miRTarBase - #MIRT318016


—
pre-miRNA Information
pre-miRNA hsa-mir-7161   
Genomic Coordinates chr6: 158609707 - 158609790
Description Homo sapiens miR-7161 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-7161-5p
Sequence 1| UAAAGACUGUAGAGGCAACUGGU |23
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1198027002 1 dbSNP
rs530077902 10 dbSNP
rs1446817450 13 dbSNP
rs774892048 14 dbSNP
rs1438482648 16 dbSNP
rs1167166990 19 dbSNP
rs760372681 19 dbSNP
Putative Targets

Gene Information
Gene Symbol CENPQ   
Synonyms C6orf139, CENP-Q
Description centromere protein Q
Transcript NM_018132   
Expression
Putative miRNA Targets on CENPQ
3'UTR of CENPQ
(miRNA target sites are highlighted)		 
>CENPQ|NM_018132|3'UTR
   1 AGAGTGTTTTTTTTTTAGATTGTTCCATATTAATTTAATGTTCGTGAATTTGTAAAACTGTTAACCTATGATTATATGTA
  81 CAGAGGCTAAGGCTTCTGCAGGATTTATTATCTCCTGATATGCACTTTAAAATTAGTCTTTGTAGTTCTATCATTAGCAT
 161 CTAATGTAGTTCTGAAGACTGTTTTTAGCAGTTGCCAAATCTAGGAAACTAACATTTATATTGCTGTATCTATAAGTATT
 241 TGCCTAAAACCATAAAATAGGAATTGCCTTAAGGATCTAATAGTTTATAATGCCTGAATGGAACTCATTTATTGGTTAAC
 321 AGCTCATATCAGGAGCTGTGATAAGTAAGTGTTTACATACACTGTCTAGTGCATAAAAACCTTAGTGTTTGCTATCATTC
 401 ATTCTGTAGCCAATGGCTTACAGTTTCTGTCTGGTCATCTGGAACTTGAAAAATCCTCAAATGCCTTCACTCTTTTACCT
 481 AACTCCCTAGTCTTTTTGGGAAGTAGTTAAGATATGCCTGCTATCTTTAACTTTGGAGGTAGTATCAAAATTTTACTTCT
 561 TTGGTTGTTTAGTGAATTAATGTTGAATATTTTCTACTGTCATCAAAACATATTCCCAAAAAGTATTAAAAAGGAACCTT
 641 AGCACATTTATTTTATTAAAACAAGAAAACCCAAAATATATAAACCTTTTCTTATTATGATAATAAGCTTATATATGTGA
 721 ATAAGTTATAACCTAGTGTATAAAAAATTATTTCTAACAAACTACAGTATACTGTCTTGGGTTTTTTTTTTTTTTTTTAG
 801 TCTGTAAAATAAAATGACTGCAATTACTTTTTAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uggucaACG-GAGAU----GUCAGAAAu 5'
                ||| ||:||    :||||||| 
Target 5' ctgataTGCACTTTAAAATTAGTCTTTg 3'
 115 - 142 155.00 -13.40
2 
miRNA  3' uggucAACGGA--GAUG--UCAGAAAu 5'
               || |||  || |  ||||||| 
Target 5' ctcttTTACCTAACTCCCTAGTCTTTt 3'
 470 - 496 154.00 -13.30
3 
miRNA  3' ugguCAACGGAGAUG-UCAGAAAu 5'
              | ||: ||||: ||| ||| 
Target 5' tattGCTGTATCTATAAGTATTTg 3'
 219 - 242 131.00 -7.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN20121477 17 COSMIC
COSN28836884 17 COSMIC
COSN30525823 26 COSMIC
COSN30472026 27 COSMIC
COSN28638294 87 COSMIC
COSN30545018 104 COSMIC
COSN31584035 146 COSMIC
COSN29628702 347 COSMIC
COSN21965081 489 COSMIC
COSN28815214 490 COSMIC
COSN31529231 592 COSMIC
COSN31608014 649 COSMIC
COSN20481287 662 COSMIC
COSN20480250 663 COSMIC
COSN18723422 780 COSMIC
COSN19186169 783 COSMIC
COSN20445867 785 COSMIC
COSN20091396 787 COSMIC
COSN20102925 799 COSMIC
rs1471539 165 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs568913239 2 dbSNP
rs1173532002 3 dbSNP
rs144722464 7 dbSNP
rs749100991 7 dbSNP
rs749945343 7 dbSNP
rs756060282 7 dbSNP
rs780812513 7 dbSNP
rs1449710950 8 dbSNP
rs1001661654 17 dbSNP
rs1438195867 18 dbSNP
rs1305211469 19 dbSNP
rs757236888 20 dbSNP
rs1220188875 23 dbSNP
rs778793747 26 dbSNP
rs745976688 28 dbSNP
rs1181557822 35 dbSNP
rs368444649 39 dbSNP
rs1384532907 43 dbSNP
