| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-4747 |
| Genomic Coordinates | chr19: 4932687 - 4932740 |
| Description | Homo sapiens miR-4747 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | |||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-4747-5p | ||||||||||||||||||||||||
| Sequence | 1| AGGGAAGGAGGCUUGGUCUUAG |22 | ||||||||||||||||||||||||
| Evidence | Experimental | ||||||||||||||||||||||||
| Experiments | Illumina | ||||||||||||||||||||||||
| SNPs in miRNA |
|
||||||||||||||||||||||||
| Putative Targets | |||||||||||||||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | EIF5AL1 | ||||||||||||||||||||
| Synonyms | EIF5AP1, bA342M3.3 | ||||||||||||||||||||
| Description | eukaryotic translation initiation factor 5A-like 1 | ||||||||||||||||||||
| Transcript | NM_001099692 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on EIF5AL1 | |||||||||||||||||||||
| 3'UTR of EIF5AL1 (miRNA target sites are highlighted) |
>EIF5AL1|NM_001099692|3'UTR 1 CTGGCTCCCAAGGTGGCAGTGGTGGCAGCAGTGATCCTCCGAACCTGCAGAGGCCCCCTCCCCCAGCCTGGCCTGGCTCT 81 GGCCTGGTCCTAGGTTGGACTCCTCCTACACAATTTATTTGACGTTTTATTTTGGTTTTCCCCACCCCCTCAATCTGTCA 161 GGGAGCCCCTGCCCTTCACCTAGCTCCCTTGGCCAGGAGCGAGCGAAGCCATGGCCTTGGTGAAGCTGCCCTCCTCTTCT 241 CCCCTCACACTACAGCCCTGGTGGGGGAGAAGGGGGTGGGTGCTGCTTGTGGTTTAGTCTTTTTTTTTTTTTTAAATTCA 321 ATCTGGAATCAGAAAGCGGTGGATTCTGGCAAATGGTCCTTGTGCCCTCCCCACTCATCCTTGGTCTGGTCCCCTGTTGC 401 CCATAGCCCTTTACCCTGAGCACCACCCAACAGACTGGGGACCAGCCCCCTCGCCTGCCTGTGTCTCTCCCCAAACCCCT 481 TTAGATGGGGAGGGAAGAAGAGGAGAGGGGAGGGGACCTGCCCCCTCCTCAGGCATCTGGGAAGGGCCTGCCCCCATGGG 561 CTTTACCCTTCCCTGCGGGCTCTCTCCCCGACACATTTGTTAAAATCAAACCTGAATAAAACTACAAGTTTAATATGAAA 641 AAAAAAAAAAAAGAAAGAAAGACGTGTAAAATGCCAAGAACTCTAGGAAACAGGGACAAAAACACTTCAAAGAGAAAGTT 721 CATGCACTTGTTTCTGACCACCCAGGGCACCCTTCAGCACACGCTGTCTGGAGTGGCCTGAAGCAAGGAGTGTCTTGTGA 801 GGTGCAGAGGATGCAATGGGAGCAGGGTCCTGTCCCCACCCTAAAGGAGTTCACAGTTTAACGCAAATGAGAAGCCAGTG 881 AGGACATCACTACTCCTGCTGTGAACTTGGGAACTAGAAACACAAAACCTGAGTCTGGAGGGAAGCTAAGGAAGCATTCT 961 GCTCTGGAGTAGACATGAGTGCGTGTGAAGCTTCTGATCTCCCATGAGAGCAATGGGGACATGGGGCAGAATCTAAAACC 1041 CATGACTGAAAGCACCAAATTGCTAAAATGGCAATAAAGAGACATGAGGCCAAGATGGAGAAGAAGGAACCCAGGACGAG 1121 GGTCAGCCTCACATTTGGGGCTCATTTCCCTCAGTTTCCTCACTGAATTTCAGAAGGGACTAACTGAGATGCAAAGAAGC 1201 AGAGCAGCTTTTGCACCATGTGGAGGACTAGATGGAAAACAAGTAGACTGAGGGTCTGCTAGTGAAGGTGACCCCTACTG 1281 AAGTCCACTGGCTTTGGTTGGGACCCAGAAGAGTCACACGCCAGGAATAGAGGTGGACAGGAAACACCCTGACTTTTGTA 1361 GGGACTGAACCTCACTGATAACCTCAATTGCGGATGGTATGGAGGGTGTCTAGGTGTGCTAGGACCCCTGCCCATTCCCC 1441 AGAAATAGACTCCCATCTTTTCTACAGCAAGATAACGTGCTAGTAGGCCTCAATTCATTGCTAAATATTTTTAACGAGTG 1521 TCTTACATTTAGCCAAAAAGACTAGTCATGTGGCAGGAAAAATACAATGTCATATGACCAAAAGCTAAAAGACTGTGAAA 1601 ATGAATCCAGAGGTGACCCAAGCATTGAATTTAACAATGCCAGTACCTGGACCTCCGCTTGCCCCTAAAACATTACAATC 1681 AAGAATGTAGGAAGGGAAAGGAAACACGAAGATTAATCAAGCAGGAAGGACAAGCTCAGTTTTGCACCCACTGAATTTGC 