, 28550310, 26028588, 26449202, 26487287, 29165639 MiREDiBase
A-to-I 14 10 + 51299636 29233923 MiREDiBase
A-to-I 20 10 + 51299642 18684997, 26449202, 27587585, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs759219082 5 dbSNP
rs1491224174 9 dbSNP
rs746611214 10 dbSNP
rs367648737 11 dbSNP
rs1359467239 14 dbSNP
rs1442565019 16 dbSNP
Putative Targets

Gene Information
Gene Symbol FOXC1   
Synonyms ARA, ASGD3, FKHL7, FREAC-3, FREAC3, IGDA, IHG1, IRID1, RIEG3
Description forkhead box C1
Transcript NM_001453   
Expression
Putative miRNA Targets on FOXC1
3'UTR of FOXC1
(miRNA target sites are highlighted)		 
>FOXC1|NM_001453|3'UTR
   1 CACACCCTCAAAGCCGAACTAAATCGAACCCCAAAGCAGGAAAAGCTAAAGGAACCCATCAAGGCAAAATCGAAACTAAA
  81 AAAAAAAAATCCAATTAAAAAAAACCCCTGAGAATATTCACCACACCAGCGAACAGAATATCCCTCCAAAAATTCAGCTC
 161 ACCAGCACCAGCACGAAGAAAACTCTATTTTCTTAACCGATTAATTCAGAGCCACCTCCACTTTGCCTTGTCTAAATAAA
 241 CAAACCCGTAAACTGTTTTATACAGAGACAGCAAAATCTTGGTTTATTAAAGGACAGTGTTACTCCAGATAACACGTAAG
 321 TTTCTTCTTGCTTTTCAGAGACCTGCTTTCCCCTCCTCCCGTCTCCCCTCTCTTGCCTTCTTCCTTGCCTCTCACCTGTA
 401 AGATATTATTTTATCCTATGTTGAAGGGAGGGGGAAAGTCCCCGTTTATGAAAGTCGCTTTCTTTTTATTCATGGACTTG
 481 TTTTAAAATGTAAATTGCAACATAGTAATTTATTTTTAATTTGTAGTTGGATGTCGTGGACCAAACGCCAGAAAGTGTTC
 561 CCAAAACCTGACGTTAAATTGCCTGAAACTTTAAATTGTGCTTTTTTTCTCATTATAAAAAGGGAAACTGTATTAATCTT
 641 ATTCTATCCTCTTTTCTTTCTTTTTGTTGAACATATTCATTGTTTGTTTATTAATAAATTACCATTCAGTTTGAATGAGA
 721 CCTATATGTCTGGATACTTTAATAGAGCTTTAATTATTACGAAAAAAGATTTCAGAGATAAAACACTAGAAGTTACCTAT
 801 TCTCCACCTAAATCTCTGAAAAATGGAGAAACCCTCTGACTAGTCCATGTCAAATTTTACTAAAAGTCTTTTTGTTTAGA
 881 TTTATTTTCCTGCAGCATCTTCTGCAAAATGTACTATATAGTCAGCTTGCTTTGAGGCTAGTAAAAAGATATTTTTCTAA
 961 ACAGATTGGAGTTGGCATATAAACAAATACGTTTTCTCACTAATGACAGTCCATGATTCGGAAATTTTAAGCCCATGAAT
1041 CAGCCGCGGTCTTACCACGGTGATGCCTGTGTGCCGAGAGATGGGACTGTGCGGCCAGATATGCACAGATAAATATTTGG
1121 CTTGTGTATTCCATATAAAATTGCAGTGCATATTATACATCCCTGTGAGCCAGATGCTGAATAGATATTTTCCTATTATT
1201 TCAGTCCTTTATAAAAGGAAAAATAAACCAGTTTTTAAATGTATGTATATAATTCTCCCCCATTTACAATCCTTCATGTA
1281 TTACATAGAAGGATTGCTTTTTTAAAAATATACTGCGGGTTGGAAAGGGATATTTAATCTTTGAGAAACTATTTTAGAAA
1361 ATATGTTTGTAGAACAATTATTTTTGAAAAAGATTTAAAGCAATAACAAGAAGGAAGGCGAGAGGAGCAGAACATTTTGG
1441 TCTAGGGTGGTTTCTTTTTAAACCATTTTTTCTTGTTAATTTACAGTTAAACCTAGGGGACAATCCGGATTGGCCCTCCC
1521 CCTTTTGTAAATAACCCAGGAAATGTAATAAATTCATTATCTTAGGGTGATCTGCCCTGCCAATCAGACTTTGGGGAGAT
1601 GGCGATTTGATTACAGACGTTCGGGGGGGTGGGGGGCTTGCAGTTTGTTTTGGAGATAATACAGTTTCCTGCTATCTGCC
1681 GCTCCTATCTAGAGGCAACACTTAAGCAGTAATTGCTGTTGCTTGTTGTCAAAATTTGATCATTGTTAAAGGATTGCTGC
1761 AAATAAATACACTTTAATTTCAGTCAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agauuuAGAGUAUCACGGAAGa 5'
                |||| |  ||||||| 
Target 5' ctccccTCTC-T--TGCCTTCt 3'
 363 - 381 147.00 -13.10
2 
miRNA  3' agauuuAGAGUAUC---ACGGAAGa 5'
                |:||| ||   |||:||| 
Target 5' cttgctTTTCAGAGACCTGCTTTCc 3'
 327 - 351 140.00 -9.40
3 
miRNA  3' agAUUUAGAG---UAUCACGGAAGa 5'