rs766685297 44 dbSNP
rs372696964 45 dbSNP
rs1203804952 46 dbSNP
rs768918489 47 dbSNP
rs962262257 63 dbSNP
rs995067451 75 dbSNP
rs554533571 76 dbSNP
rs1028265308 81 dbSNP
rs953562739 84 dbSNP
rs985655912 99 dbSNP
rs566787635 103 dbSNP
rs533830395 106 dbSNP
rs1241827743 112 dbSNP
rs893363175 121 dbSNP
rs910935955 136 dbSNP
rs1359027369 143 dbSNP
rs549568758 158 dbSNP
rs1230214521 160 dbSNP
rs1380417173 162 dbSNP
rs1471539 165 dbSNP
rs976361250 169 dbSNP
rs1372885230 178 dbSNP
rs377241945 180 dbSNP
rs1429781902 182 dbSNP
rs1172418648 201 dbSNP
rs1162320018 202 dbSNP
rs576936215 212 dbSNP
rs1425174594 213 dbSNP
rs781715553 214 dbSNP
rs998006976 222 dbSNP
rs1360778275 225 dbSNP
rs753334995 226 dbSNP
rs1402011563 227 dbSNP
rs1053696956 233 dbSNP
rs1183030660 234 dbSNP
rs1490219889 237 dbSNP
rs953472461 245 dbSNP
rs1224137039 246 dbSNP
rs915097175 250 dbSNP
rs1322481297 251 dbSNP
rs1284023775 252 dbSNP
rs1430601440 253 dbSNP
rs1316042194 261 dbSNP
rs947872690 266 dbSNP
rs1045564343 268 dbSNP
rs906586984 274 dbSNP
rs1289570263 277 dbSNP
rs756813288 278 dbSNP
rs1471538 281 dbSNP
rs1291284949 284 dbSNP
rs1459127266 286 dbSNP
rs897814725 291 dbSNP
rs556255367 294 dbSNP
rs1158135898 297 dbSNP
rs1455411967 301 dbSNP
rs1027904966 316 dbSNP
rs889287879 326 dbSNP
rs1159889772 329 dbSNP
rs1233690956 333 dbSNP
rs917563980 334 dbSNP
rs949118717 337 dbSNP
rs778844666 345 dbSNP
rs1488941601 352 dbSNP
rs980846365 366 dbSNP
rs926324823 372 dbSNP
rs1331720126 373 dbSNP
rs1269148561 395 dbSNP
rs936417159 401 dbSNP
rs1054604391 406 dbSNP
rs893332081 411 dbSNP
rs1284084055 430 dbSNP
rs1287970078 465 dbSNP
rs1432423376 466 dbSNP
rs1390640890 468 dbSNP
rs183888285 470 dbSNP
rs1201700376 471 dbSNP
rs11554555 473 dbSNP
rs1375840535 484 dbSNP
rs148692494 485 dbSNP
rs1433875779 513 dbSNP
rs1418832806 517 dbSNP
rs1017994157 522 dbSNP
rs1454173395 524 dbSNP
rs1192465999 529 dbSNP
rs1380367258 530 dbSNP
rs1249105167 535 dbSNP
rs997494428 556 dbSNP
rs965075326 559 dbSNP
rs889177771 561 dbSNP
rs766353022 563 dbSNP
rs532059725 565 dbSNP
rs1312284208 569 dbSNP
rs1016040486 571 dbSNP
rs758166325 575 dbSNP
rs1165523072 594 dbSNP
rs551649425 601 dbSNP
rs1366906157 610 dbSNP
rs956366863 621 dbSNP
rs1451609006 624 dbSNP
rs961935500 637 dbSNP
rs1304537329 643 dbSNP
rs1466434122 644 dbSNP
rs1354016237 646 dbSNP
rs541896969 647 dbSNP
rs1405773097 651 dbSNP
rs1166791239 670 dbSNP
rs1327613492 681 dbSNP
rs779723572 687 dbSNP
rs1414495870 688 dbSNP
rs915127676 692 dbSNP
rs1422464341 696 dbSNP
rs947893554 699 dbSNP
rs980606921 700 dbSNP
rs1201539603 701 dbSNP
rs971057961 705 dbSNP
rs1480591966 715 dbSNP
rs1273362508 717 dbSNP
rs980403507 729 dbSNP
rs559869048 736 dbSNP
rs528813777 739 dbSNP
rs540535000 741 dbSNP
rs1244724873 748 dbSNP
rs189396607 755 dbSNP
rs936387438 756 dbSNP
rs989257802 760 dbSNP
rs1237222551 765 dbSNP
rs1395666442 766 dbSNP
rs1306309868 773 dbSNP
rs1431669591 774 dbSNP
rs199576942 779 dbSNP
rs796542803 780 dbSNP
rs11335563 782 dbSNP
rs1163198121 782 dbSNP
rs1188667175 782 dbSNP
rs1366230412 782 dbSNP
rs568958575 782 dbSNP
