pre-miRNA Information
pre-miRNA hsa-mir-4271   
Genomic Coordinates chr3: 49274120 - 49274186
Description Homo sapiens miR-4271 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4271
Sequence 39| GGGGGAAGAAAAGGUGGGG |57
Evidence Experimental
Experiments SOLiD
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30481495 1 COSMIC
COSN31532060 5 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs760829741 1 dbSNP
rs1277951968 2 dbSNP
rs189148716 3 dbSNP
rs757021935 4 dbSNP
rs1285201145 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SHMT2   
Synonyms GLYA, HEL-S-51e, SHMT
Description serine hydroxymethyltransferase 2
Transcript NM_001166356   
Other Transcripts NM_001166357 , NM_001166358 , NM_001166359 , NM_005412   
Expression
Putative miRNA Targets on SHMT2
3'UTR of SHMT2
(miRNA target sites are highlighted)
>SHMT2|NM_001166356|3'UTR
   1 AGGCACCTGGGAAATGAGGCCCACAGACTCAAAGTTACTCTCCTTCCCCCTACCTGGGCCAGTGAAATAGAAAGCCTTTC
  81 TATTTTTTGGTGCGGGAGGGAAGACCTCTCACTTAGGGCAAGAGCCAGGTATAGTCTCCCTTCCCAGAATTTGTAACTGA
 161 GAAGATCTTTTCTTTTTCCTTTTTTTGGTAACAAGACTTAGAAGGAGGGCCCAGGCACTTTCTGTTTGAACCCCTGTCAT
 241 GATCACAGTGTCAGAGACGCGTCCTCTTTCTTGGGGAAGTTGAGGAGTGCCCTTCAGAGCCAGTAGCAGGCAGGGGTGGG
 321 TAGGCACCCTCCTTCCTGTTTTTATCTAATAAAATGCTAACCTGCCCTGAGTTTCCATTACTGTGGGTGGGGTTCCCCTG
 401 GGCCAAACAGTGATTTGTCTCCCTCAATGTGTACACCGCTCCGCTCCCACCACCGCTACCACAAGGACCCCCGGGGCTGC
 481 AGCCTCCTCTTTCTGTCTCTGATCAGAGCCGACACCAGACGTGATTAGCAGGCGCAGCAAATTCAATTTGTTAAATGAAA
 561 TTGTATTTTGCCCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ggggugGAAAAGAAGGGGg 5'
                || | ||||||| 
Target 5' aagttaCTCTCCTTCCCCc 3'
32 - 50 149.00 -17.20
2
miRNA  3' ggggUGGAAAAGAAGGGGg 5'
              |:||||||||:::| 
Target 5' gaagATCTTTTCTTTTTCc 3'
161 - 179 123.00 -16.60
3
miRNA  3' gggguggaaaaGAAGGGgg 5'
                     ||||||  
Target 5' gtatagtctccCTTCCCag 3'
129 - 147 120.00 -11.31
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30519060 41 COSMIC
COSN26602638 57 COSMIC
COSN30156193 61 COSMIC
COSN28192288 174 COSMIC
COSN20071288 187 COSMIC
COSN26775754 328 COSMIC
COSN25638802 348 COSMIC
COSN31552472 400 COSMIC
COSN26550605 496 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1318716703 3 dbSNP
rs776322364 4 dbSNP
rs1267305023 6 dbSNP
rs761489843 7 dbSNP
rs369547769 18 dbSNP
rs1254924476 19 dbSNP
rs773049410 22 dbSNP
rs1190742792 24 dbSNP
rs1367457277 25 dbSNP
rs368073830 26 dbSNP
rs762750160 27 dbSNP
rs1342090515 31 dbSNP
rs766301585 32 dbSNP
rs1157370152 33 dbSNP
rs751474653 38 dbSNP
rs1461605333 41 dbSNP
rs1166656200 46 dbSNP
rs1018318623 47 dbSNP
rs868141399 73 dbSNP
rs569698983 76 dbSNP
rs777491878 77 dbSNP
rs746445562 78 dbSNP
rs11557170 81 dbSNP
rs11557169 83 dbSNP
rs770457966 85 dbSNP
rs1349703625 90 dbSNP
rs1301672690 91 dbSNP
rs1432231994 94 dbSNP
rs962469471 95 dbSNP
rs1167417327 103 dbSNP
rs185235043 117 dbSNP
rs980485613 119 dbSNP
rs1426176394 120 dbSNP
rs926314060 128 dbSNP
rs1426849309 130 dbSNP
rs1422073935 139 dbSNP
rs1465231327 140 dbSNP
rs1477491373 141 dbSNP
rs1266585034 146 dbSNP
rs572752383 147 dbSNP
rs1206961908 150 dbSNP
rs939006357 159 dbSNP
rs11557168 173 dbSNP
rs972752823 175 dbSNP
rs923443104 180 dbSNP
rs1464737819 181 dbSNP
rs772967471 197 dbSNP
rs933524360 198 dbSNP
rs991754457 203 dbSNP
rs554647678 210 dbSNP
rs1302444705 211 dbSNP
rs945246287 212 dbSNP
rs1378232659 218 dbSNP
rs371194878 226 dbSNP
rs1281785347 227 dbSNP
rs1280091630 229 dbSNP
rs925107890 231 dbSNP
rs1411987372 232 dbSNP