            |:|| ||:   || ||||:||: 
Target 5' ccTGAAACTTTAAATTGTGCTTTTt 3'
 582 - 606 132.00 -11.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1181503 106 ClinVar
183249 735 ClinVar
COSN26976635 14 COSMIC
COSN19659403 27 COSMIC
COSN30454357 31 COSMIC
COSN15624097 68 COSMIC
COSN31600803 70 COSMIC
COSN20075525 72 COSMIC
COSN27220304 90 COSMIC
COSN30131523 93 COSMIC
COSN20045745 105 COSMIC
COSN31588248 105 COSMIC
COSN8513643 172 COSMIC
COSN28770477 188 COSMIC
COSN31547489 221 COSMIC
COSN30135019 268 COSMIC
COSN30401750 279 COSMIC
COSN31517901 279 COSMIC
COSN30141708 294 COSMIC
COSN31540894 309 COSMIC
COSN30533227 345 COSMIC
COSN7697022 381 COSMIC
COSN16361054 442 COSMIC
COSN21702469 481 COSMIC
COSN30114578 494 COSMIC
COSN15968548 573 COSMIC
COSN32110299 586 COSMIC
COSN30130629 746 COSMIC
COSN30135020 762 COSMIC
COSN27213216 784 COSMIC
COSN30129855 806 COSMIC
COSN30127769 822 COSMIC
COSN31593751 833 COSMIC
COSN21529772 837 COSMIC
COSN8513644 840 COSMIC
COSN26566061 844 COSMIC
COSN30113449 864 COSMIC
COSN9971943 991 COSMIC
COSN31563382 1002 COSMIC
COSN31515894 1048 COSMIC
COSN31538095 1094 COSMIC
COSN24301808 1096 COSMIC
COSN30529972 1120 COSMIC
COSN30141029 1128 COSMIC
COSN30129866 1164 COSMIC
COSN19659404 1204 COSMIC
COSN30142326 1252 COSMIC
COSN15624098 1256 COSMIC
COSN15624099 1258 COSMIC
COSN32191710 1276 COSMIC
COSN26555098 1279 COSMIC
COSN30113761 1292 COSMIC
COSN4857222 1304 COSMIC
COSN17153524 1345 COSMIC
COSN30534033 1450 COSMIC
COSN30128834 1475 COSMIC
COSN31543010 1543 COSMIC
COSN31592770 1559 COSMIC
COSN30510390 1574 COSMIC
COSN23868924 1580 COSMIC
COSN30144139 1600 COSMIC
COSN25630585 1601 COSMIC
COSN30143578 1613 COSMIC
COSN26602065 1623 COSMIC
COSN31579436 1630 COSMIC
COSN9499950 1631 COSMIC
COSN30126227 1704 COSMIC
COSN31609183 1747 COSMIC
rs2745599 1345 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1356049082 4 dbSNP
rs550008409 6 dbSNP
rs770747430 7 dbSNP
rs1309394453 8 dbSNP
rs774178122 11 dbSNP
rs1255629093 14 dbSNP
rs569615621 16 dbSNP
rs1395644292 19 dbSNP
rs776933515 19 dbSNP
rs762444077 20 dbSNP
rs1488149748 23 dbSNP
rs753828358 24 dbSNP
rs755098873 30 dbSNP
rs199666960 31 dbSNP
rs1429781292 32 dbSNP
rs758797660 33 dbSNP
rs766539992 35 dbSNP
rs370151681 36 dbSNP
rs1351404767 37 dbSNP
rs374620749 38 dbSNP
rs781401575 46 dbSNP
rs773884905 48 dbSNP
rs748021580 49 dbSNP
rs756124189 52 dbSNP
rs73406893 53 dbSNP
rs903258348 57 dbSNP
rs534974179 58 dbSNP
rs558074909 59 dbSNP
rs933362683 72 dbSNP
rs953785432 77 dbSNP
rs1285728011 78 dbSNP
rs1334614373 78 dbSNP
rs779316749 78 dbSNP
rs1171816932 79 dbSNP
rs1461296707 89 dbSNP
rs1415913194 94 dbSNP
rs1296786615 96 dbSNP
rs1232314245 97 dbSNP
rs1473261626 97 dbSNP
rs889256919 98 dbSNP
rs116336796 106 dbSNP
rs910042588 108 dbSNP
rs537216699 110 dbSNP
rs1284073173 111 dbSNP
rs1354347813 122 dbSNP
rs1349510047 124 dbSNP
rs1277263405 130 dbSNP
rs1225469218 131 dbSNP
rs1286810804 132 dbSNP
