| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-2110 |
| Genomic Coordinates | chr10: 114174105 - 114174179 |
| Synonyms | hsa-mir-2110, MIR2110 |
| Description | Homo sapiens miR-2110 stem-loop |
| Comment | Zhu et al. incorrectly referred to this sequence as mir-1309 in . This sequence is unrelated to MIR1309 in plants. |
| RNA Secondary Structure |  |
| Associated Diseases |  |
| Mature miRNA Information | |||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-2110 | ||||||||||||||||||||||||||||||||||||||||||
| Sequence | 8| UUGGGGAAACGGCCGCUGAGUG |29 | ||||||||||||||||||||||||||||||||||||||||||
| Evidence | Experimental | ||||||||||||||||||||||||||||||||||||||||||
| Experiments | 454 | DRVs in miRNA |
|
||||||||||||||||||||||||||||||||||||||||
| SNPs in miRNA |
|
||||||||||||||||||||||||||||||||||||||||||
| Putative Targets | |||||||||||||||||||||||||||||||||||||||||||
| miRNA Expression profile | |
|---|---|
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | E2F3 | ||||||||||||||||||||
| Synonyms | E2F-3 | ||||||||||||||||||||
| Description | E2F transcription factor 3 | ||||||||||||||||||||
| Transcript | NM_001949 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on E2F3 | |||||||||||||||||||||
| 3'UTR of E2F3 (miRNA target sites are highlighted) |
>E2F3|NM_001949|3'UTR 1 TTATGCTTCGTGTGAACTCTCCTTAAAAACCGATATTTTTTTATCATGGAACCAGAACATCTGTCATGCAGTGTTGTCCC 81 TTCCTACCTTCTTCCTCCAAGAGAGTATCATGAAGTAAACTACAAACTTCAGAAGAAAGCTGACATTTTAATGAATTTTT 161 TAAAAAATTAATAAACAAATTGTCTAAACGCACAGTTGCAGGCTCCCTTGGGAAAGCCCTGCTTTGCTCCAGGCTCCAAG 241 ATCTCCTGGCTAAGTCAGCAAGTGAGAAAATGTGCAATCAGGTGTCTCTCACCCCGAATTGTCCTTCCTCCTTCCTCCCC 321 GGATTGGCTTGCTGTGCCTGACGGATGGGCTGTAGAATGGGGTCTGGCCACCTGGCCTGCTGGGAAACAGCAATCTTCCT 401 TAATAGCATTTCAAGCCGTGCCTTCTCCGCAGAATGCATGTCTTTGAGGTCTGCTAATATGGAATGGAACTGCAGCAAAT 481 GCAAACTTGAAGTCATGCAAAAGTATGAAATGGATTTCTTCAGCTCTTCTTAGGAATATTTAAATTACTGTCATAATTCA 561 GTTTAAGCTATGAACTGTGTGTCCCAGTAGGAGGTCAAGAAAACCTCCACAGCCTTCTGGATGAAGAACCTGTTTTCAAA 641 TATACTTGTTGCAGATACAGAAGACTAGTAGAGTTCTGCCACTCTAAGCTGTTGTGGATTTTCCTGTCTCCATGAACCAC 721 TCCCATTCCCCCGTCCCCAATGTGTTTGTGAGTTTCCAGTTGATTTGTAGCAAATGCCTACTTAGTTCTTTGTGGATTGT 801 TCTAGACTTTTAATTTTTTTAGCTGCCATTTAAGCATTCCTGTGGCACCCATCACCATTTCAATTTAATTGTTTACTTTG 881 AAGCGGTTTTTGCAAATTCATATTACTTAAGCAGAGGGAGAGAACCTCTACTGATCAGAGCATCTAAACCTGTGTGATCT 961 AAGGTTTATCAGCCTCTGCAAGGAGCTTTGTCCCATCGTGCTTCCATTCCCAGGAGGGGGAGCTTGGAGCGAGTCAGTCC 1041 TGGGGCTTGCTGACATGGGTGGCCCATTGGAAAGGAGAACCAGGTCAGATGATGTAACAGCCCCAAGGAGCAGCAGGCAT 1121 GGGTCCCTCCATCCTTGGGCTTCCCGGGCCCCTGTGACAGGGGAAAGGGCTCTCTTACACCGCACTCAGGGAGACCACTT 1201 CTCAGGATGGGGTCAGATGGAGAGACCTCTAGGGAGAAAGACATCCCCATTGTGTGAGTGGCATTTCCTTAAGCTGGCAG 1281 GAACAGGGAGCAGCCCTGTGTCGGGGGCTGGAATAGTTCTGGCCAGACCCCGTTCCCCTTCCTCTATGAAGGAATAAGTT 1361 GGACCAAGGGAAGTCGGGGACGTAAAAAATGAAGCAAAACAATGCCAGGGTGTCTCCCGCTTTACTCTTCAGGAATGGTG 1441 TCCCAAGTTGGAGGCTTTGTGTCAGCTGCAAATCCTACCAGTTATGTCCAAGAATGGCTTTCCCTCGGGCAGGTGGCAGC 1521 GGCCATCTCCCACTGGGAATATGGCGTAGTATCTCCGGTCCATTCCTTGGATGCTAAGGACTGCGGGAATGAGGGAGTCA 1601 GATAAAGAACAAACCTCGAAACGAACAGTTAAATTGAAATGCTATGTGCCTGACCCAATGGTAGGCACATAGTAGGCACT 1681 CAACTCATATGTTTAATTGAATTGAAAATATCCCTTAGGAAAAAAAAAAAACACACAAAAAACCACAAGAGCCCCAGCCA 1761 GTTTACTCCAGGTAGATTTCCACAATATGCAAAGTGGTGGTGGGGTCAAGACAGATGACACCAGCACTTTAAACTCTTTG 