| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-6733 |
| Genomic Coordinates | chr1: 43171652 - 43171712 |
| Description | Homo sapiens miR-6733 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-6733-5p | |||||||||||||||
| Sequence | 6| UGGGAAAGACAAACUCAGAGUU |27 | |||||||||||||||
| Evidence | Experimental | |||||||||||||||
| Experiments | Meta-analysis | |||||||||||||||
| SNPs in miRNA |
|
|||||||||||||||
| Putative Targets | ||||||||||||||||
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | E2F3 | ||||||||||||||||||||
| Synonyms | E2F-3 | ||||||||||||||||||||
| Description | E2F transcription factor 3 | ||||||||||||||||||||
| Transcript | NM_001949 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on E2F3 | |||||||||||||||||||||
| 3'UTR of E2F3 (miRNA target sites are highlighted) |
>E2F3|NM_001949|3'UTR 1 TTATGCTTCGTGTGAACTCTCCTTAAAAACCGATATTTTTTTATCATGGAACCAGAACATCTGTCATGCAGTGTTGTCCC 81 TTCCTACCTTCTTCCTCCAAGAGAGTATCATGAAGTAAACTACAAACTTCAGAAGAAAGCTGACATTTTAATGAATTTTT 161 TAAAAAATTAATAAACAAATTGTCTAAACGCACAGTTGCAGGCTCCCTTGGGAAAGCCCTGCTTTGCTCCAGGCTCCAAG 241 ATCTCCTGGCTAAGTCAGCAAGTGAGAAAATGTGCAATCAGGTGTCTCTCACCCCGAATTGTCCTTCCTCCTTCCTCCCC 321 GGATTGGCTTGCTGTGCCTGACGGATGGGCTGTAGAATGGGGTCTGGCCACCTGGCCTGCTGGGAAACAGCAATCTTCCT 401 TAATAGCATTTCAAGCCGTGCCTTCTCCGCAGAATGCATGTCTTTGAGGTCTGCTAATATGGAATGGAACTGCAGCAAAT 481 GCAAACTTGAAGTCATGCAAAAGTATGAAATGGATTTCTTCAGCTCTTCTTAGGAATATTTAAATTACTGTCATAATTCA 561 GTTTAAGCTATGAACTGTGTGTCCCAGTAGGAGGTCAAGAAAACCTCCACAGCCTTCTGGATGAAGAACCTGTTTTCAAA 641 TATACTTGTTGCAGATACAGAAGACTAGTAGAGTTCTGCCACTCTAAGCTGTTGTGGATTTTCCTGTCTCCATGAACCAC 721 TCCCATTCCCCCGTCCCCAATGTGTTTGTGAGTTTCCAGTTGATTTGTAGCAAATGCCTACTTAGTTCTTTGTGGATTGT 801 TCTAGACTTTTAATTTTTTTAGCTGCCATTTAAGCATTCCTGTGGCACCCATCACCATTTCAATTTAATTGTTTACTTTG 881 AAGCGGTTTTTGCAAATTCATATTACTTAAGCAGAGGGAGAGAACCTCTACTGATCAGAGCATCTAAACCTGTGTGATCT 961 AAGGTTTATCAGCCTCTGCAAGGAGCTTTGTCCCATCGTGCTTCCATTCCCAGGAGGGGGAGCTTGGAGCGAGTCAGTCC 1041 TGGGGCTTGCTGACATGGGTGGCCCATTGGAAAGGAGAACCAGGTCAGATGATGTAACAGCCCCAAGGAGCAGCAGGCAT 1121 GGGTCCCTCCATCCTTGGGCTTCCCGGGCCCCTGTGACAGGGGAAAGGGCTCTCTTACACCGCACTCAGGGAGACCACTT 1201 CTCAGGATGGGGTCAGATGGAGAGACCTCTAGGGAGAAAGACATCCCCATTGTGTGAGTGGCATTTCCTTAAGCTGGCAG 1281 GAACAGGGAGCAGCCCTGTGTCGGGGGCTGGAATAGTTCTGGCCAGACCCCGTTCCCCTTCCTCTATGAAGGAATAAGTT 1361 GGACCAAGGGAAGTCGGGGACGTAAAAAATGAAGCAAAACAATGCCAGGGTGTCTCCCGCTTTACTCTTCAGGAATGGTG 1441 TCCCAAGTTGGAGGCTTTGTGTCAGCTGCAAATCCTACCAGTTATGTCCAAGAATGGCTTTCCCTCGGGCAGGTGGCAGC 1521 GGCCATCTCCCACTGGGAATATGGCGTAGTATCTCCGGTCCATTCCTTGGATGCTAAGGACTGCGGGAATGAGGGAGTCA 1601 GATAAAGAACAAACCTCGAAACGAACAGTTAAATTGAAATGCTATGTGCCTGACCCAATGGTAGGCACATAGTAGGCACT 1681 CAACTCATATGTTTAATTGAATTGAAAATATCCCTTAGGAAAAAAAAAAAACACACAAAAAACCACAAGAGCCCCAGCCA 1761 GTTTACTCCAGGTAGATTTCCACAATATGCAAAGTGGTGGTGGGGTCAAGACAGATGACACCAGCACTTTAAACTCTTTG 1841 TGTGGGTATGCGTGGGTGTATGTTTGGGAAGAAAAACAAAGGTGCAGACTATCTTCCTTTTTTTCTTCTTCAGCCTCCAT 