1761 CACAAATATTGTGGAAAATATTCTCGGGGACATTGCAGTTGTCTACTTTGGTTGGCACATGGTTCATACAACAGTGTTTG 1841 TGTCAGTGAACATCTTACTCTTCCTCGGCAGTCTTTCTTTGCCCAGAGATTTCGCAATGACTGTTGACCTTCATCATCAC 1921 CTTTTGGACTTTGGCTTGCACTTTAGCTTCTGTAGATCTCCATGATGTAAAGAAGTATTTTAGGTCCATTTTAATTCCTG 2001 CAAAGGATAAAATCCTTCTATTTGTGTGCATATAAGTGGACCTGAGCCCTTGGTTAGGGTGTAGAGAGGAGAAGGGGAGA 2081 AACCTGAGGGCCAGAAGCTGTTCTTTCCCTTAAAAGGGCAAACTCATTTCCACACTATGGGGACTCTGACAGATAGCATA 2161 CCTTCCTGTCTATGGCTATTGGACCTGCAGGCTTTCCCCTGTAAATCCGTGTTCTGTCATTGACATTTTGTGACTGTAAG 2241 ACAGACTTGAGATAAGACATCTAGAAAACAATAATTGAACAATGATGTGAATATATTTCACACAACTGAACTGTACATTT 2321 CAACAAGGTTAAGATGGTAATTATCACGTTATACATTTTTTACCGCAGGTTAAAATGTTTCACAGGTTGAAAGGAAAGCA 2401 ACTACCTTCAGTTCTCTGAGTTCAAGAATTTGTAACATTTCACCCCCTGCTCCTTCCTGATCTTCTGTGGAGCATCTTTT 2481 TTCCATCCATGCTCTACTCAGAGCCCACTTTCCCTTCCCTGACACCAGCTTCACTGAGGCTGGTTGGAACCTAACACAAA 2561 ACATTCTCAGTAATGACTGAATTCCCACAAAGAATTCCATATAGACTGCATATGAGTTGAATCTTCTAAGACATGAAATA 2641 TTTGTTCTCTTCTTGGCTAATATGCAATGCAAATCCTGTTGCAGATGTACGTCATATACCTCTGAAATTCCTGATGTATT 2721 CAATGAAATAACATCTTTAAAGTTCTGTGTAGAATGTTTTTTTTCTGATTTCTTCACATACGATAGAAAAAAAAACCCAA 2801 AAAAACATGTACTAGGATTTCAATAGAAGCAATGGGTGATCTAAAAAGATGAAAGAGCAACCGCATGCGCCCTACAGCTA 2881 CCGCTAGATTTTATGGGGAAAGCAGCTGGCCCAGTTTGCAGCTAGGAGAAATGTCAAACACATGAAGAAATGAGAAGCAA 2961 AGAAAAACCATGAGGCATGAACATTTCATGGCAATCACGATGTCCTGGTTTGTGAGATAATGGGATAGAGGAGTAGAAAA 3041 CAAGGAGAAAGATGAGAAGGTACAAAGTGGTTCAAGTCAAACAGCTCAACTGAACTTTTCTTAATGGAATATTTAAAAAG 3121 TGGTACATTAAAAAACTTCCCCCAGTTCACATCAAAAATTCTCTCTTCAGGACTAAGTTGGGTAGAGACTGTTCAATGTG 3201 CCTAGATATCTTCAGAACTTATATATTTTCTGTTTTCTACGTATGTTGAAGGGCAGTGCCAAATGATGTGTAATTATCTA 3281 GGTTGTAAAAATAAAACATACTCCCCCTTCCCTTGAGGATAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | HEK293 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
||||||
| Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | TZM-bl | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
||||||
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HCT116 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177609. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_11
PAR-CLIP data was present in ERX177610. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_12
PAR-CLIP data was present in ERX177612. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_2
PAR-CLIP data was present in ERX177621. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_11
PAR-CLIP data was present in ERX177622. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_12
PAR-CLIP data was present in ERX177634. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_12
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
| Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