rs557556144 137 dbSNP
rs777444017 139 dbSNP
rs972991232 145 dbSNP
rs574031863 148 dbSNP
rs1214688132 158 dbSNP
rs1025952402 159 dbSNP
rs1407613742 160 dbSNP
rs1156876480 167 dbSNP
rs746626978 169 dbSNP
rs778482299 170 dbSNP
rs1260804568 176 dbSNP
rs1381038207 182 dbSNP
rs1443885886 183 dbSNP
rs1467096969 183 dbSNP
rs1045714544 188 dbSNP
rs1222117634 193 dbSNP
rs1446052631 195 dbSNP
rs1033531452 200 dbSNP
rs1236765850 204 dbSNP
rs959454603 216 dbSNP
rs543142683 219 dbSNP
rs1234127445 220 dbSNP
rs1369429649 221 dbSNP
rs374954433 226 dbSNP
rs1295644065 236 dbSNP
rs780414480 237 dbSNP
rs915154568 238 dbSNP
rs947423341 239 dbSNP
rs977398485 246 dbSNP
rs924585817 248 dbSNP
rs1361188087 249 dbSNP
rs1173100474 251 dbSNP
rs1452497344 258 dbSNP
rs933435061 264 dbSNP
rs1396876064 267 dbSNP
rs770525624 270 dbSNP
rs1474984667 273 dbSNP
rs368696215 279 dbSNP
rs943515912 288 dbSNP
rs1156410607 290 dbSNP
rs1278905567 297 dbSNP
rs573322518 298 dbSNP
rs1037993239 306 dbSNP
rs745354528 308 dbSNP
rs1304110537 310 dbSNP
rs62390613 310 dbSNP
rs1042305444 315 dbSNP
rs1047409599 316 dbSNP
rs1268804146 317 dbSNP
rs902445399 327 dbSNP
rs1026186793 328 dbSNP
rs1312337969 333 dbSNP
rs1339287626 337 dbSNP
rs997817850 338 dbSNP
rs1003323508 339 dbSNP
rs181633430 341 dbSNP
rs959272757 347 dbSNP
rs1477940854 351 dbSNP
rs1029337099 352 dbSNP
rs953877244 354 dbSNP
rs1022049158 359 dbSNP
rs774927159 362 dbSNP
rs977951060 369 dbSNP
rs924667152 372 dbSNP
rs1017118005 373 dbSNP
rs757677458 377 dbSNP
rs962887422 378 dbSNP
rs779102893 384 dbSNP
rs748674372 392 dbSNP
rs918803355 394 dbSNP
rs527848565 395 dbSNP
rs1200893619 398 dbSNP
rs971622442 399 dbSNP
rs1277635793 403 dbSNP
rs1341337414 403 dbSNP
rs1292950487 408 dbSNP
rs987612826 416 dbSNP
rs910619308 420 dbSNP
rs981696683 422 dbSNP
rs927291357 427 dbSNP
rs1352759512 428 dbSNP
rs1172538167 434 dbSNP
rs1465989492 440 dbSNP
rs1416672414 441 dbSNP
rs1238281094 450 dbSNP
rs1037877254 451 dbSNP
rs937369274 454 dbSNP
rs1256162161 461 dbSNP
rs533280855 472 dbSNP
rs914662049 482 dbSNP
rs547974202 486 dbSNP
rs1042253141 499 dbSNP
rs902393159 504 dbSNP
rs1400479244 509 dbSNP
rs1318993382 510 dbSNP
rs933894998 523 dbSNP
rs1231619002 525 dbSNP
rs1051035997 531 dbSNP
rs1323733501 533 dbSNP
rs1313521976 534 dbSNP
rs906222374 544 dbSNP
rs1332574324 545 dbSNP
rs1399666627 546 dbSNP
rs77607008 548 dbSNP
rs1393387054 553 dbSNP
rs1054913036 574 dbSNP
rs1006985237 576 dbSNP
rs34877245 577 dbSNP
rs1010571137 580 dbSNP
rs1381663103 583 dbSNP
rs1181001203 602 dbSNP
rs1458615771 610 dbSNP
rs898244928 614 dbSNP
rs1252687696 615 dbSNP
rs1208494249 618 dbSNP
rs1489578771 620 dbSNP
rs994255163 625 dbSNP
rs1266311285 629 dbSNP
rs772515842 630 dbSNP
rs1315161024 634 dbSNP
rs1022099852 639 dbSNP
rs528961345 640 dbSNP
rs549100468 643 dbSNP
rs1390969318 644 dbSNP
rs1029993018 648 dbSNP
rs1200473920 649 dbSNP
rs954768273 650 dbSNP
rs1361835609 651 dbSNP
rs1158727827 652 dbSNP