1841 TGTGGGTATGCGTGGGTGTATGTTTGGGAAGAAAAACAAAGGTGCAGACTATCTTCCTTTTTTTCTTCTTCAGCCTCCAT 1921 CCCTGGCCTCCTCCCCTCACACACACTGGACTTGGTACAAAATGTCGGTGTGGTCCTAGATGAAGCATTGGGGTGGGGGA 2001 GGGAGAGGGAGCTTTGTGTTAAGTGCCTACTGGAAATGCACTGTGGGGTTTTTTCCTGTATGGGAAACCATTTATGCCAA 2081 GCTTTTCCCCATTTCCCATATTTATCTCATCTGGTTAGCTGCCTCTGCTTCCAGCTTTGTGTAATTCTCTTTGCCAGCTG 2161 CACAAAGCTGATTTTTTCCAAAGTCTAAAGACTGAGCTCACCTGGCTAGATTGTTGTGTGTTTTGTTGAATTTTTTCATA 2241 ATGTAATGCCGTATTTATTGTTTTTAAAATGAAAGGAATACTAATAAGTCTTAAAAGTTCCTTCATGCATAAGATTTTTT 2321 TCCAGTTACTGGGTTTAACTGGTGTACATTAATTAGATGTCCATACTGTATTTTGTTTGCATTAAGTAATTTTCTTTTTG 2401 ACTTAGTATCCGGCACACAAAGTGGGTTAGTACTACAGTATTTGCGTTACTTTAAGTACTAAGTATGCAGGTTTCCTGGT 2481 ACCATTGAGTTGCTGCTATTAAAGCTCACACACGAAATGGCTAAAAGTTACAAGTGTGCAAATTATGACTGCGTGAGCCT 2561 TAGAAAATAAAATGTATAAAGGGCAACACATGAGCTGTCAAACAGTGTTAGGAGTGTGTTTATATGTACAGAGTTGTGCA 2641 TAGCAATCGTTTTATTTAAGTTGATATGTAGTCTACTCACATTTTCATTATTTAGCAATTTTGTACAAAAATAGCAATTA 2721 ATTTGTAAACACTGCCAGAATACTTTCTAGCTGCTTTGTAATTTTTTAAGAGTGTTATTTTGTTTTTGTTTTTCTGTTCT 2801 TTGTTGTGGCTCTTGTTTTCATTTTTGTTGTACGTGTAGATCTGTAAATAAAATTGCAGTATTTAAAGCTTAAGCTTTCA 2881 GGAAAAAGAAAATAAGAATTCAGTGTGTGCATGACAACTCGTGTGTATGAGAAGGAGGGATATGAAGGAAGATGGCTTGC 2961 AGAGTAAGTCGGGTGGCAATTGTCAGGGTGTGGGAATTTCTTTTCCTACGGGGTACGTGATTTTGTAAAAAGGAAGTATT 3041 TCTCCCAAAATTGGGAGTAGGCAAACTACTAATCAGTTTAGCTTTGTGTTGTATGCTAGTTTAAAAAAGAAAATATGTAA 3121 TATAATGTAAAAAAAAACAAAAAAAAGCTTTTATGATGGATTTTGTAAATAGATTTGTTACAGGGTGACCTGTTCTCTAG 3201 CTGTGATCTTACCACTTCAAATGGGTGTAATTTGAATAAATTTTGTATGGTAAAGGATCAATAAAATGATTTTTTTTAAG 3281 AGTTAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | HEK293 | ||||||
| Disease | 1871.0 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
||||||
| Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | TZM-bl | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
||||||
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HCT116 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177609. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_11
PAR-CLIP data was present in ERX177628. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_6
PAR-CLIP data was present in ERX177599. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_1
PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5
PAR-CLIP data was present in ERX177604. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_6
PAR-CLIP data was present in ERX177605. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_7
PAR-CLIP data was present in ERX177606. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_8
PAR-CLIP data was present in ERX177615. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_5
PAR-CLIP data was present in ERX177616. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_6
PAR-CLIP data was present in ERX177617. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_7
PAR-CLIP data was present in ERX177621. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_11
PAR-CLIP data was present in ERX177627. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_5
PAR-CLIP data was present in ERX177629. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_7
PAR-CLIP data was present in ERX177630. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_8