| CLIP-seq Support 1 for dataset GSM545212 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000520547.2 | 3UTR | CCCUGCGGGCUCUCUC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM1462574 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000520547.2 | 3UTR | CCCCCAUGGGCUUUACCCUUCCCUGCGG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
215 hsa-miR-4747-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT061689 | BTG2 | BTG anti-proliferation factor 2 |  |
|
2 | 2 | ||||||
| MIRT062834 | BCL7A | BCL tumor suppressor 7A | |
|
2 | 2 | ||||||
| MIRT079371 | CCDC137 | coiled-coil domain containing 137 | |
|
2 | 2 | ||||||
| MIRT081190 | MIDN | midnolin | |
|
2 | 4 | ||||||
| MIRT081724 | ZNF507 | zinc finger protein 507 | |
|
2 | 2 | ||||||
| MIRT110565 | ZMYND11 | zinc finger MYND-type containing 11 | |
|
2 | 2 | ||||||
| MIRT133724 | SKI | SKI proto-oncogene | |
|
2 | 4 | ||||||
| MIRT146689 | MINK1 | misshapen like kinase 1 | |
|
2 | 2 | ||||||
| MIRT150676 | SLC27A1 | solute carrier family 27 member 1 | |
|
2 | 2 | ||||||
| MIRT159196 | NRBP1 | nuclear receptor binding protein 1 | |
|
2 | 2 | ||||||
| MIRT180865 | RPRD2 | regulation of nuclear pre-mRNA domain containing 2 | |
|
2 | 2 | ||||||
| MIRT190659 | PABPN1 | poly(A) binding protein nuclear 1 | |
|
2 | 2 | ||||||
| MIRT196111 | MPRIP | myosin phosphatase Rho interacting protein | |
|
2 | 2 | ||||||
| MIRT232390 | SP1 | Sp1 transcription factor | |
|
2 | 2 | ||||||
| MIRT331070 | EIF5AL1 | eukaryotic translation initiation factor 5A-like 1 | |
|
2 | 4 | ||||||
| MIRT338632 | SHMT2 | serine hydroxymethyltransferase 2 | |
|
2 | 2 | ||||||
| MIRT407441 | CTDSP1 | CTD small phosphatase 1 | |
|
2 | 2 | ||||||
| MIRT444276 | NKX6-1 | NK6 homeobox 1 | |
|
2 | 2 | ||||||
| MIRT444834 | PDE6D | phosphodiesterase 6D | |
|
2 | 2 | ||||||
| MIRT445452 | EXT1 | exostosin glycosyltransferase 1 | |
|
2 | 2 | ||||||
| MIRT445644 | NPY4R | neuropeptide Y receptor Y4 | |
|
2 | 2 | ||||||
| MIRT446157 | RPL12 | ribosomal protein L12 | |
|
2 | 2 | ||||||
| MIRT446608 | HIP1 | huntingtin interacting protein 1 | |
|
2 | 2 | ||||||
| MIRT447108 | CLPX | caseinolytic mitochondrial matrix peptidase chaperone subunit | |
|
2 | 2 | ||||||
| MIRT449314 | MRO | maestro | |
|
2 | 2 | ||||||
| MIRT450305 | DRAXIN | dorsal inhibitory axon guidance protein | |
|
2 | 2 | ||||||
| MIRT451245 | ZNF444 | zinc finger protein 444 | |
|
2 | 2 | ||||||
| MIRT451714 | OLR1 | oxidized low density lipoprotein receptor 1 | |
|
2 | 2 | ||||||
| MIRT451908 | ILK | integrin linked kinase | |
|
2 | 2 | ||||||
| MIRT452183 | KIAA1456 | KIAA1456 | |
|
2 | 2 | ||||||
| MIRT452610 | REPIN1 | replication initiator 1 | |
|
2 | 2 | ||||||
| MIRT453422 | GLG1 | golgi glycoprotein 1 | |
|
2 | 2 | ||||||
| MIRT454006 | ALKBH5 | alkB homolog 5, RNA demethylase | |
|
2 | 2 | ||||||
| MIRT455072 | ARHGAP39 | Rho GTPase activating protein 39 | |
|
2 | 2 | ||||||