1921 CCCTGGCCTCCTCCCCTCACACACACTGGACTTGGTACAAAATGTCGGTGTGGTCCTAGATGAAGCATTGGGGTGGGGGA 2001 GGGAGAGGGAGCTTTGTGTTAAGTGCCTACTGGAAATGCACTGTGGGGTTTTTTCCTGTATGGGAAACCATTTATGCCAA 2081 GCTTTTCCCCATTTCCCATATTTATCTCATCTGGTTAGCTGCCTCTGCTTCCAGCTTTGTGTAATTCTCTTTGCCAGCTG 2161 CACAAAGCTGATTTTTTCCAAAGTCTAAAGACTGAGCTCACCTGGCTAGATTGTTGTGTGTTTTGTTGAATTTTTTCATA 2241 ATGTAATGCCGTATTTATTGTTTTTAAAATGAAAGGAATACTAATAAGTCTTAAAAGTTCCTTCATGCATAAGATTTTTT 2321 TCCAGTTACTGGGTTTAACTGGTGTACATTAATTAGATGTCCATACTGTATTTTGTTTGCATTAAGTAATTTTCTTTTTG 2401 ACTTAGTATCCGGCACACAAAGTGGGTTAGTACTACAGTATTTGCGTTACTTTAAGTACTAAGTATGCAGGTTTCCTGGT 2481 ACCATTGAGTTGCTGCTATTAAAGCTCACACACGAAATGGCTAAAAGTTACAAGTGTGCAAATTATGACTGCGTGAGCCT 2561 TAGAAAATAAAATGTATAAAGGGCAACACATGAGCTGTCAAACAGTGTTAGGAGTGTGTTTATATGTACAGAGTTGTGCA 2641 TAGCAATCGTTTTATTTAAGTTGATATGTAGTCTACTCACATTTTCATTATTTAGCAATTTTGTACAAAAATAGCAATTA 2721 ATTTGTAAACACTGCCAGAATACTTTCTAGCTGCTTTGTAATTTTTTAAGAGTGTTATTTTGTTTTTGTTTTTCTGTTCT 2801 TTGTTGTGGCTCTTGTTTTCATTTTTGTTGTACGTGTAGATCTGTAAATAAAATTGCAGTATTTAAAGCTTAAGCTTTCA 2881 GGAAAAAGAAAATAAGAATTCAGTGTGTGCATGACAACTCGTGTGTATGAGAAGGAGGGATATGAAGGAAGATGGCTTGC 2961 AGAGTAAGTCGGGTGGCAATTGTCAGGGTGTGGGAATTTCTTTTCCTACGGGGTACGTGATTTTGTAAAAAGGAAGTATT 3041 TCTCCCAAAATTGGGAGTAGGCAAACTACTAATCAGTTTAGCTTTGTGTTGTATGCTAGTTTAAAAAAGAAAATATGTAA 3121 TATAATGTAAAAAAAAACAAAAAAAAGCTTTTATGATGGATTTTGTAAATAGATTTGTTACAGGGTGACCTGTTCTCTAG 3201 CTGTGATCTTACCACTTCAAATGGGTGTAATTTGAATAAATTTTGTATGGTAAAGGATCAATAAAATGATTTTTTTTAAG 3281 AGTTAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | |||||||||
| Validation Method |
|
|||||||||
| Conditions | HEK293 | |||||||||
| Disease | 1871.0 | |||||||||
| Location of target site | 3'UTR | |||||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | |||||||||
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
|||||||||
| miRNA-target interactions (Provided by authors) |
|
|||||||||
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
|||||||||
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | TZM-bl |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HCT116 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177609. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_11
PAR-CLIP data was present in ERX177628. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_6
PAR-CLIP data was present in ERX177599. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_1
PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5
PAR-CLIP data was present in ERX177604. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_6
PAR-CLIP data was present in ERX177605. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_7
PAR-CLIP data was present in ERX177606. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_8
PAR-CLIP data was present in ERX177615. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_5