rs776714750 234 dbSNP
rs936407301 245 dbSNP
rs1263217684 246 dbSNP
rs749771372 248 dbSNP
rs1360459587 255 dbSNP
rs1053420994 256 dbSNP
rs577090328 259 dbSNP
rs540821542 260 dbSNP
rs1009468237 261 dbSNP
rs1486423468 262 dbSNP
rs1219246947 264 dbSNP
rs145812788 265 dbSNP
rs899890870 267 dbSNP
rs1484191461 272 dbSNP
rs1257891329 275 dbSNP
rs1210836421 283 dbSNP
rs1323095475 284 dbSNP
rs1261449150 285 dbSNP
rs1477789051 288 dbSNP
rs1230642157 289 dbSNP
rs1403652259 296 dbSNP
rs1351537189 297 dbSNP
rs1306694631 302 dbSNP
rs1390229967 308 dbSNP
rs750569476 313 dbSNP
rs1001960181 319 dbSNP
rs1033478512 326 dbSNP
rs770776806 329 dbSNP
rs1451226721 330 dbSNP
rs1200699686 332 dbSNP
rs1403469170 344 dbSNP
rs1160991741 347 dbSNP
rs958761699 347 dbSNP
rs998206255 349 dbSNP
rs1390514568 356 dbSNP
rs1051497716 358 dbSNP
rs112143664 367 dbSNP
rs1156651100 371 dbSNP
rs887376101 378 dbSNP
rs769245450 384 dbSNP
rs1256690368 386 dbSNP
rs1182548070 387 dbSNP
rs553143014 391 dbSNP
rs1241328922 392 dbSNP
rs572197786 398 dbSNP
rs1017142056 403 dbSNP
rs1431486942 408 dbSNP
rs1175670234 417 dbSNP
rs1330074337 424 dbSNP
rs371580524 428 dbSNP
rs1454170815 436 dbSNP
rs1324064925 437 dbSNP
rs375353676 438 dbSNP
rs369375949 439 dbSNP
rs1033401544 440 dbSNP
rs1435432987 441 dbSNP
rs373185705 443 dbSNP
rs376265132 443 dbSNP
rs1442663463 444 dbSNP
rs543812804 444 dbSNP
rs913566895 445 dbSNP
rs1190530959 447 dbSNP
rs189601930 447 dbSNP
rs1358209456 448 dbSNP
rs1465520597 449 dbSNP
rs913522359 455 dbSNP
rs373864153 456 dbSNP
rs1046073972 471 dbSNP
rs979742682 473 dbSNP
rs925139124 474 dbSNP
rs1299189392 478 dbSNP
rs532841107 480 dbSNP
rs1054853277 487 dbSNP
rs1488145922 492 dbSNP
rs547631718 493 dbSNP
rs888306068 495 dbSNP
rs1223913575 496 dbSNP
rs921353806 506 dbSNP
rs1170602535 511 dbSNP
rs759410807 512 dbSNP
rs1191355376 516 dbSNP
rs1372556033 516 dbSNP
rs1435126785 517 dbSNP
rs1268568645 518 dbSNP
rs1222137009 519 dbSNP
rs773600442 522 dbSNP
rs1016797966 523 dbSNP
rs1277344669 528 dbSNP
rs560038393 529 dbSNP
rs529795181 534 dbSNP
rs548342053 535 dbSNP
rs954918365 538 dbSNP
rs986409676 545 dbSNP
rs766549553 547 dbSNP
rs1402833121 548 dbSNP
rs574267940 557 dbSNP
rs1308615323 563 dbSNP
rs1157035895 564 dbSNP
rs1395948767 566 dbSNP
rs958232321 574 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' ggggugGAAAAGAAGGGGg 5'
                || | ||||||| 
Target 5' aaguuaCUCUCCUUCCCCc 3'
13 - 31
2
miRNA  3' gggguggaaaagaaGGGgg 5'
                        |||  
Target 5' --------------CCCac 3'
1 - 5
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_001166358 | 3UTR | ACAGACUCAAAGUUACUCUCCUUCCCCCUACCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_001166358 | 3UTR | AGACUCAAAGUUACUCUCCUUCCCCCUACCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_001166358 | 3UTR | CACAGACUCAAAGUUACUCUCCUUCCCCCUACCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_001166358 | 3UTR | AGACUCAAAGUUACUCUCCUUCCCCCUACCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_001166358 | 3UTR | UCAAAGUUACUCUCCUUCCCCCUACCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000328923.3 | 3UTR | CCCACAGACUCAAAGUUACUCUCCUUCCCCCUACCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
181 hsa-miR-4271 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT066209 MARCH9 membrane associated ring-CH-type finger 9 2 2
MIRT079367 CCDC137 coiled-coil domain containing 137 2 2
MIRT081183 MIDN midnolin 2 4
MIRT083278 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT086207 HOXD13 homeobox D13 2 2