rs1258567842 652 dbSNP
rs1440838913 653 dbSNP
rs1395068769 657 dbSNP
rs1456933278 661 dbSNP
rs1180078939 673 dbSNP
rs1197168145 675 dbSNP
rs987885802 677 dbSNP
rs1268534128 679 dbSNP
rs1204722008 680 dbSNP
rs1487434632 680 dbSNP
rs1288248870 683 dbSNP
rs1217513071 691 dbSNP
rs1347031180 692 dbSNP
rs1273050921 693 dbSNP
rs373198124 696 dbSNP
rs1331426200 697 dbSNP
rs1294603483 705 dbSNP
rs1035039962 708 dbSNP
rs958712480 710 dbSNP
rs565331544 716 dbSNP
rs1268814441 720 dbSNP
rs771651540 722 dbSNP
rs1298256399 723 dbSNP
rs1433610597 727 dbSNP
rs1433451833 728 dbSNP
rs973455445 731 dbSNP
rs990569401 732 dbSNP
rs35717904 735 dbSNP
rs946126937 736 dbSNP
rs977543159 748 dbSNP
rs1193006729 750 dbSNP
rs1476957589 753 dbSNP
rs923754485 761 dbSNP
rs1376308151 762 dbSNP
rs1478976089 763 dbSNP
rs1485365139 764 dbSNP
rs933834675 774 dbSNP
rs1202055515 776 dbSNP
rs766487149 778 dbSNP
rs889714509 785 dbSNP
rs550980014 787 dbSNP
rs928196365 790 dbSNP
rs1391501908 799 dbSNP
rs1386449675 800 dbSNP
rs942344607 801 dbSNP
rs1038444290 811 dbSNP
rs533511348 821 dbSNP
rs571583124 822 dbSNP
rs1025377885 833 dbSNP
rs537378863 835 dbSNP
rs1403615454 837 dbSNP
rs377765731 846 dbSNP
rs907364869 850 dbSNP
rs1278601164 860 dbSNP
rs557259848 861 dbSNP
rs1171595558 864 dbSNP
rs946499603 869 dbSNP
rs1043440034 882 dbSNP
rs902396688 890 dbSNP
rs1249786791 891 dbSNP
rs1196490023 900 dbSNP
rs1266733504 903 dbSNP
rs35607877 904 dbSNP
rs1353824696 916 dbSNP
rs1208885860 917 dbSNP
rs574217067 928 dbSNP
rs1034581487 938 dbSNP
rs1264749097 944 dbSNP
rs1244948411 948 dbSNP
rs959222279 953 dbSNP
rs1029465164 958 dbSNP
rs549895092 959 dbSNP
rs1194922404 966 dbSNP
rs1332467460 967 dbSNP
rs1461117583 967 dbSNP
rs1262897723 978 dbSNP
rs1022043424 986 dbSNP
rs1477149158 987 dbSNP
rs560601928 997 dbSNP
rs1473187638 998 dbSNP
rs1363328041 1005 dbSNP
rs140591342 1020 dbSNP
rs977484540 1034 dbSNP
rs371193842 1040 dbSNP
rs1017629366 1043 dbSNP
rs923368123 1045 dbSNP
rs964693942 1046 dbSNP
rs973507863 1047 dbSNP
rs1306477997 1049 dbSNP
rs1369146515 1056 dbSNP
rs573385129 1057 dbSNP
rs1238527932 1058 dbSNP
rs1027738401 1059 dbSNP
rs1310429500 1061 dbSNP
rs1436264009 1067 dbSNP
rs545386506 1068 dbSNP
rs1406195390 1076 dbSNP
rs954747882 1077 dbSNP
rs1359917061 1088 dbSNP
rs1156935391 1089 dbSNP
rs987045658 1090 dbSNP
rs190526847 1093 dbSNP
rs1298626264 1094 dbSNP
rs1476895837 1096 dbSNP
rs1248265788 1099 dbSNP
rs1199064433 1102 dbSNP
rs911099579 1105 dbSNP
rs1446074650 1106 dbSNP
rs942608051 1108 dbSNP
rs529818974 1114 dbSNP
rs939615139 1117 dbSNP
rs991075728 1123 dbSNP
rs1287411386 1132 dbSNP
rs916272695 1134 dbSNP
rs946385105 1142 dbSNP
rs1276986857 1143 dbSNP
rs1437372866 1144 dbSNP
rs1314708825 1156 dbSNP
rs1321801334 1159 dbSNP
rs1043492044 1167 dbSNP
rs1421641072 1174 dbSNP
rs1243524293 1181 dbSNP
rs1175211232 1183 dbSNP
rs902279141 1184 dbSNP
rs1426930068 1185 dbSNP
rs1191627827 1187 dbSNP
rs984253 1188 dbSNP