PAR-CLIP data was present in ERX177616. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_6
PAR-CLIP data was present in ERX177617. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_7
PAR-CLIP data was present in ERX177621. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_11
PAR-CLIP data was present in ERX177627. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_5
PAR-CLIP data was present in ERX177629. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_7
PAR-CLIP data was present in ERX177630. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_8
PAR-CLIP data was present in ERX177633. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_11
PAR-CLIP data was present in ERX177618. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_8
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
| Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | Prostate Tissue |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760638. RNA binding protein: AGO2. Condition:AGO-CLIP-PC3-miR148
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
| Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
| CLIP-seq Support 1 for dataset GSM714645 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repB |
| Location of target site | ENST00000346618.3 | 3UTR | CUUUUCCCCAUUUCCCAUAUUUAUCUCAUCUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM1462574 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000346618.3 | 3UTR | CCAAGCUUUUCCCCAUUUCCCAUAUUUAUCUCAUCUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
161 hsa-miR-6733-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT075325 | SF3B3 | splicing factor 3b subunit 3 |  |
|
2 | 4 | ||||||
| MIRT082764 | EPN1 | epsin 1 | |
|
2 | 4 | ||||||
| MIRT119868 | NRBP1 | nuclear receptor binding protein 1 | |
|
2 | 2 | ||||||
| MIRT124577 | PRRC2B | proline rich coiled-coil 2B | |
|
2 | 2 | ||||||
| MIRT126718 | WAC | WW domain containing adaptor with coiled-coil | |
|
2 | 2 | ||||||
| MIRT128925 | KMT2A | lysine methyltransferase 2A | |
|
2 | 2 | ||||||
| MIRT135191 | TMBIM6 | transmembrane BAX inhibitor motif containing 6 | |
|
2 | 2 | ||||||
| MIRT145630 | LASP1 | LIM and SH3 protein 1 | |
|
2 | 2 | ||||||
| MIRT175518 | ZBTB33 | zinc finger and BTB domain containing 33 | |
|
2 | 4 | ||||||
| MIRT188406 | ATXN7L3B | ataxin 7 like 3B | |
|
2 | 2 | ||||||
| MIRT192486 | KNSTRN | kinetochore localized astrin/SPAG5 binding protein | |
|
2 | 2 | ||||||
| MIRT208383 | SLC25A36 | solute carrier family 25 member 36 | |
|
2 | 2 | ||||||
| MIRT216690 | F2R | coagulation factor II thrombin receptor | |
|
2 | 2 | ||||||
| MIRT235839 | FAM217B | family with sequence similarity 217 member B | |
|
2 | 2 | ||||||
| MIRT257000 | RGMB | repulsive guidance molecule family member b | |
|
2 | 2 | ||||||
| MIRT266594 | POGZ | pogo transposable element derived with ZNF domain | |
|
2 | 2 | ||||||
| MIRT273614 | SP1 | Sp1 transcription factor | |