PAR-CLIP data was present in ERX177633. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_11
PAR-CLIP data was present in ERX177618. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_8
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
| Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | Prostate Tissue |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760638. RNA binding protein: AGO2. Condition:AGO-CLIP-PC3-miR148
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
| Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
| CLIP-seq Support 1 for dataset GSM4903825 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | Dermal fibroblasts / PID14_NS |
| Location of target site | NM_001949 | 3UTR | CAUUUCCCAUAUUUAUCUCAUCUGGUUAGCUGCCUCUGCUUCCAGCUUU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Accession Series | GSE161237 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM4903833 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | Dermal fibroblasts / CTL_TD_21_a |
| Location of target site | NM_001949 | 3UTR | CCUGUAUGGGAAACCAUUUAUGCCAAGCUUUUCCCCAUUUCCCAUAUUUAUCUCAUCUGGUUAGCUGCCUCUGCUUCCAGCUUU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Accession Series | GSE161239 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM4903836 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | Dermal fibroblasts / 124_TD_21_a |
| Location of target site | NM_001949 | 3UTR | UCCCCAUUUCCCAUAUUUAUCUCAUCUGGUUAGCUGCCUCUGCUUCCAGCUUU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Accession Series | GSE161239 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM4903837 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | Dermal fibroblasts / 124_TD_21_b |
| Location of target site | NM_001949 | 3UTR | UGUAUGGGAAACCAUUUAUGCCAAGCUUUUCCCCAUUUCCCAUAUUUAUCUCAUCUGGUUAGCUGCCUCUGCUUCCAGCUUU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Accession Series | GSE161239 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 5 for dataset GSM714645 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repB |
| Location of target site | ENST00000346618.3 | 3UTR | CUUUUCCCCAUUUCCCAUAUUUAUCUCAUCUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 6 for dataset GSM1462574 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000346618.3 | 3UTR | CCAAGCUUUUCCCCAUUUCCCAUAUUUAUCUCAUCUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
96 hsa-miR-2110 Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT035757 | BRD4 | bromodomain containing 4 |  |
1 | 1 | |||||||
| MIRT035758 | NCOR2 | nuclear receptor corepressor 2 | |
1 | 1 | |||||||
| MIRT035759 | FASN | fatty acid synthase | |
1 | 1 | |||||||
| MIRT035760 | C10orf118 | coiled-coil domain containing 186 | |
1 | 1 | |||||||
| MIRT055403 | SHOC2 | SHOC2, leucine rich repeat scaffold protein | |
|
2 | 6 | ||||||
| MIRT066205 | MARCH9 | membrane associated ring-CH-type finger 9 | |
|
2 | 2 | ||||||
| MIRT079365 | CCDC137 | coiled-coil domain containing 137 | |
|
2 | 2 | ||||||
| MIRT081180 | MIDN | midnolin | |
|
2 | 4 | ||||||
| MIRT082397 | HNRNPUL1 | heterogeneous nuclear ribonucleoprotein U like 1 | |
|
2 | 4 | ||||||
| MIRT089000 | BCL11A | B-cell CLL/lymphoma 11A | |
|
2 | 2 | ||||||
| MIRT133706 | SKI | SKI proto-oncogene | |
|
