| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-4330 |
| Genomic Coordinates | chrX: 151168222 - 151168326 |
| Description | Homo sapiens miR-4330 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-4330 | ||||||||||||
| Sequence | 77| CCUCAGAUCAGAGCCUUGC |95 | ||||||||||||
| Evidence | Experimental | ||||||||||||
| Experiments | SOLiD | ||||||||||||
| SNPs in miRNA |
|
||||||||||||
| Putative Targets | |||||||||||||
| miRNA Expression profile | |
|---|---|
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | ZXDB | ||||||||||||||||||||
| Synonyms | ZNF905, dJ83L6.1 | ||||||||||||||||||||
| Description | zinc finger, X-linked, duplicated B | ||||||||||||||||||||
| Transcript | NM_007157 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on ZXDB | |||||||||||||||||||||
| 3'UTR of ZXDB (miRNA target sites are highlighted) |
>ZXDB|NM_007157|3'UTR 1 ACCAACTCTATTCATTCCTCATCATGTGGCTTACTTTTATTACAGTCAATTTTGAGGATATTCTGGACTAAATATTTAAG 81 TGCAGTCATTTCTTTTTGGTTTGCAAAAAGAGCACAGCCCTGGACTACAAGTTTGGAGATTTAAATTCTGATCTTGAGTT 161 TGGAACTGACAAGTTGTGTGACCCTGAGCAAGTCAGTTAACCTATCTGAGCCTTAATTTCCTTATTTATAAATTGAGGTG 241 GTTTGAATAGATTGCTTTTAAGGTCTTTCTGCTCTGTGATTCCTTGATAATACATTTCTTTCCTTGAAAAATATGAGGAC 321 GTTTTTCAGTGATGTGGCATGCGTTTTTTTTTAACTGCCCCCCCAGCCCTGACATGTTCTTTTTTTGGCAAACATACATA 401 ATGTTACATCATACTATGATGAACATCCATGTACTTTTCACTCAATTTCAGCAATTATGAATCCATGAACAATCTTTTTT 481 AACTTAGCCTCACTCACTCCCCATGTTCTAGTATTATTTTGTAACAAATAGCAGACATCTGATCATTTTATCCATAAATA 561 TTCTTTATATATCTCTGAAAGCTATGGGATGATATGGAAAAAAATGATAATTCCATTATCGCAAGTGATATTTACAGTAA 641 TTCTTTAATATCAGTAAATATCCAGTGAGGGTTCAAACTTCCAATTGCCTCATAAATGCTACTTGTTTTATTATTTTTAA 721 TTAGTAGAATCCCGTAAATCTCCTAAGTGTCTTCTTAATCCGTATGTTTCCCTTTCATCTTTCTTTTTTTCCTTGCGATT 801 TTGTTTATGAAATGAGGTTGTTTCACATGTAGCATTTGCCACAATTTAAGTTTTGCTAATTGCATCCCTATGGTAATGTT 881 TGCTTTCCTCTATCCTCTGTTTCTTTAATTTGCTAGTTATGTCTAGAGACTTGATGAGATTGAAACATGGCTTTTGGCAT 961 GAATGTTTCATAGGTTATGTTGTGTTCATTTAGTAGGTGGCGCATAATCTGTGGTTTTCTCTCTTTTTGTGGTATTAGCA 1041 GCTGCTGCAGATAAATGCATTAATTCATGATGCTTCTGATATGATGAGTCATCTTTGTAGAGTTACTAAGCATTAGCAAA 1121 GGAGGAAATGCTATGTAATAGAAATATTATTCAATGCCAAAATATTTTCTTAAATAGTCATAGAACTAACAAGAAAAAAT 1201 AGATAGCAAAAAAATGTGTTGGCTGTTCTCACTGTTTATCTTCCTAACTTCTTTTGATGATGGAAGGCAGTTTTGTGGAA 1281 ATTGCCAGCCAGGACTTTGACATGAAACAGACCCAGGGCTAAATTTTGGCTCTGTGGTGTTGGATAAGTGGCCTTGAATA 1361 AATTAGTTATTAAGCTTCAGTTTTCTAGCTTTTAACTGATTATAACAATGCACACACATACCTGACACACTGTTAAATTT 1441 TCTTCTCTTCCTGTTTCTTATGTTAAGGAAAGATACTCTGTGTTTTGGCATATGTTGGTGAATTTGTACCATTTTTATCC 1521 TCTCAGTCCTTCCTTTTATAAGACAATAATTGGAGTAGTTTAATCTTATTCATGTGCAGATAAAAGAGGTTTATGAAGTT 1601 TAGGGTGAAGTAGGCAAGGGAATCTGTTTACTCCCTCTTCCCTCTACTGAATAATTTTCCCTCTACTGAATAATTTTCCC 1681 TCTAAGAATTGCTGTGGGTAATACCAGGAGTGGGGACATTGCCCACATGCATAAGAGCGTATCTCTCCATTCGATCAGTT 1761 TGTCACCATCTTTGCTCTGTTTTGAAAGTCAGGCTTCTCTGTGACTGTGAAGCCTGCTGTTCCCTGAAAATCTGATAATG 1841 GAGCAGTGGAGGTTTTTTTCTTTCTGTGCTCTGTAGATCTCATTGTTTGCACTTGTAATTTCCCAGAGTTGAAAGGAAAG 1921 