MIRT133713 SKI SKI proto-oncogene 2 4
MIRT150653 SLC27A1 solute carrier family 27 member 1 2 2
MIRT159166 NRBP1 nuclear receptor binding protein 1 2 2
MIRT160059 TET3 tet methylcytosine dioxygenase 3 2 4
MIRT180856 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT181931 MARK2 microtubule affinity regulating kinase 2 2 2
MIRT190628 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 2 2
MIRT190654 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT196107 MPRIP myosin phosphatase Rho interacting protein 2 2
MIRT263248 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT321168 EIF4H eukaryotic translation initiation factor 4H 2 2
MIRT338624 SHMT2 serine hydroxymethyltransferase 2 2 2
MIRT366301 GDI1 GDP dissociation inhibitor 1 2 4
MIRT375172 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 2
MIRT441488 NCEH1 neutral cholesterol ester hydrolase 1 2 2
MIRT442333 WNT9B Wnt family member 9B 2 2
MIRT443889 CNKSR3 CNKSR family member 3 2 2
MIRT445880 WBP1L WW domain binding protein 1 like 2 2
MIRT449312 MRO maestro 2 2
MIRT449844 BCL2L13 BCL2 like 13 2 2
MIRT450304 DRAXIN dorsal inhibitory axon guidance protein 2 2
MIRT450515 EMX1 empty spiracles homeobox 1 2 2
MIRT451243 ZNF444 zinc finger protein 444 2 2
MIRT451713 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT451792 TLR5 toll like receptor 5 2 2
MIRT451823 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT451906 ILK integrin linked kinase 2 2
MIRT452181 KIAA1456 KIAA1456 2 4
MIRT452242 TRAM1 translocation associated membrane protein 1 2 2
MIRT452544 ZNF467 zinc finger protein 467 2 2
MIRT452605 REPIN1 replication initiator 1 2 2
MIRT454505 ZFYVE27 zinc finger FYVE-type containing 27 2 2
MIRT454657 FBXL18 F-box and leucine rich repeat protein 18 2 2
MIRT455354 KDM5C lysine demethylase 5C 2 2
MIRT455452 EPB41L4B erythrocyte membrane protein band 4.1 like 4B 2 2
MIRT455587 TAF12 TATA-box binding protein associated factor 12 2 2
MIRT456501 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 2 2
MIRT456815 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT457425 NOL10 nucleolar protein 10 2 2
MIRT457468 SLC35F6 solute carrier family 35 member F6 2 2
MIRT457660 SERINC1 serine incorporator 1 2 2
MIRT458231 NXPH3 neurexophilin 3 2 2
MIRT458374 ITM2C integral membrane protein 2C 2 2
MIRT458667 GPR35 G protein-coupled receptor 35 2 2
MIRT459665 VPS37C VPS37C, ESCRT-I subunit 2 2
MIRT459825 TPP1 tripeptidyl peptidase 1 2 2
MIRT460564 FEM1A fem-1 homolog A 2 2
MIRT460725 ASXL3 additional sex combs like 3, transcriptional regulator 2 2
MIRT461121 RAB36 RAB36, member RAS oncogene family 2 2
MIRT461529 C14orf1 ergosterol biosynthesis 28 homolog 2 2
MIRT461750 DDX11 DEAD/H-box helicase 11 2 2
MIRT462570 STS steroid sulfatase 2 2
MIRT462798 NTN1 netrin 1 2 2
MIRT463030 ZNF689 zinc finger protein 689 2 2
MIRT463991 WDTC1 WD and tetratricopeptide repeats 1 2 2
MIRT464684 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 2
MIRT465439 TP53 tumor protein p53 2 2
MIRT465512 PRICKLE4 prickle planar cell polarity protein 4 2 2
MIRT465649 TNPO2 transportin 2 2 10
MIRT465947 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 2
MIRT466028 TMEM189 transmembrane protein 189 2 2
MIRT468076 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 6
MIRT468131 SH3PXD2A SH3 and PX domains 2A 2 2
MIRT468498 SESN2 sestrin 2 2 2
MIRT468879 RREB1 ras responsive element binding protein 1 2 2
MIRT469318 RGP1 RGP1 homolog, RAB6A GEF complex partner 1 2 2