2 | 4 | ||||||
| MIRT160053 | TET3 | tet methylcytosine dioxygenase 3 | |
|
2 | 4 | ||||||
| MIRT180853 | RPRD2 | regulation of nuclear pre-mRNA domain containing 2 | |
|
2 | 2 | ||||||
| MIRT263243 | SGPL1 | sphingosine-1-phosphate lyase 1 | |
|
2 | 2 | ||||||
| MIRT285532 | CDT1 | chromatin licensing and DNA replication factor 1 | |
|
2 | 2 | ||||||
| MIRT317152 | E2F3 | E2F transcription factor 3 | |
|
2 | 4 | ||||||
| MIRT321166 | EIF4H | eukaryotic translation initiation factor 4H | |
|
2 | 2 | ||||||
| MIRT441482 | NCEH1 | neutral cholesterol ester hydrolase 1 | |
|
2 | 2 | ||||||
| MIRT443884 | CNKSR3 | CNKSR family member 3 | |
|
2 | 2 | ||||||
| MIRT445877 | WBP1L | WW domain binding protein 1 like | |
|
2 | 2 | ||||||
| MIRT446195 | GTPBP4 | GTP binding protein 4 | |
|
2 | 2 | ||||||
| MIRT449308 | MRO | maestro | |
|
2 | 2 | ||||||
| MIRT450301 | DRAXIN | dorsal inhibitory axon guidance protein | |
|
2 | 2 | ||||||
| MIRT450512 | EMX1 | empty spiracles homeobox 1 | |
|
2 | 2 | ||||||
| MIRT451534 | CIAPIN1 | cytokine induced apoptosis inhibitor 1 | |
|
2 | 2 | ||||||
| MIRT451820 | ALDH3B1 | aldehyde dehydrogenase 3 family member B1 | |
|
2 | 2 | ||||||
| MIRT452239 | TRAM1 | translocation associated membrane protein 1 | |
|
2 | 2 | ||||||
| MIRT454207 | HLA-A | major histocompatibility complex, class I, A | |
|
2 | 2 | ||||||
| MIRT455447 | EPB41L4B | erythrocyte membrane protein band 4.1 like 4B | |
|
2 | 2 | ||||||
| MIRT456496 | PFKFB2 | 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 | |
|
2 | 2 | ||||||
| MIRT457656 | SERINC1 | serine incorporator 1 | |
|
2 | 2 | ||||||
| MIRT459819 | TPP1 | tripeptidyl peptidase 1 | |
|
2 | 2 | ||||||
| MIRT460556 | FEM1A | fem-1 homolog A | |
|
2 | 2 | ||||||
| MIRT462561 | STS | steroid sulfatase | |
|
2 | 2 | ||||||
| MIRT462986 | ZNF740 | zinc finger protein 740 | |
|
2 | 2 | ||||||
| MIRT464671 | UBE2V1 | ubiquitin conjugating enzyme E2 V1 | |
|
2 | 2 | ||||||
| MIRT465432 | TP53 | tumor protein p53 | |
|
2 | 2 | ||||||
| MIRT465934 | TMEM189-UBE2V1 | TMEM189-UBE2V1 readthrough | |
|
2 | 2 | ||||||
| MIRT466015 | TMEM189 | transmembrane protein 189 | |
|
2 | 2 | ||||||
| MIRT468122 | SH3PXD2A | SH3 and PX domains 2A | |
|
2 | 2 | ||||||
| MIRT469652 | RAC1 | Rac family small GTPase 1 | |
|
2 | 2 | ||||||
| MIRT469980 | PTPN14 | protein tyrosine phosphatase, non-receptor type 14 | |
|
2 | 2 | ||||||
| MIRT473531 | MAX | MYC associated factor X | |
|
2 | 2 | ||||||
| MIRT473596 | MARK2 | microtubule affinity regulating kinase 2 | |
|
2 | 2 | ||||||
| MIRT473652 | MARCKSL1 | MARCKS like 1 | |
|
2 | 2 | ||||||
| MIRT474219 | LCOR | ligand dependent nuclear receptor corepressor | |
|
2 | 4 | ||||||
| MIRT474771 | KIAA0895L | KIAA0895 like | |
|
2 | 2 | ||||||
| MIRT479312 | VPS72 | vacuolar protein sorting 72 homolog | |
|
2 | 2 | ||||||
| MIRT481121 | AZIN1 | antizyme inhibitor 1 | |
|
2 | 4 | ||||||
| MIRT481682 | AR | androgen receptor | |
|
2 | 2 | ||||||
| MIRT482381 | AEN | apoptosis enhancing nuclease | |
|
2 | 2 | ||||||
| MIRT483833 | UNC5B | unc-5 netrin receptor B | |
|
2 | 4 | ||||||
| MIRT484693 | RNF11 | ring finger protein 11 | |
|
2 | 2 | ||||||
| MIRT485238 | POGZ | pogo transposable element derived with ZNF domain | |