ATTGAACTGGAATATTGTGTAAACTATCTGTCTTACATTAGTGTAGCATTTTGCAATTTGGGGAACATCTTCACAATTTG 2001 TGTCTCGTTGTTCAGAACAACCCTGTGAAGTAGTTTTGGCAATGTCTGTGTTACATTTCATGTAATTTAGCCAACTCCCA 2081 TTCCAACTAGGCTTTGGCTAAATCTGACAATTTTATATATAGCTTAAAACAAAGAATATACATTCTTTTCACCCCTCCCA 2161 GTCTACCCATCCAGCCTTCATGATTCATTCCTGTGTCAAGGTTAGTCGCTGTTTTCCATTTGAATTGGTTTCTTTTATGG 2241 TCAGTTTACTTTCTTCCCTCTCCCCTCCCTTTCCTGCACATCCCCATCCTTGCTATGCCTTTCTGTCCTCTTTTATAATG 2321 GATATATCTTTTTCCTGCCATTATCCCTCAGACATTCTCCTCATGGCACATTTTCTTCAAATGCTAACATTTACTGAGTG 2401 TACATTGAAGTTCTGTGCATACAGGAAGAAGTTATTTTCTGAGCTTAGATAATACTATGTGTATATGTGATTAAAATGAA 2481 GATTATTTTCTAAAGCCTTCAAATTAGAAGTGGATTTCTGTTTCATTACTTCCGTTTTAAAAGTTTTTGCCAGAGAGTTT 2561 TGCTAAATACTCTCTTATTTGCTCTAGTGTACTAGTCCAGTAGTGTTTGCATGTGGATGTCTGTGGATGACAGTTATTGT 2641 AGCACTTTGGCAGTGCACTAAAATTTTGCCACTATGAAATGTTTCTTTATTGTGTGTGCGTGTGTGTTTTGAAATACGCA 2721 CACAGCCACACCCACATATATATTAAAAGTGGTTGTATTCATTTAGTGAAAAACAAAAAGTAGATGTACTTCTGTAAATC 2801 AGATAAATGCTTGGAATTTGATTGTCTACCCAATCAACAGTTTTCCCTCTTTGCTCTGGAAATATTTGTACTCATATAGC 2881 ATATTTCAAAAATGTTGTCATTCATTAAGGCCTCTTAAATAGACCACTATTTTTTGTGTCTGGCAGATGAGTATGTCAAG 2961 GATTGAGATGAACACATAAGTCTTGGAAATTAAATAAATTTATAAACATAAAGATAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | HEK293 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
||||||
| Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | HEK293 | ||||||
| Disease | 158586.0 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
||||||
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | TZM-bl |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HCT116 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177608. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_10
PAR-CLIP data was present in ERX177620. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_10
PAR-CLIP data was present in ERX177632. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_10
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
| Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
| CLIP-seq Support 1 for dataset GSM545216 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / miR-124 transfection |
| Location of target site | ENST00000374888.1 | 3UTR | UUAACCUAUCUGAGCCUUAAUUUCCUUAUUUAUAAAUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM714644 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000374888.1 | 3UTR | UUAACCUAUCUGAGCCUUAAUUUCCUUAUUUAUAAAUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM1462574 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000374888.1 | 3UTR | UUAACCUAUCUGAGCCUUAAUUUCCUUAUUUAUAAAUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
79 hsa-miR-4330 Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT092330 | EDEM1 | ER degradation enhancing alpha-mannosidase like protein 1 |  |
|
2 | 6 | ||||||
| MIRT092536 | KBTBD8 | kelch repeat and BTB domain containing 8 | |
|
2 | 6 | ||||||
| MIRT102900 | INSIG1 | insulin induced gene 1 | |
|
2 | 6 | ||||||