|
2 | 2 | ||||||
| MIRT276567 | AKAP11 | A-kinase anchoring protein 11 | |
|
2 | 2 | ||||||
| MIRT285544 | CDT1 | chromatin licensing and DNA replication factor 1 | |
|
2 | 2 | ||||||
| MIRT291540 | LRRC8B | leucine rich repeat containing 8 VRAC subunit B | |
|
2 | 2 | ||||||
| MIRT317159 | E2F3 | E2F transcription factor 3 | |
|
2 | 4 | ||||||
| MIRT340688 | THRAP3 | thyroid hormone receptor associated protein 3 | |
|
2 | 2 | ||||||
| MIRT366934 | OGT | O-linked N-acetylglucosamine (GlcNAc) transferase | |
|
2 | 2 | ||||||
| MIRT376193 | AP1M1 | adaptor related protein complex 1 mu 1 subunit | |
|
2 | 2 | ||||||
| MIRT441983 | TSTD2 | thiosulfate sulfurtransferase like domain containing 2 | |
|
2 | 2 | ||||||
| MIRT442059 | POU3F2 | POU class 3 homeobox 2 | |
|
2 | 6 | ||||||
| MIRT443190 | PDHA1 | pyruvate dehydrogenase E1 alpha 1 subunit | |
|
2 | 2 | ||||||
| MIRT445133 | CMTM4 | CKLF like MARVEL transmembrane domain containing 4 | |
|
2 | 2 | ||||||
| MIRT445881 | WBP1L | WW domain binding protein 1 like | |
|
2 | 2 | ||||||
| MIRT449359 | DPP6 | dipeptidyl peptidase like 6 | |
|
2 | 2 | ||||||
| MIRT451399 | FARSA | phenylalanyl-tRNA synthetase alpha subunit | |
|
2 | 2 | ||||||
| MIRT451802 | CDCA3 | cell division cycle associated 3 | |
|
2 | 4 | ||||||
| MIRT452295 | EIF5AL1 | eukaryotic translation initiation factor 5A-like 1 | |
|
2 | 2 | ||||||
| MIRT452494 | HMGXB3 | HMG-box containing 3 | |
|
2 | 2 | ||||||
| MIRT453354 | ZNF3 | zinc finger protein 3 | |
|
2 | 2 | ||||||
| MIRT453375 | CACNA2D2 | calcium voltage-gated channel auxiliary subunit alpha2delta 2 | |
|
2 | 2 | ||||||
| MIRT453719 | RAP1GDS1 | Rap1 GTPase-GDP dissociation stimulator 1 | |
|
2 | 2 | ||||||
| MIRT453839 | SDK1 | sidekick cell adhesion molecule 1 | |
|
2 | 2 | ||||||
| MIRT454009 | ALKBH5 | alkB homolog 5, RNA demethylase | |
|
2 | 2 | ||||||
| MIRT454371 | PIGS | phosphatidylinositol glycan anchor biosynthesis class S | |
|
2 | 2 | ||||||
| MIRT454729 | ARSK | arylsulfatase family member K | |
|
2 | 2 | ||||||
| MIRT455227 | KIAA2013 | KIAA2013 | |
|
2 | 2 | ||||||
| MIRT455866 | SLC35C2 | solute carrier family 35 member C2 | |
|
2 | 2 | ||||||
| MIRT456386 | KLHL12 | kelch like family member 12 | |
|
2 | 2 | ||||||
| MIRT457017 | ACADSB | acyl-CoA dehydrogenase, short/branched chain | |
|
2 | 2 | ||||||
| MIRT457048 | NEGR1 | neuronal growth regulator 1 | |
|
2 | 2 | ||||||
| MIRT457402 | BACE2 | beta-site APP-cleaving enzyme 2 | |
|
2 | 2 | ||||||
| MIRT457808 | KLHL25 | kelch like family member 25 | |
|
2 | 2 | ||||||
| MIRT458361 | C3orf80 | chromosome 3 open reading frame 80 | |
|
2 | 2 | ||||||
| MIRT458678 | MRI1 | methylthioribose-1-phosphate isomerase 1 | |
|
2 | 2 | ||||||
| MIRT459629 | GABARAP | GABA type A receptor-associated protein | |
|
2 | 2 | ||||||
| MIRT460955 | MUL1 | mitochondrial E3 ubiquitin protein ligase 1 | |