rs1195170946 1189 dbSNP
rs929669731 1191 dbSNP
rs1046778204 1193 dbSNP
rs182014366 1199 dbSNP
rs890934328 1204 dbSNP
rs1216843912 1207 dbSNP
rs1262956965 1219 dbSNP
rs1002963173 1228 dbSNP
rs1487482078 1228 dbSNP
rs34470720 1229 dbSNP
rs1257394346 1230 dbSNP
rs894683660 1231 dbSNP
rs1402106230 1240 dbSNP
rs1341148857 1243 dbSNP
rs1302344316 1244 dbSNP
rs1018185743 1248 dbSNP
rs35347817 1251 dbSNP
rs529133151 1253 dbSNP
rs1012235779 1256 dbSNP
rs1185582616 1257 dbSNP
rs1382223531 1259 dbSNP
rs1421246610 1260 dbSNP
rs1021899806 1270 dbSNP
rs1477949071 1272 dbSNP
rs1420573877 1279 dbSNP
rs967348287 1286 dbSNP
rs994831470 1287 dbSNP
rs186543284 1291 dbSNP
rs1030386783 1294 dbSNP
rs1211479052 1299 dbSNP
rs1457562388 1300 dbSNP
rs552498486 1303 dbSNP
rs765022070 1304 dbSNP
rs1304370247 1305 dbSNP
rs1220627774 1318 dbSNP
rs1035627483 1323 dbSNP
rs761625675 1327 dbSNP
rs1462867624 1329 dbSNP
rs2745599 1345 dbSNP
rs772836394 1347 dbSNP
rs1312332569 1349 dbSNP
rs1303315105 1352 dbSNP
rs189813928 1354 dbSNP
rs1397773979 1355 dbSNP
rs1333123102 1357 dbSNP
rs1465812437 1361 dbSNP
rs1367590270 1362 dbSNP
rs1162064279 1365 dbSNP
rs1425001424 1366 dbSNP
rs1240446654 1375 dbSNP
rs1284790010 1376 dbSNP
rs1184689387 1377 dbSNP
rs762904432 1393 dbSNP
rs963939040 1394 dbSNP
rs1315507067 1401 dbSNP
rs1439629585 1402 dbSNP
rs916825230 1405 dbSNP
rs1200982239 1408 dbSNP
rs1265128264 1408 dbSNP
rs557505558 1408 dbSNP
rs979070591 1408 dbSNP
rs767916595 1410 dbSNP
rs1313546694 1412 dbSNP
rs974379714 1417 dbSNP
rs919862089 1419 dbSNP
rs923586166 1429 dbSNP
rs763914229 1431 dbSNP
rs1046723418 1434 dbSNP
rs550941173 1435 dbSNP
rs1447308114 1440 dbSNP
rs928351040 1441 dbSNP
rs1291382417 1443 dbSNP
rs1459133442 1444 dbSNP
rs181076077 1447 dbSNP
rs1349889157 1448 dbSNP
rs752952900 1455 dbSNP
rs935089761 1461 dbSNP
rs1419617439 1465 dbSNP
rs1379059400 1466 dbSNP
rs1180870440 1477 dbSNP
rs938430342 1481 dbSNP
rs1050851728 1489 dbSNP
rs912408104 1489 dbSNP
rs1055584724 1491 dbSNP
rs1489589542 1492 dbSNP
rs3799328 1499 dbSNP
rs756309855 1500 dbSNP
rs1483235941 1503 dbSNP
rs1202296565 1504 dbSNP
rs1351387567 1514 dbSNP
rs1240129693 1518 dbSNP
rs1039676836 1529 dbSNP
rs1442402634 1531 dbSNP
rs551307028 1532 dbSNP
rs1043670673 1537 dbSNP
rs1367941744 1544 dbSNP
rs1440333143 1555 dbSNP
rs903441744 1562 dbSNP
rs185531077 1566 dbSNP
rs536815357 1573 dbSNP
rs1030334389 1574 dbSNP
rs1160920540 1575 dbSNP
rs1378774955 1577 dbSNP
rs1435119104 1579 dbSNP
rs1178030199 1581 dbSNP
rs954727073 1584 dbSNP
rs564615118 1586 dbSNP
rs553305445 1587 dbSNP
rs1465508614 1593 dbSNP
rs866492467 1599 dbSNP
rs1334548372 1602 dbSNP
rs1269927835 1606 dbSNP
rs1049107628 1611 dbSNP
rs886411391 1613 dbSNP
rs1446788581 1615 dbSNP
rs1307890453 1622 dbSNP
rs879010583 1622 dbSNP
rs1005402281 1623 dbSNP
rs1254014489 1623 dbSNP
rs1352967725 1623 dbSNP
rs566940366 1625 dbSNP
rs370514174 1626 dbSNP
rs757127346 1627 dbSNP
rs1298278221 1628 dbSNP