| MIRT271430 | ETNK1 | ethanolamine kinase 1 | |
|
2 | 2 | ||||||
| MIRT327637 | ZXDB | zinc finger, X-linked, duplicated B | |
|
2 | 6 | ||||||
| MIRT441799 | BCAS1 | breast carcinoma amplified sequence 1 | |
|
2 | 2 | ||||||
| MIRT442396 | ILDR1 | immunoglobulin like domain containing receptor 1 | |
|
2 | 2 | ||||||
| MIRT452817 | INTS2 | integrator complex subunit 2 | |
|
2 | 2 | ||||||
| MIRT455523 | C6orf106 | chromosome 6 open reading frame 106 | |
|
2 | 2 | ||||||
| MIRT455885 | KIF2C | kinesin family member 2C | |
|
2 | 2 | ||||||
| MIRT462197 | NDUFS1 | NADH:ubiquinone oxidoreductase core subunit S1 | |
|
2 | 2 | ||||||
| MIRT462697 | SNRPD3 | small nuclear ribonucleoprotein D3 polypeptide | |
|
2 | 2 | ||||||
| MIRT464698 | UBE2V1 | ubiquitin conjugating enzyme E2 V1 | |
|
2 | 2 | ||||||
| MIRT465961 | TMEM189-UBE2V1 | TMEM189-UBE2V1 readthrough | |
|
2 | 2 | ||||||
| MIRT466045 | TMEM189 | transmembrane protein 189 | |
|
2 | 2 | ||||||
| MIRT473479 | MCFD2 | multiple coagulation factor deficiency 2 | |
|
2 | 2 | ||||||
| MIRT473562 | MATR3 | matrin 3 | |
|
2 | 2 | ||||||
| MIRT473945 | LYN | LYN proto-oncogene, Src family tyrosine kinase | |
|
2 | 2 | ||||||
| MIRT475053 | JMY | junction mediating and regulatory protein, p53 cofactor | |
|
2 | 2 | ||||||
| MIRT475532 | HOXA3 | homeobox A3 | |
|
2 | 8 | ||||||
| MIRT475980 | GTPBP2 | GTP binding protein 2 | |
|
2 | 2 | ||||||
| MIRT477066 | FAM208B | family with sequence similarity 208 member B | |
|
2 | 4 | ||||||
| MIRT479327 | CERS2 | ceramide synthase 2 | |
|
2 | 2 | ||||||
| MIRT479895 | CCDC117 | coiled-coil domain containing 117 | |
|
2 | 2 | ||||||
| MIRT481542 | ARL5B | ADP ribosylation factor like GTPase 5B | |
|
2 | 2 | ||||||
| MIRT482406 | ADRB1 | adrenoceptor beta 1 | |
|
2 | 10 | ||||||
| MIRT482911 | ZNF845 | zinc finger protein 845 | |
|
2 | 2 | ||||||
| MIRT489975 | DDB1 | damage specific DNA binding protein 1 | |
|
2 | 2 | ||||||
| MIRT490346 | PEX10 | peroxisomal biogenesis factor 10 | |
|
2 | 2 | ||||||
| MIRT493585 | HNRNPA1 | heterogeneous nuclear ribonucleoprotein A1 | |
|
2 | 6 | ||||||
| MIRT496153 | RPS15A | ribosomal protein S15a | |
|
2 | 2 | ||||||
| MIRT500620 | TXNIP | thioredoxin interacting protein | |
|
2 | 2 | ||||||
| MIRT503158 | ANKRD11 | ankyrin repeat domain 11 | |
|
2 | 2 | ||||||
| MIRT504479 | HSF5 | heat shock transcription factor 5 | |
|
2 | 6 | ||||||
| MIRT504633 | MFSD8 | major facilitator superfamily domain containing 8 | |
|
2 | 6 | ||||||
| MIRT507122 | GIGYF1 | GRB10 interacting GYF protein 1 | |
|
2 | 6 | ||||||
| MIRT514631 | MTRNR2L7 | MT-RNR2-like 7 | |
|
2 | 2 | ||||||
| MIRT521270 | RTN4 | reticulon 4 | |
|
2 | 6 | ||||||
| MIRT533902 | TBL1X | transducin beta like 1X-linked | |
|
2 | 2 | ||||||
| MIRT537583 | ESYT2 | extended synaptotagmin 2 | |
|
2 | 2 | ||||||
| MIRT540430 | FAM83F | family with sequence similarity 83 member F | |
|
2 | 2 | ||||||