|
2 | 2 | ||||||
| MIRT462241 | PRSS16 | protease, serine 16 | |
|
2 | 2 | ||||||
| MIRT462472 | FIZ1 | FLT3 interacting zinc finger 1 | |
|
2 | 2 | ||||||
| MIRT462572 | STS | steroid sulfatase | |
|
2 | 2 | ||||||
| MIRT462931 | ZNF827 | zinc finger protein 827 | |
|
2 | 2 | ||||||
| MIRT463442 | ZC3HAV1L | zinc finger CCCH-type containing, antiviral 1 like | |
|
2 | 2 | ||||||
| MIRT464129 | VPS35 | VPS35, retromer complex component | |
|
2 | 2 | ||||||
| MIRT464688 | UBE2V1 | ubiquitin conjugating enzyme E2 V1 | |
|
2 | 2 | ||||||
| MIRT465653 | TNPO2 | transportin 2 | |
|
2 | 2 | ||||||
| MIRT465951 | TMEM189-UBE2V1 | TMEM189-UBE2V1 readthrough | |
|
2 | 2 | ||||||
| MIRT466032 | TMEM189 | transmembrane protein 189 | |
|
2 | 2 | ||||||
| MIRT466577 | TBC1D2B | TBC1 domain family member 2B | |
|
2 | 2 | ||||||
| MIRT467506 | SMG1 | SMG1, nonsense mediated mRNA decay associated PI3K related kinase | |
|
2 | 2 | ||||||
| MIRT467786 | SLC2A14 | solute carrier family 2 member 14 | |
|
2 | 2 | ||||||
| MIRT468104 | SH3TC2 | SH3 domain and tetratricopeptide repeats 2 | |
|
2 | 2 | ||||||
| MIRT468292 | SFT2D2 | SFT2 domain containing 2 | |
|
2 | 2 | ||||||
| MIRT469004 | RNF41 | ring finger protein 41 | |
|
2 | 2 | ||||||
| MIRT469753 | RAB2B | RAB2B, member RAS oncogene family | |
|
2 | 2 | ||||||
| MIRT473205 | MINK1 | misshapen like kinase 1 | |
|
2 | 4 | ||||||
| MIRT473314 | MEX3A | mex-3 RNA binding family member A | |
|
2 | 2 | ||||||
| MIRT473549 | MAVS | mitochondrial antiviral signaling protein | |
|
2 | 2 | ||||||
| MIRT474269 | LATS2 | large tumor suppressor kinase 2 | |
|
2 | 2 | ||||||
| MIRT475111 | IPPK | inositol-pentakisphosphate 2-kinase | |
|
2 | 2 | ||||||
| MIRT475436 | HYOU1 | hypoxia up-regulated 1 | |
|
2 | 2 | ||||||
| MIRT475751 | HDLBP | high density lipoprotein binding protein | |
|
2 | 2 | ||||||
| MIRT475972 | GTPBP2 | GTP binding protein 2 | |
|
2 | 2 | ||||||
| MIRT476480 | GATAD2A | GATA zinc finger domain containing 2A | |
|
2 | 2 | ||||||
| MIRT476595 | G3BP1 | G3BP stress granule assembly factor 1 | |
|
2 | 2 | ||||||
| MIRT476684 | FURIN | furin, paired basic amino acid cleaving enzyme | |
|
2 | 2 | ||||||
| MIRT477261 | ERGIC2 | ERGIC and golgi 2 | |
|
2 | 2 | ||||||
| MIRT477647 | EFNA1 | ephrin A1 | |
|
2 | 2 | ||||||
| MIRT477790 | E2F2 | E2F transcription factor 2 | |
|
2 | 2 | ||||||
| MIRT477871 | DYRK2 | dual specificity tyrosine phosphorylation regulated kinase 2 | |
|
2 | 2 | ||||||
| MIRT478012 | DNAJC8 | DnaJ heat shock protein family (Hsp40) member C8 | |
|
2 | 2 | ||||||
| MIRT479558 | CDC5L | cell division cycle 5 like | |
|
2 | 4 | ||||||
| MIRT480420 | C17orf85 | nuclear cap binding subunit 3 | |
|
2 | 2 | ||||||
| MIRT480642 | BSCL2 | BSCL2, seipin lipid droplet biogenesis associated | |
|
2 | 2 | ||||||
| MIRT480778 | BMP2 | bone morphogenetic protein 2 | |