| MIRT455319 | TTLL9 | tubulin tyrosine ligase like 9 | |
|
2 | 2 | ||||||
| MIRT455357 | KDM5C | lysine demethylase 5C | |
|
2 | 2 | ||||||
| MIRT455589 | TAF12 | TATA-box binding protein associated factor 12 | |
|
2 | 2 | ||||||
| MIRT455711 | EIF4EBP2 | eukaryotic translation initiation factor 4E binding protein 2 | |
|
2 | 2 | ||||||
| MIRT455860 | TMEM254 | transmembrane protein 254 | |
|
2 | 2 | ||||||
| MIRT455919 | RAPGEF1 | Rap guanine nucleotide exchange factor 1 | |
|
2 | 2 | ||||||
| MIRT455946 | CYP4A22 | cytochrome P450 family 4 subfamily A member 22 | |
|
2 | 2 | ||||||
| MIRT456935 | LRP10 | LDL receptor related protein 10 | |
|
2 | 2 | ||||||
| MIRT457223 | AP3D1 | adaptor related protein complex 3 delta 1 subunit | |
|
2 | 2 | ||||||
| MIRT457431 | NOL10 | nucleolar protein 10 | |
|
2 | 2 | ||||||
| MIRT457470 | SLC35F6 | solute carrier family 35 member F6 | |
|
2 | 2 | ||||||
| MIRT457907 | ZNF212 | zinc finger protein 212 | |
|
2 | 2 | ||||||
| MIRT458046 | TSEN54 | tRNA splicing endonuclease subunit 54 | |
|
2 | 2 | ||||||
| MIRT458073 | RNLS | renalase, FAD dependent amine oxidase | |
|
2 | 2 | ||||||
| MIRT458234 | NXPH3 | neurexophilin 3 | |
|
2 | 2 | ||||||
| MIRT458307 | TNFAIP8L3 | TNF alpha induced protein 8 like 3 | |
|
2 | 2 | ||||||
| MIRT458378 | ITM2C | integral membrane protein 2C | |
|
2 | 2 | ||||||
| MIRT458967 | ZNF436 | zinc finger protein 436 | |
|
2 | 2 | ||||||
| MIRT459099 | CYP4A11 | cytochrome P450 family 4 subfamily A member 11 | |
|
2 | 2 | ||||||
| MIRT459446 | TMEM37 | transmembrane protein 37 | |
|
2 | 2 | ||||||
| MIRT459671 | VPS37C | VPS37C, ESCRT-I subunit | |
|
2 | 2 | ||||||
| MIRT460727 | ASXL3 | additional sex combs like 3, transcriptional regulator | |
|
2 | 2 | ||||||
| MIRT460744 | SRP14 | signal recognition particle 14 | |
|
2 | 2 | ||||||
| MIRT461531 | C14orf1 | ergosterol biosynthesis 28 homolog | |
|
2 | 2 | ||||||
| MIRT461752 | DDX11 | DEAD/H-box helicase 11 | |
|
2 | 2 | ||||||
| MIRT461837 | F2RL3 | F2R like thrombin or trypsin receptor 3 | |
|
2 | 2 | ||||||
| MIRT462019 | RIF1 | replication timing regulatory factor 1 | |
|
2 | 2 | ||||||
| MIRT462631 | PHF5A | PHD finger protein 5A | |
|
2 | 2 | ||||||
| MIRT462772 | ZNF8 | zinc finger protein 8 | |
|
2 | 2 | ||||||
| MIRT463032 | ZNF689 | zinc finger protein 689 | |
|
2 | 2 | ||||||
| MIRT463886 | WNT7B | Wnt family member 7B | |
|
2 | 2 | ||||||
| MIRT463995 | WDTC1 | WD and tetratricopeptide repeats 1 | |
|
2 | 2 | ||||||
| MIRT464371 | URM1 | ubiquitin related modifier 1 | |
|
2 | 2 | ||||||
| MIRT465342 | TPM3 | tropomyosin 3 | |
|
2 | 4 | ||||||
| MIRT465515 | PRICKLE4 | prickle planar cell polarity protein 4 | |
|
2 | 2 | ||||||
| MIRT465602 | TNRC6A | trinucleotide repeat containing 6A | |
|
2 | 2 | ||||||
| MIRT465697 | TNPO2 | transportin 2 | |
|
2 | 10 | ||||||