| MIRT544324 | TMEM81 | transmembrane protein 81 | |
|
2 | 4 | ||||||
| MIRT548303 | EPHA7 | EPH receptor A7 | |
|
2 | 2 | ||||||
| MIRT552766 | YIPF6 | Yip1 domain family member 6 | |
|
2 | 2 | ||||||
| MIRT555669 | PGAM4 | phosphoglycerate mutase family member 4 | |
|
2 | 2 | ||||||
| MIRT561279 | ZCCHC3 | zinc finger CCHC-type containing 3 | |
|
2 | 2 | ||||||
| MIRT564575 | ZXDA | zinc finger, X-linked, duplicated A | |
|
2 | 2 | ||||||
| MIRT565812 | SDCCAG3 | serologically defined colon cancer antigen 3 | |
|
2 | 2 | ||||||
| MIRT568741 | MTRNR2L1 | MT-RNR2-like 1 | |
|
2 | 2 | ||||||
| MIRT569363 | PRMT6 | protein arginine methyltransferase 6 | |
|
2 | 2 | ||||||
| MIRT570608 | MTRNR2L11 | MT-RNR2-like 11 | |
|
2 | 2 | ||||||
| MIRT572424 | PTGES3L | prostaglandin E synthase 3 like | |
|
2 | 2 | ||||||
| MIRT576542 | Txlna | taxilin alpha | |
|
2 | 2 | ||||||
| MIRT610568 | HIST3H2BB | histone cluster 3 H2B family member b | |
|
2 | 2 | ||||||
| MIRT617497 | IFT46 | intraflagellar transport 46 | |
|
2 | 2 | ||||||
| MIRT617773 | C17orf105 | chromosome 17 open reading frame 105 | |
|
2 | 2 | ||||||
| MIRT619275 | CEP57L1 | centrosomal protein 57 like 1 | |
|
2 | 2 | ||||||
| MIRT624618 | ATXN7L3B | ataxin 7 like 3B | |
|
2 | 2 | ||||||
| MIRT628001 | MELK | maternal embryonic leucine zipper kinase | |
|
2 | 2 | ||||||
| MIRT646325 | MVB12B | multivesicular body subunit 12B | |
|
2 | 2 | ||||||
| MIRT648697 | TNFRSF13C | TNF receptor superfamily member 13C | |
|
2 | 2 | ||||||
| MIRT665675 | TOR1B | torsin family 1 member B | |
|
2 | 2 | ||||||
| MIRT669730 | ZBTB8B | zinc finger and BTB domain containing 8B | |
|
2 | 2 | ||||||
| MIRT676242 | PARP2 | poly(ADP-ribose) polymerase 2 | |
|
2 | 2 | ||||||
| MIRT683205 | MBNL1 | muscleblind like splicing regulator 1 | |
|
2 | 2 | ||||||
| MIRT684425 | TUFT1 | tuftelin 1 | |
|
2 | 2 | ||||||
| MIRT688864 | CAMKK2 | calcium/calmodulin dependent protein kinase kinase 2 | |
|
2 | 2 | ||||||
| MIRT693406 | NUDT16 | nudix hydrolase 16 | |
|
2 | 2 | ||||||
| MIRT694597 | AAR2 | AAR2 splicing factor homolog | |
|
2 | 2 | ||||||
| MIRT698399 | TMED10 | transmembrane p24 trafficking protein 10 | |
|
2 | 2 | ||||||
| MIRT698435 | TM4SF1 | transmembrane 4 L six family member 1 | |
|
2 | 2 | ||||||
| MIRT708290 | ZNF24 | zinc finger protein 24 | |
|
2 | 2 | ||||||
| MIRT709766 | GPR183 | G protein-coupled receptor 183 | |
|
2 | 2 | ||||||
| MIRT710713 | KRTAP6-1 | keratin associated protein 6-1 | |
|
2 | 2 | ||||||
| MIRT711643 | LIPG | lipase G, endothelial type | |
|
2 | 2 | ||||||
| MIRT713246 | SLC22A3 | solute carrier family 22 member 3 | |
|
2 | 2 | ||||||
| MIRT714008 | IL6R | interleukin 6 receptor | |
|
2 | 2 | ||||||
| MIRT721851 | C1QTNF3 | C1q and TNF related 3 | |
|
2 | 2 | ||||||
| MIRT724003 | TMEM174 | transmembrane protein 174 | |
|
2 | 2 | ||||||
| miRNA-Drug Associations | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|