|
2 | 2 | ||||||
| MIRT488748 | FXYD1 | FXYD domain containing ion transport regulator 1 | |
|
2 | 2 | ||||||
| MIRT489147 | MRPL12 | mitochondrial ribosomal protein L12 | |
|
2 | 4 | ||||||
| MIRT489518 | MRE11A | MRE11 homolog, double strand break repair nuclease | |
|
2 | 8 | ||||||
| MIRT498908 | SRCAP | Snf2 related CREBBP activator protein | |
|
2 | 2 | ||||||
| MIRT506426 | NAGK | N-acetylglucosamine kinase | |
|
2 | 6 | ||||||
| MIRT506640 | MAPK1 | mitogen-activated protein kinase 1 | |
|
2 | 4 | ||||||
| MIRT507332 | FAM168A | family with sequence similarity 168 member A | |
|
2 | 2 | ||||||
| MIRT513099 | DYNAP | dynactin associated protein | |
|
2 | 2 | ||||||
| MIRT513514 | YIPF4 | Yip1 domain family member 4 | |
|
2 | 6 | ||||||
| MIRT521800 | POM121C | POM121 transmembrane nucleoporin C | |
|
2 | 2 | ||||||
| MIRT525078 | FRK | fyn related Src family tyrosine kinase | |
|
2 | 2 | ||||||
| MIRT530927 | SCIN | scinderin | |
|
2 | 2 | ||||||
| MIRT533498 | TRIM71 | tripartite motif containing 71 | |
|
2 | 2 | ||||||
| MIRT536787 | HNRNPD | heterogeneous nuclear ribonucleoprotein D | |
|
2 | 2 | ||||||
| MIRT544554 | CSNK2A1 | casein kinase 2 alpha 1 | |
|
2 | 2 | ||||||
| MIRT552977 | VAT1 | vesicle amine transport 1 | |
|
2 | 2 | ||||||
| MIRT557358 | HAND1 | heart and neural crest derivatives expressed 1 | |
|
2 | 2 | ||||||
| MIRT560401 | TMEM69 | transmembrane protein 69 | |
|
2 | 2 | ||||||
| MIRT565498 | SP1 | Sp1 transcription factor | |
|
2 | 2 | ||||||
| MIRT568962 | CACNA1C | calcium voltage-gated channel subunit alpha1 C | |
|
2 | 2 | ||||||
| MIRT569031 | IL21R | interleukin 21 receptor | |
|
2 | 2 | ||||||
| MIRT573224 | TRIM21 | tripartite motif containing 21 | |
|
2 | 2 | ||||||
| MIRT574312 | ZNF703 | zinc finger protein 703 | |
|
2 | 2 | ||||||
| MIRT620395 | MYO1H | myosin IH | |
|
2 | 2 | ||||||
| MIRT620936 | OSMR | oncostatin M receptor | |
|
2 | 2 | ||||||
| MIRT638166 | TMED4 | transmembrane p24 trafficking protein 4 | |
|
2 | 2 | ||||||
| MIRT647743 | SAMD9L | sterile alpha motif domain containing 9 like | |
|
2 | 2 | ||||||
| MIRT649991 | MSI1 | musashi RNA binding protein 1 | |
|
2 | 2 | ||||||
| MIRT669203 | CBX8 | chromobox 8 | |
|
2 | 2 | ||||||
| MIRT684546 | ZNF708 | zinc finger protein 708 | |
|
2 | 2 | ||||||
| MIRT685837 | ANGEL1 | angel homolog 1 | |
|
2 | 2 | ||||||
| MIRT688547 | DCAF16 | DDB1 and CUL4 associated factor 16 | |
|
2 | 2 | ||||||
| MIRT693252 | HBS1L | HBS1 like translational GTPase | |
|
2 | 2 | ||||||
| MIRT701970 | MIER3 | MIER family member 3 | |
|
2 | 2 | ||||||
| MIRT706385 | MC2R | melanocortin 2 receptor | |
|
2 | 2 | ||||||
| MIRT707484 | UGT2B4 | UDP glucuronosyltransferase family 2 member B4 | |
|
2 | 2 | ||||||
| MIRT711882 | INSIG2 | insulin induced gene 2 | |
|
2 | 2 | ||||||
| MIRT716906 | CACNB2 | calcium voltage-gated channel auxiliary subunit beta 2 | |
|
2 | 2 | ||||||
| MIRT717638 | HLX | H2.0 like homeobox | |
|
2 | 2 | ||||||
| MIRT719058 | ZNF281 | zinc finger protein 281 | |
|
2 | 2 | ||||||
| MIRT723754 | NKIRAS2 | NFKB inhibitor interacting Ras like 2 | |
|
2 | 2 | ||||||
| MIRT725479 | GPR26 | G protein-coupled receptor 26 | |
|
2 | 2 | ||||||
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|