| MIRT466988 | SSRP1 | structure specific recognition protein 1 | |
|
2 | 4 | ||||||
| MIRT467630 | SLC7A5 | solute carrier family 7 member 5 | |
|
2 | 2 | ||||||
| MIRT468132 | SH3PXD2A | SH3 and PX domains 2A | |
|
2 | 2 | ||||||
| MIRT468322 | SF3B3 | splicing factor 3b subunit 3 | |
|
2 | 2 | ||||||
| MIRT468502 | SESN2 | sestrin 2 | |
|
2 | 2 | ||||||
| MIRT468881 | RREB1 | ras responsive element binding protein 1 | |
|
2 | 2 | ||||||
| MIRT469322 | RGP1 | RGP1 homolog, RAB6A GEF complex partner 1 | |
|
2 | 2 | ||||||
| MIRT469562 | RARA | retinoic acid receptor alpha | |
|
2 | 2 | ||||||
| MIRT469898 | PTRF | caveolae associated protein 1 | |
|
2 | 2 | ||||||
| MIRT470045 | PTGFRN | prostaglandin F2 receptor inhibitor | |
|
2 | 2 | ||||||
| MIRT470068 | PTGES2 | prostaglandin E synthase 2 | |
|
2 | 2 | ||||||
| MIRT470238 | PRRC2A | proline rich coiled-coil 2A | |
|
2 | 2 | ||||||
| MIRT470390 | PPP1R16B | protein phosphatase 1 regulatory subunit 16B | |
|
2 | 2 | ||||||
| MIRT470500 | PPP1R11 | protein phosphatase 1 regulatory inhibitor subunit 11 | |
|
2 | 2 | ||||||
| MIRT470689 | POLR2D | RNA polymerase II subunit D | |
|
2 | 2 | ||||||
| MIRT470704 | POGK | pogo transposable element derived with KRAB domain | |
|
2 | 2 | ||||||
| MIRT471083 | PIK3C2B | phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta | |
|
2 | 2 | ||||||
| MIRT472482 | NACC2 | NACC family member 2 | |
|
2 | 2 | ||||||
| MIRT473583 | MAT2A | methionine adenosyltransferase 2A | |
|
2 | 2 | ||||||
| MIRT474554 | KLHDC3 | kelch domain containing 3 | |
|
2 | 2 | ||||||
| MIRT474651 | KLF13 | Kruppel like factor 13 | |
|
2 | 2 | ||||||
| MIRT474843 | KHSRP | KH-type splicing regulatory protein | |
|
2 | 2 | ||||||
| MIRT474934 | KCTD15 | potassium channel tetramerization domain containing 15 | |
|
2 | 2 | ||||||
| MIRT475573 | HNRNPC | heterogeneous nuclear ribonucleoprotein C (C1/C2) | |
|
2 | 2 | ||||||
| MIRT476045 | GRSF1 | G-rich RNA sequence binding factor 1 | |
|
2 | 2 | ||||||
| MIRT476080 | GRB2 | growth factor receptor bound protein 2 | |
|
2 | 2 | ||||||
| MIRT476440 | GBA2 | glucosylceramidase beta 2 | |
|
2 | 2 | ||||||
| MIRT476764 | FOSL2 | FOS like 2, AP-1 transcription factor subunit | |
|
2 | 2 | ||||||
| MIRT478785 | CRTC2 | CREB regulated transcription coactivator 2 | |
|
2 | 2 | ||||||
| MIRT479287 | CHAC1 | ChaC glutathione specific gamma-glutamylcyclotransferase 1 | |
|
2 | 2 | ||||||
| MIRT479505 | CDH6 | cadherin 6 | |
|
2 | 2 | ||||||
| MIRT479732 | CCND1 | cyclin D1 | |
|
2 | 6 | ||||||
| MIRT480352 | C5orf24 | chromosome 5 open reading frame 24 | |
|
2 | 2 | ||||||
| MIRT480407 | C19orf47 | chromosome 19 open reading frame 47 | |
|
2 | 2 | ||||||
| MIRT480859 | BHLHB9 | basic helix-loop-helix family member b9 | |
|
2 | 2 | ||||||
| MIRT481445 | ARRB2 | arrestin beta 2 | |
|