rs1357257030 784 dbSNP
rs78512419 784 dbSNP
rs3209645 785 dbSNP
rs200487614 786 dbSNP
rs1346416887 787 dbSNP
rs1199806655 788 dbSNP
rs1238308240 789 dbSNP
rs1208875701 792 dbSNP
rs914722569 793 dbSNP
rs1178995471 798 dbSNP
rs1335137640 799 dbSNP
rs756408768 799 dbSNP
rs1362888243 800 dbSNP
rs1311795811 801 dbSNP
rs1042287142 802 dbSNP
rs1048984177 803 dbSNP
rs1415389584 805 dbSNP
rs1460912869 807 dbSNP
rs1331934607 814 dbSNP
rs1398783927 820 dbSNP
rs902066598 823 dbSNP
rs1328194856 827 dbSNP
rs1341297469 828 dbSNP
rs1410155059 829 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000335783.3 | 3UTR | CCUUCACUCUUUUACCUAACUCCCUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
94 hsa-miR-7161-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT131193 INCENP inner centromere protein 2 4
MIRT318016 CENPQ centromere protein Q 2 2
MIRT405275 ZNF678 zinc finger protein 678 2 2
MIRT442570 CCDC59 coiled-coil domain containing 59 2 2
MIRT442611 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT444013 GOLGA8H golgin A8 family member H 2 2
MIRT444024 GOLGA8M golgin A8 family member M 2 2
MIRT444339 GOLGA6L4 golgin A6 family-like 4 2 2
MIRT444611 GOLGA6L10 golgin A6 family-like 10 2 2
MIRT446342 MAN1A2 mannosidase alpha class 1A member 2 2 2
MIRT446558 GOLGA8J golgin A8 family member J 2 2
MIRT447671 PACSIN2 protein kinase C and casein kinase substrate in neurons 2 2 2
MIRT447975 MSH6 mutS homolog 6 2 2
MIRT448895 CNNM3 cyclin and CBS domain divalent metal cation transport mediator 3 2 2
MIRT448936 CHD7 chromodomain helicase DNA binding protein 7 2 2
MIRT449414 TRIM5 tripartite motif containing 5 2 2
MIRT450291 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 2 2
MIRT454877 PCNA proliferating cell nuclear antigen 2 4
MIRT456615 SFMBT2 Scm like with four mbt domains 2 2 2
MIRT462108 TMEM214 transmembrane protein 214 2 2
MIRT471923 NRAS NRAS proto-oncogene, GTPase 2 4
MIRT474437 KLHL21 kelch like family member 21 2 2
MIRT476600 G3BP1 G3BP stress granule assembly factor 1 2 2
MIRT480573 BZW1 basic leucine zipper and W2 domains 1 2 2
MIRT483890 IL20RB interleukin 20 receptor subunit beta 2 6
MIRT493363 KIF5B kinesin family member 5B 2 2
MIRT494934 TMEM167A transmembrane protein 167A 2 2
MIRT495915 CLDN1 claudin 1 2 2
MIRT501574 PLEKHF2 pleckstrin homology and FYVE domain containing 2 2 4
MIRT502193 IGF1R insulin like growth factor 1 receptor 2 4
MIRT502928 CDC42SE1 CDC42 small effector 1 2 4
MIRT506393 NUCKS1 nuclear casein kinase and cyclin dependent kinase substrate 1 2 4
MIRT506570 MNX1 motor neuron and pancreas homeobox 1 2 4
MIRT509478 GNL3L G protein nucleolar 3 like 2 6
MIRT518537 FLCN folliculin 2 6
MIRT519577 ZNFX1 zinc finger NFX1-type containing 1 2 4
MIRT524088 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 4
MIRT524146 LDHD lactate dehydrogenase D 2 4
MIRT524659 C1orf50 chromosome 1 open reading frame 50 2 10
MIRT526324 UGT2A1 UDP glucuronosyltransferase family 2 member A1 complex locus 2 2
MIRT526566 UGT2A2 UDP glucuronosyltransferase family 2 member A2 2 2