|
2 | 2 | ||||||
| MIRT481554 | ARL10 | ADP ribosylation factor like GTPase 10 | |
|
2 | 2 | ||||||
| MIRT481689 | AR | androgen receptor | |
|
2 | 2 | ||||||
| MIRT481836 | AP1S1 | adaptor related protein complex 1 sigma 1 subunit | |
|
2 | 2 | ||||||
| MIRT483138 | FOXC1 | forkhead box C1 | |
|
2 | 2 | ||||||
| MIRT483919 | SPSB1 | splA/ryanodine receptor domain and SOCS box containing 1 | |
|
2 | 2 | ||||||
| MIRT484202 | SUMO1 | small ubiquitin-like modifier 1 | |
|
2 | 2 | ||||||
| MIRT484433 | RAB7A | RAB7A, member RAS oncogene family | |
|
2 | 4 | ||||||
| MIRT485544 | GP5 | glycoprotein V platelet | |
|
2 | 2 | ||||||
| MIRT486558 | SLC38A4 | solute carrier family 38 member 4 | |
|
2 | 2 | ||||||
| MIRT486727 | MGAT5B | mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B | |
|
2 | 4 | ||||||
| MIRT490490 | GLRA3 | glycine receptor alpha 3 | |
|
2 | 2 | ||||||
| MIRT490682 | SSTR1 | somatostatin receptor 1 | |
|
2 | 2 | ||||||
| MIRT490792 | PSMD3 | proteasome 26S subunit, non-ATPase 3 | |
|
2 | 2 | ||||||
| MIRT491060 | ACVR1B | activin A receptor type 1B | |
|
2 | 4 | ||||||
| MIRT492614 | PNRC1 | proline rich nuclear receptor coactivator 1 | |
|
2 | 2 | ||||||
| MIRT492768 | PDGFB | platelet derived growth factor subunit B | |
|
2 | 2 | ||||||
| MIRT493988 | EHD1 | EH domain containing 1 | |
|
2 | 2 | ||||||
| MIRT494510 | BDNF-AS | BDNF antisense RNA | |
|
2 | 2 | ||||||
| MIRT494755 | AP3M2 | adaptor related protein complex 3 mu 2 subunit | |
|
2 | 2 | ||||||
| MIRT499802 | LONRF3 | LON peptidase N-terminal domain and ring finger 3 | |
|
2 | 2 | ||||||
| MIRT501336 | RNF44 | ring finger protein 44 | |
|
2 | 4 | ||||||
| MIRT509490 | CENPA | centromere protein A | |
|
2 | 2 | ||||||
| MIRT509643 | ZNF354B | zinc finger protein 354B | |
|
2 | 10 | ||||||
| MIRT510147 | PDGFRA | platelet derived growth factor receptor alpha | |
|
2 | 4 | ||||||
| MIRT510567 | UNG | uracil DNA glycosylase | |
|
2 | 6 | ||||||
| MIRT525087 | FRK | fyn related Src family tyrosine kinase | |
|
2 | 2 | ||||||
| MIRT528452 | NXT2 | nuclear transport factor 2 like export factor 2 | |
|
2 | 4 | ||||||
| MIRT531970 | C12orf49 | chromosome 12 open reading frame 49 | |
|
2 | 2 | ||||||
| MIRT532084 | RTTN | rotatin | |
|
2 | 2 | ||||||
| MIRT532756 | LDHD | lactate dehydrogenase D | |
|
2 | 2 | ||||||
| MIRT535072 | PPP1R15B | protein phosphatase 1 regulatory subunit 15B | |
|
2 | 2 | ||||||
| MIRT535637 | NPEPPS | aminopeptidase puromycin sensitive | |
|
2 | 2 | ||||||
| MIRT545410 | EIF4A3 | eukaryotic translation initiation factor 4A3 | |
|
2 | 4 | ||||||
| MIRT545911 | ZFP91 | ZFP91 zinc finger protein | |
|
2 | 4 | ||||||
| MIRT548007 | GRB2 | growth factor receptor bound protein 2 | |
|
2 | 4 | ||||||
| MIRT548545 | DR1 | down-regulator of transcription 1 | |
|
2 | 2 | ||||||