2 | 2 | ||||||
| MIRT481732 | APH1A | aph-1 homolog A, gamma-secretase subunit | |
|
2 | 2 | ||||||
| MIRT481824 | AP2M1 | adaptor related protein complex 2 mu 1 subunit | |
|
2 | 2 | ||||||
| MIRT482566 | ABHD2 | abhydrolase domain containing 2 | |
|
2 | 2 | ||||||
| MIRT482607 | ABHD14B | abhydrolase domain containing 14B | |
|
2 | 2 | ||||||
| MIRT483144 | SYCE1L | synaptonemal complex central element protein 1 like | |
|
2 | 2 | ||||||
| MIRT483214 | APOA1 | apolipoprotein A1 | |
|
2 | 6 | ||||||
| MIRT483878 | TGIF1 | TGFB induced factor homeobox 1 | |
|
2 | 2 | ||||||
| MIRT483917 | SPSB1 | splA/ryanodine receptor domain and SOCS box containing 1 | |
|
2 | 2 | ||||||
| MIRT483939 | LENG8 | leukocyte receptor cluster member 8 | |
|
2 | 4 | ||||||
| MIRT484420 | SNX19 | sorting nexin 19 | |
|
2 | 2 | ||||||
| MIRT484489 | SLC9A1 | solute carrier family 9 member A1 | |
|
2 | 2 | ||||||
| MIRT484612 | SIX3 | SIX homeobox 3 | |
|
2 | 6 | ||||||
| MIRT484705 | RNF11 | ring finger protein 11 | |
|
2 | 2 | ||||||
| MIRT485107 | SHISA6 | shisa family member 6 | |
|
2 | 2 | ||||||
| MIRT485354 | MYO1C | myosin IC | |
|
2 | 4 | ||||||
| MIRT485609 | FOSL1 | FOS like 1, AP-1 transcription factor subunit | |
|
2 | 4 | ||||||
| MIRT487311 | GLTSCR1 | BRD4 interacting chromatin remodeling complex associated protein | |
|
2 | 2 | ||||||
| MIRT487417 | CACNB1 | calcium voltage-gated channel auxiliary subunit beta 1 | |
|
2 | 2 | ||||||
| MIRT487695 | CDK14 | cyclin dependent kinase 14 | |
|
2 | 2 | ||||||
| MIRT487791 | GPR20 | G protein-coupled receptor 20 | |
|
2 | 4 | ||||||
| MIRT488042 | PABPC1L2B | poly(A) binding protein cytoplasmic 1 like 2B | |
|
2 | 2 | ||||||
| MIRT488058 | PABPC1L2A | poly(A) binding protein cytoplasmic 1 like 2A | |
|
2 | 2 | ||||||
| MIRT488237 | DNLZ | DNL-type zinc finger | |
|
2 | 4 | ||||||
| MIRT488764 | FXYD1 | FXYD domain containing ion transport regulator 1 | |
|
2 | 2 | ||||||
| MIRT489401 | TUBB2A | tubulin beta 2A class IIa | |
|
2 | 2 | ||||||
| MIRT489777 | GRINA | glutamate ionotropic receptor NMDA type subunit associated protein 1 | |
|
2 | 2 | ||||||
| MIRT490099 | FN3K | fructosamine 3 kinase | |
|
2 | 2 | ||||||
| MIRT490290 | ISL2 | ISL LIM homeobox 2 | |
|
2 | 2 | ||||||
| MIRT490378 | LHFPL3 | LHFPL tetraspan subfamily member 3 | |
|
2 | 2 | ||||||
| MIRT491329 | GFER | growth factor, augmenter of liver regeneration | |
|
2 | 2 | ||||||
| MIRT491435 | MSX2 | msh homeobox 2 | |
|
2 | 2 | ||||||
| MIRT491769 | ZNF385A | zinc finger protein 385A | |
|
2 | 2 | ||||||
| MIRT491922 | WNK2 | WNK lysine deficient protein kinase 2 | |
|
2 | 2 | ||||||
| MIRT491983 | UNK | unkempt family zinc finger | |
|
2 | 2 | ||||||
| MIRT492228 | SLC48A1 | solute carrier family 48 member 1 | |
|
2 | 2 | ||||||
| MIRT492404 | SDK1 | sidekick cell adhesion molecule 1 | |