MIRT526612 ZNF780A zinc finger protein 780A 2 4
MIRT526889 PLEKHG2 pleckstrin homology and RhoGEF domain containing G2 2 2
MIRT527115 ARHGAP15 Rho GTPase activating protein 15 2 2
MIRT528023 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT529589 TMEM220 transmembrane protein 220 2 2
MIRT532797 STYK1 serine/threonine/tyrosine kinase 1 2 2
MIRT537099 GPC6 glypican 6 2 2
MIRT539070 ATP6V1C1 ATPase H+ transporting V1 subunit C1 2 2
MIRT545495 DAPK2 death associated protein kinase 2 2 2
MIRT545814 ZNF608 zinc finger protein 608 2 4
MIRT553533 TMEM185B transmembrane protein 185B 2 4
MIRT557285 HIST2H2BE histone cluster 2 H2B family member e 2 2
MIRT559552 ARGLU1 arginine and glutamate rich 1 2 4
MIRT561069 EIF4A3 eukaryotic translation initiation factor 4A3 2 2
MIRT561710 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT561995 LRRC58 leucine rich repeat containing 58 2 2
MIRT565896 NHS NHS actin remodeling regulator 2 2
MIRT567333 HMGB1 high mobility group box 1 2 2
MIRT568042 CLDN12 claudin 12 2 2
MIRT568315 BAG4 BCL2 associated athanogene 4 2 2
MIRT570677 GFPT1 glutamine--fructose-6-phosphate transaminase 1 2 2
MIRT571047 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT571359 SFT2D2 SFT2 domain containing 2 2 2
MIRT571935 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT572786 ZNF277 zinc finger protein 277 2 2
MIRT573936 CNTNAP2 contactin associated protein like 2 2 2
MIRT576962 Anxa4 annexin A4 2 3
MIRT608297 KATNAL1 katanin catalytic subunit A1 like 1 2 2
MIRT613342 AFF1 AF4/FMR2 family member 1 2 2
MIRT613529 ANAPC7 anaphase promoting complex subunit 7 2 2
MIRT614705 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT616658 ORAI1 ORAI calcium release-activated calcium modulator 1 2 2
MIRT624731 ANXA4 annexin A4 2 3
MIRT626525 TSC1 TSC complex subunit 1 2 2
MIRT627647 SCN1A sodium voltage-gated channel alpha subunit 1 2 2
MIRT637423 EPB41L3 erythrocyte membrane protein band 4.1 like 3 2 2
MIRT641059 TCP11L1 t-complex 11 like 1 2 4
MIRT645591 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT646455 ZNF705A zinc finger protein 705A 2 2
MIRT656454 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT676551 TMPPE transmembrane protein with metallophosphoesterase domain 2 4
MIRT682720 KIAA1456 KIAA1456 2 2
MIRT698307 TMEM2 transmembrane protein 2 2 2
MIRT701906 MMGT1 membrane magnesium transporter 1 2 2
MIRT702228 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT708642 UBE2W ubiquitin conjugating enzyme E2 W 2 2
MIRT709326 HMBOX1 homeobox containing 1 2 2
MIRT711400 RANBP2 RAN binding protein 2 2 2
MIRT712130 TGFBR2 transforming growth factor beta receptor 2 2 2
MIRT714226 ARMC10 armadillo repeat containing 10 2 2
MIRT716914 CACNB2 calcium voltage-gated channel auxiliary subunit beta 2 2 2
MIRT723060 FGD6 FYVE, RhoGEF and PH domain containing 6 2 2
MIRT723846 MN1 MN1 proto-oncogene, transcriptional regulator 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-7161-5p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (HEYA8)

Error report submission