| MIRT550075 | TRAPPC2 | trafficking protein particle complex 2 | |
|
2 | 2 | ||||||
| MIRT553730 | TBRG1 | transforming growth factor beta regulator 1 | |
|
2 | 2 | ||||||
| MIRT557569 | GNPTAB | N-acetylglucosamine-1-phosphate transferase alpha and beta subunits | |
|
2 | 2 | ||||||
| MIRT558025 | EXT1 | exostosin glycosyltransferase 1 | |
|
2 | 2 | ||||||
| MIRT558139 | ENC1 | ectodermal-neural cortex 1 | |
|
2 | 2 | ||||||
| MIRT560173 | COA1 | cytochrome c oxidase assembly factor 1 homolog | |
|
2 | 2 | ||||||
| MIRT561700 | PTP4A1 | protein tyrosine phosphatase type IVA, member 1 | |
|
2 | 2 | ||||||
| MIRT565101 | UBE3C | ubiquitin protein ligase E3C | |
|
2 | 2 | ||||||
| MIRT565739 | SESN3 | sestrin 3 | |
|
2 | 2 | ||||||
| MIRT566669 | NACC2 | NACC family member 2 | |
|
2 | 2 | ||||||
| MIRT567040 | KCNB1 | potassium voltage-gated channel subfamily B member 1 | |
|
2 | 2 | ||||||
| MIRT569627 | ZNF746 | zinc finger protein 746 | |
|
2 | 2 | ||||||
| MIRT570530 | RPH3A | rabphilin 3A | |
|
2 | 2 | ||||||
| MIRT570939 | CPE | carboxypeptidase E | |
|
2 | 2 | ||||||
| MIRT574774 | FGF2 | fibroblast growth factor 2 | |
|
2 | 2 | ||||||
| MIRT620120 | LACC1 | laccase domain containing 1 | |
|
2 | 2 | ||||||
| MIRT624338 | CISD1 | CDGSH iron sulfur domain 1 | |
|
2 | 2 | ||||||
| MIRT625434 | RMDN1 | regulator of microtubule dynamics 1 | |
|
2 | 2 | ||||||
| MIRT640528 | TET3 | tet methylcytosine dioxygenase 3 | |
|
2 | 4 | ||||||
| MIRT646916 | TRIM14 | tripartite motif containing 14 | |
|
2 | 2 | ||||||
| MIRT656298 | METTL1 | methyltransferase like 1 | |
|
2 | 2 | ||||||
| MIRT660192 | BMPR1A | bone morphogenetic protein receptor type 1A | |
|
2 | 2 | ||||||
| MIRT661360 | DYRK4 | dual specificity tyrosine phosphorylation regulated kinase 4 | |
|
2 | 2 | ||||||
| MIRT667769 | KCTD11 | potassium channel tetramerization domain containing 11 | |
|
2 | 2 | ||||||
| MIRT683187 | TAF1D | TATA-box binding protein associated factor, RNA polymerase I subunit D | |
|
2 | 2 | ||||||
| MIRT685843 | ANGEL1 | angel homolog 1 | |
|
2 | 2 | ||||||
| MIRT688553 | DCAF16 | DDB1 and CUL4 associated factor 16 | |
|
2 | 2 | ||||||
| MIRT689424 | CYB561 | cytochrome b561 | |
|
2 | 2 | ||||||
| MIRT698505 | TGFBR1 | transforming growth factor beta receptor 1 | |
|
2 | 2 | ||||||
| MIRT701232 | OCRL | OCRL, inositol polyphosphate-5-phosphatase | |
|
2 | 2 | ||||||
| MIRT702506 | KDELR1 | KDEL endoplasmic reticulum protein retention receptor 1 | |
|
2 | 2 | ||||||
| MIRT706488 | SEPT6 | septin 6 | |
|
2 | 2 | ||||||
| MIRT713774 | ZNF460 | zinc finger protein 460 | |
|
2 | 2 | ||||||
| MIRT716991 | ARL6IP4 | ADP ribosylation factor like GTPase 6 interacting protein 4 | |
|
2 | 2 | ||||||
| MIRT722644 | MPEG1 | macrophage expressed 1 | |
|
2 | 2 | ||||||
| MIRT725254 | PARVB | parvin beta | |
|
2 | 2 | ||||||
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|