rs1383261911 1629 dbSNP
rs1402190184 1630 dbSNP
rs778334758 1630 dbSNP
rs1389500439 1631 dbSNP
rs34380836 1632 dbSNP
rs1302456857 1637 dbSNP
rs369046889 1647 dbSNP
rs979626594 1657 dbSNP
rs1194066891 1664 dbSNP
rs923632092 1675 dbSNP
rs1202344570 1676 dbSNP
rs1260477978 1679 dbSNP
rs1458603837 1680 dbSNP
rs1257200906 1681 dbSNP
rs1198157783 1682 dbSNP
rs1231230729 1683 dbSNP
rs1017710743 1687 dbSNP
rs1319640335 1688 dbSNP
rs1270253647 1690 dbSNP
rs1243492691 1696 dbSNP
rs543347962 1702 dbSNP
rs1340360788 1708 dbSNP
rs1332727577 1714 dbSNP
rs1398328998 1723 dbSNP
rs1407215815 1724 dbSNP
rs1331175371 1736 dbSNP
rs1464253443 1739 dbSNP
rs557172454 1743 dbSNP
rs956380500 1748 dbSNP
rs1472488367 1759 dbSNP
rs964197765 1763 dbSNP
rs1425633285 1769 dbSNP
rs533700893 1777 dbSNP
rs1445168180 1782 dbSNP
rs919809545 1785 dbSNP
rs1196586174 1786 dbSNP
rs1425767402 1786 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' agauuuAGAGUAUCACGGAAGa 5'
                |||| |  ||||||| 
Target 5' cuccccUCUC-U--UGCCUUCu 3'
 		2 - 20
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462573. RNA binding protein: AGO2. Condition:TZM-bl BaL PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177599. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_1 PAR-CLIP data was present in ERX177600. RNA binding protein: AGO2. Condition:p53_V_Ago_CLIP_2_2 PAR-CLIP data was present in ERX177601. RNA binding protein: AGO2. Condition:KO_D_Ago_CLIP_2_3 PAR-CLIP data was present in ERX177612. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_2 PAR-CLIP data was present in ERX177613. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_3 PAR-CLIP data was present in ERX177625. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_3 PAR-CLIP data was present in ERX177605. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_7 PAR-CLIP data was present in ERX177617. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_7 PAR-CLIP data was present in ERX177627. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_5 PAR-CLIP data was present in ERX177629. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_7 PAR-CLIP data was present in ERX177630. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_8 PAR-CLIP data was present in ERX177621. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_11 PAR-CLIP data was present in ERX177633. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_11 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000380874.2 | 3UTR | UCUCCCCUCUCUUGCCUUCUUCCUUGCCUCUCACCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1462573
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl BaL
Location of target site ENST00000380874.2 | 3UTR | CCUCCUCCCGUCUCCCCUCUCUUGCCUUCUUCCUUGCCUCUCACCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000380874.2 | 3UTR | UCUCCCCUCUCUUGCCUUCUUCCUUGCCUCUCACCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