|
2 | 2 | ||||||
| MIRT492767 | PDGFB | platelet derived growth factor subunit B | |
|
2 | 2 | ||||||
| MIRT492966 | NCS1 | neuronal calcium sensor 1 | |
|
2 | 2 | ||||||
| MIRT493295 | LLGL2 | LLGL2, scribble cell polarity complex component | |
|
2 | 2 | ||||||
| MIRT493650 | HDLBP | high density lipoprotein binding protein | |
|
2 | 2 | ||||||
| MIRT493913 | FAM127B | retrotransposon Gag like 8A | |
|
2 | 4 | ||||||
| MIRT495601 | NKX2-5 | NK2 homeobox 5 | |
|
2 | 2 | ||||||
| MIRT496875 | AHCYL2 | adenosylhomocysteinase like 2 | |
|
2 | 2 | ||||||
| MIRT498514 | MYH14 | myosin heavy chain 14 | |
|
2 | 2 | ||||||
| MIRT499178 | RBPJL | recombination signal binding protein for immunoglobulin kappa J region like | |
|
2 | 2 | ||||||
| MIRT502143 | KIF5B | kinesin family member 5B | |
|
2 | 8 | ||||||
| MIRT502692 | CSNK1G1 | casein kinase 1 gamma 1 | |
|
2 | 4 | ||||||
| MIRT508460 | HOXB6 | homeobox B6 | |
|
2 | 4 | ||||||
| MIRT510430 | ZNF207 | zinc finger protein 207 | |
|
2 | 6 | ||||||
| MIRT511837 | GPATCH8 | G-patch domain containing 8 | |
|
2 | 4 | ||||||
| MIRT512368 | CPM | carboxypeptidase M | |
|
2 | 2 | ||||||
| MIRT512506 | BTBD19 | BTB domain containing 19 | |
|
2 | 2 | ||||||
| MIRT513065 | ANKRD45 | ankyrin repeat domain 45 | |
|
2 | 2 | ||||||
| MIRT513267 | SCUBE1 | signal peptide, CUB domain and EGF like domain containing 1 | |
|
2 | 4 | ||||||
| MIRT513575 | EVX1 | even-skipped homeobox 1 | |
|
2 | 2 | ||||||
| MIRT515051 | EBNA1BP2 | EBNA1 binding protein 2 | |
|
2 | 2 | ||||||
| MIRT515790 | COL4A3BP | collagen type IV alpha 3 binding protein | |
|
2 | 2 | ||||||
| MIRT521657 | PRKD3 | protein kinase D3 | |
|
2 | 2 | ||||||
| MIRT522679 | LUZP1 | leucine zipper protein 1 | |
|
2 | 6 | ||||||
| MIRT528845 | RAB32 | RAB32, member RAS oncogene family | |
|
2 | 2 | ||||||
| MIRT533569 | TOR1AIP1 | torsin 1A interacting protein 1 | |
|
2 | 2 | ||||||
| MIRT543738 | DHCR7 | 7-dehydrocholesterol reductase | |
|
2 | 2 | ||||||
| MIRT544295 | TSPYL1 | TSPY like 1 | |
|
2 | 2 | ||||||
| MIRT544857 | MYH2 | myosin heavy chain 2 | |
|
2 | 4 | ||||||
| MIRT557323 | HIATL1 | major facilitator superfamily domain containing 14B | |
|
2 | 4 | ||||||
| MIRT560522 | TMEM98 | transmembrane protein 98 | |
|
2 | 2 | ||||||
| MIRT561565 | SLC6A9 | solute carrier family 6 member 9 | |
|
2 | 2 | ||||||
| MIRT562374 | ERI2 | ERI1 exoribonuclease family member 2 | |
|
2 | 2 | ||||||
| MIRT565780 | SEMA6D | semaphorin 6D | |
|
2 | 2 | ||||||
| MIRT569548 | UNC119B | unc-119 lipid binding chaperone B | |
|
2 | 2 | ||||||
| MIRT569944 | PRRT2 | proline rich transmembrane protein 2 | |
|
2 | 2 | ||||||
| MIRT570016 | COL1A2 | collagen type I alpha 2 chain | |
|
2 | 2 | ||||||
| MIRT572163 | CRK | CRK proto-oncogene, adaptor protein | |
|
2 | 2 | ||||||