100 hsa-miR-605-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT061339 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT061584 BTG2 BTG anti-proliferation factor 2 2 6
MIRT076140 WDR81 WD repeat domain 81 2 2
MIRT079361 CCDC137 coiled-coil domain containing 137 2 2
MIRT079547 VAMP3 vesicle associated membrane protein 3 2 2
MIRT096242 CANX calnexin 2 2
MIRT243877 G3BP1 G3BP stress granule assembly factor 1 2 4
MIRT249186 AKIRIN1 akirin 1 2 8
MIRT273604 SP1 Sp1 transcription factor 2 2
MIRT316766 FOXC1 forkhead box C1 2 4
MIRT322410 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 2 2
MIRT370117 TRIB3 tribbles pseudokinase 3 2 2
MIRT392725 UBN2 ubinuclein 2 2 2
MIRT406910 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT407440 CTDSP1 CTD small phosphatase 1 2 2
MIRT441887 RD3 retinal degeneration 3 2 4
MIRT444979 C15orf52 chromosome 15 open reading frame 52 2 2
MIRT445241 FOXD4 forkhead box D4 2 2
MIRT445500 FOXD4L5 forkhead box D4 like 5 2 2
MIRT445503 FOXD4L4 forkhead box D4 like 4 2 2
MIRT447025 FOXD4L1 forkhead box D4 like 1 2 2
MIRT447743 TMCC3 transmembrane and coiled-coil domain family 3 2 2
MIRT448761 HDX highly divergent homeobox 2 2
MIRT450003 HAX1 HCLS1 associated protein X-1 2 2
MIRT452830 FAM131B family with sequence similarity 131 member B 2 2
MIRT452872 LAX1 lymphocyte transmembrane adaptor 1 2 2
MIRT453506 ARRB1 arrestin beta 1 2 2
MIRT454169 HIST1H2BK histone cluster 1 H2B family member k 2 2
MIRT458742 CES2 carboxylesterase 2 2 2
MIRT459166 HSPA6 heat shock protein family A (Hsp70) member 6 2 21
MIRT460246 IL17RB interleukin 17 receptor B 2 4
MIRT460514 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT460698 RNF157 ring finger protein 157 2 2
MIRT461481 METTL1 methyltransferase like 1 2 2
MIRT462617 C20orf27 chromosome 20 open reading frame 27 2 4
MIRT463233 ZNF131 zinc finger protein 131 2 2
MIRT465699 TNPO2 transportin 2 2 8
MIRT466304 TIMM22 translocase of inner mitochondrial membrane 22 2 2
MIRT468957 RPS14 ribosomal protein S14 2 6
MIRT469571 RARA retinoic acid receptor alpha 2 2
MIRT469685 RAB5B RAB5B, member RAS oncogene family 2 2
MIRT470800 PMP22 peripheral myelin protein 22 2 2
MIRT471649 PANK2 pantothenate kinase 2 2 4
MIRT471722 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 2 2
MIRT472281 NFIB nuclear factor I B 2 4
MIRT473680 MAPKBP1 mitogen-activated protein kinase binding protein 1 2 2
MIRT475859 H6PD hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase 2 2
MIRT477326 EPHA2 EPH receptor A2 2 2
MIRT477831 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 2 2
MIRT478572 CTNND1 catenin delta 1 2 4
MIRT479634 CD81 CD81 molecule 2 2
MIRT481950 ANKRD11 ankyrin repeat domain 11 2 2
MIRT483696 ZNF74 zinc finger protein 74 2 6
MIRT488798 MALT1 MALT1 paracaspase 2 2
MIRT489066 STARD3 StAR related lipid transfer domain containing 3 2 2
MIRT492533 PSMD11 proteasome 26S subunit, non-ATPase 11 2 2
MIRT492857 NRARP NOTCH regulated ankyrin repeat protein 2 2
MIRT496793 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 2 2
MIRT500122 ZNF106 zinc finger protein 106 2 4
MIRT505359 TMEM167A transmembrane protein 167A 2 2
MIRT506786 KLHL15 kelch like family member 15 2 6
MIRT510692 SRM spermidine synthase 2 6
MIRT515841 CEP104 centrosomal protein 104 2 4
MIRT516448 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif 4 2 4
MIRT528855 PKP1 plakophilin 1 2 2
MIRT533848 TET3 tet methylcytosine dioxygenase 3 2 2
MIRT539025 ATXN7L1 ataxin 7 like 1 2 4
MIRT542872 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT546543 SATB2 SATB homeobox 2 2 2
MIRT554114 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 2 2
MIRT560569 ZNF460 zinc finger protein 460 2 2
MIRT560796 EPM2AIP1 EPM2A interacting protein 1 2 2
MIRT562836 GCFC2 GC-rich sequence DNA-binding factor 2 2 2
MIRT563109 IFRD2 interferon related developmental regulator 2 2 2
MIRT564177 MRPL49 mitochondrial ribosomal protein L49 2 2
MIRT564283 ASB1 ankyrin repeat and SOCS box containing 1 2 2
MIRT564350 USP22 ubiquitin specific peptidase 22 2 2
MIRT565279 TNFRSF21 TNF receptor superfamily member 21 2 2
MIRT565338 TMEM104 transmembrane protein 104 2 2
MIRT565905 SCAMP2 secretory carrier membrane protein 2 2 2
MIRT567108 ITGB1 integrin subunit beta 1 2 2
MIRT567601 FANCF Fanconi anemia complementation group F 2 2
MIRT567779 DGAT2 diacylglycerol O-acyltransferase 2 2 2
MIRT568075 CENPQ centromere protein Q 2 2
MIRT624304 COL12A1 collagen type XII alpha 1 chain 2 2
MIRT644395 CDKL1 cyclin dependent kinase like 1 2 2
MIRT661547 ZNF674 zinc finger protein 674 2 4
MIRT670949 IRAK3 interleukin 1 receptor associated kinase 3 2 2
MIRT672951 AKAP5 A-kinase anchoring protein 5 2 2
MIRT697426 ZFP36 ZFP36 ring finger protein 2 2
MIRT700793 PIAS2 protein inhibitor of activated STAT 2 2 2
MIRT702657 ITGA3 integrin subunit alpha 3 2 2
MIRT708945 FZR1 fizzy and cell division cycle 20 related 1 2 2
MIRT713657 PLCE1 phospholipase C epsilon 1 2 2
MIRT719239 CYSLTR2 cysteinyl leukotriene receptor 2 2 2
MIRT719951 BLOC1S6 biogenesis of lysosomal organelles complex 1 subunit 6 2 2
MIRT722048 HLA-E major histocompatibility complex, class I, E 2 2
MIRT722201 URM1 ubiquitin related modifier 1 2 2
MIRT724790 C1D C1D nuclear receptor corepressor 2 2
MIRT734347 CYP2B6 cytochrome P450 family 2 subfamily B member 6 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-605 Anthranilamide-pyrazolo[1,5-a]pyrimidine NULL NULL Quantitative real-time PCR neuroblastoma cells 23992861 2013 up-regualted
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-605 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-605 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-605 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-mir-605 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-605-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)

Error report submission