| MIRT572322 | HSPB6 | heat shock protein family B (small) member 6 | |
|
2 | 2 | ||||||
| MIRT573495 | IQSEC3 | IQ motif and Sec7 domain 3 | |
|
2 | 2 | ||||||
| MIRT574139 | MARVELD1 | MARVEL domain containing 1 | |
|
2 | 2 | ||||||
| MIRT609449 | CCDC149 | coiled-coil domain containing 149 | |
|
2 | 2 | ||||||
| MIRT610619 | ARHGAP18 | Rho GTPase activating protein 18 | |
|
2 | 2 | ||||||
| MIRT623355 | LZIC | leucine zipper and CTNNBIP1 domain containing | |
|
2 | 2 | ||||||
| MIRT629854 | ACOX1 | acyl-CoA oxidase 1 | |
|
2 | 2 | ||||||
| MIRT630516 | CDC73 | cell division cycle 73 | |
|
2 | 2 | ||||||
| MIRT632535 | PSMB2 | proteasome subunit beta 2 | |
|
2 | 2 | ||||||
| MIRT633975 | SLC35E2 | solute carrier family 35 member E2 | |
|
2 | 2 | ||||||
| MIRT636408 | MTHFD2 | methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase | |
|
2 | 2 | ||||||
| MIRT641722 | LTBR | lymphotoxin beta receptor | |
|
2 | 2 | ||||||
| MIRT642661 | RGS6 | regulator of G protein signaling 6 | |
|
2 | 2 | ||||||
| MIRT649649 | MAST3 | microtubule associated serine/threonine kinase 3 | |
|
2 | 2 | ||||||
| MIRT650367 | MOCS3 | molybdenum cofactor synthesis 3 | |
|
2 | 2 | ||||||
| MIRT651355 | ZBTB40 | zinc finger and BTB domain containing 40 | |
|
2 | 2 | ||||||
| MIRT664840 | HUS1 | HUS1 checkpoint clamp component | |
|
2 | 2 | ||||||
| MIRT667322 | MYH9 | myosin heavy chain 9 | |
|
2 | 2 | ||||||
| MIRT670680 | SUGT1 | SGT1 homolog, MIS12 kinetochore complex assembly cochaperone | |
|
2 | 2 | ||||||
| MIRT674922 | TRPM6 | transient receptor potential cation channel subfamily M member 6 | |
|
2 | 2 | ||||||
| MIRT675919 | CYP51A1 | cytochrome P450 family 51 subfamily A member 1 | |
|
2 | 2 | ||||||
| MIRT676493 | GJD3 | gap junction protein delta 3 | |
|
2 | 2 | ||||||
| MIRT680162 | ZDHHC20 | zinc finger DHHC-type containing 20 | |
|
2 | 2 | ||||||
| MIRT688008 | GSN | gelsolin | |
|
2 | 2 | ||||||
| MIRT688997 | ATP6AP1 | ATPase H+ transporting accessory protein 1 | |
|
2 | 2 | ||||||
| MIRT700337 | RAB4A | RAB4A, member RAS oncogene family | |
|
2 | 2 | ||||||
| MIRT701344 | NR4A3 | nuclear receptor subfamily 4 group A member 3 | |
|
2 | 2 | ||||||
| MIRT703519 | FKBP15 | FK506 binding protein 15 | |
|
2 | 2 | ||||||
| MIRT703901 | EPT1 | selenoprotein I | |
|
2 | 2 | ||||||
| MIRT705565 | ARHGEF18 | Rho/Rac guanine nucleotide exchange factor 18 | |
|
2 | 2 | ||||||
| MIRT709709 | DNAJC11 | DnaJ heat shock protein family (Hsp40) member C11 | |
|
2 | 2 | ||||||
| MIRT713108 | TMBIM4 | transmembrane BAX inhibitor motif containing 4 | |
|
2 | 2 | ||||||
| MIRT718426 | ZNF85 | zinc finger protein 85 | |
|
2 | 2 | ||||||
| MIRT719236 | CYSLTR2 | cysteinyl leukotriene receptor 2 | |
|
2 | 2 | ||||||
| MIRT719326 | STAC | SH3 and cysteine rich domain | |
|
2 | 2 | ||||||
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|