MIRT469558 RARA retinoic acid receptor alpha 2 2
MIRT469793 RAB15 RAB15, member RAS oncogene family 2 2
MIRT469896 PTRF caveolae associated protein 1 2 2
MIRT470235 PRRC2A proline rich coiled-coil 2A 2 2
MIRT470808 PLXND1 plexin D1 2 2
MIRT471597 PAQR5 progestin and adipoQ receptor family member 5 2 10
MIRT471710 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 2 2
MIRT471752 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 2
MIRT472978 MRRF mitochondrial ribosome recycling factor 2 2
MIRT473538 MAX MYC associated factor X 2 2
MIRT473581 MAT2A methionine adenosyltransferase 2A 2 2
MIRT473970 LRRC58 leucine rich repeat containing 58 2 2
MIRT474223 LCOR ligand dependent nuclear receptor corepressor 2 4
MIRT474553 KLHDC3 kelch domain containing 3 2 2
MIRT474777 KIAA0895L KIAA0895 like 2 2
MIRT476042 GRSF1 G-rich RNA sequence binding factor 1 2 2
MIRT476438 GBA2 glucosylceramidase beta 2 2 2
MIRT477773 E2F3 E2F transcription factor 3 2 4
MIRT477946 DPM2 dolichyl-phosphate mannosyltransferase subunit 2, regulatory 2 2
MIRT478782 CRTC2 CREB regulated transcription coactivator 2 2 2
MIRT479320 VPS72 vacuolar protein sorting 72 homolog 2 2
MIRT480405 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT480593 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 2 2
MIRT480963 BBC3 BCL2 binding component 3 2 2
MIRT481127 AZIN1 antizyme inhibitor 1 2 4
MIRT481444 ARRB2 arrestin beta 2 2 2
MIRT481687 AR androgen receptor 2 2
MIRT481730 APH1A aph-1 homolog A, gamma-secretase subunit 2 2
MIRT482386 AEN apoptosis enhancing nuclease 2 2
MIRT482564 ABHD2 abhydrolase domain containing 2 2 2
MIRT482605 ABHD14B abhydrolase domain containing 14B 2 2
MIRT483256 CITED4 Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 4 2 4
MIRT483531 TAGLN2 transgelin 2 2 2
MIRT483840 UNC5B unc-5 netrin receptor B 2 4
MIRT483935 LENG8 leukocyte receptor cluster member 8 2 4
MIRT484414 SNX19 sorting nexin 19 2 2
MIRT484487 SLC9A1 solute carrier family 9 member A1 2 2
MIRT484609 SIX3 SIX homeobox 3 2 6
MIRT484703 RNF11 ring finger protein 11 2 2
MIRT485244 POGZ pogo transposable element derived with ZNF domain 2 2
MIRT485607 FOSL1 FOS like 1, AP-1 transcription factor subunit 2 4
MIRT485965 RTBDN retbindin 2 2
MIRT487308 GLTSCR1 BRD4 interacting chromatin remodeling complex associated protein 2 2
MIRT487329 SREBF1 sterol regulatory element binding transcription factor 1 2 4
MIRT487410 CACNB1 calcium voltage-gated channel auxiliary subunit beta 1 2 2
MIRT487607 C20orf96 chromosome 20 open reading frame 96 2 2
MIRT487689 CDK14 cyclin dependent kinase 14 2 2
MIRT487787 GPR20 G protein-coupled receptor 20 2 4
MIRT488026 ADO 2-aminoethanethiol dioxygenase 2 2
MIRT488476 B3GALNT2 beta-1,3-N-acetylgalactosaminyltransferase 2 2 2
MIRT488761 FXYD1 FXYD domain containing ion transport regulator 1 2 2
MIRT489161 MRPL12 mitochondrial ribosomal protein L12 2 4
MIRT489529 MRE11A MRE11 homolog, double strand break repair nuclease 2 8
MIRT489774 GRINA glutamate ionotropic receptor NMDA type subunit associated protein 1 2 2
MIRT489878 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT490094 FN3K fructosamine 3 kinase 2 2
MIRT490202 PKNOX2 PBX/knotted 1 homeobox 2 2 2
MIRT490283 ISL2 ISL LIM homeobox 2 2 2
MIRT490377 LHFPL3 LHFPL tetraspan subfamily member 3 2 2
MIRT491035 ALPK3 alpha kinase 3 2 2
MIRT491186 JUND JunD proto-oncogene, AP-1 transcription factor subunit 2 4
MIRT491766 ZNF385A zinc finger protein 385A 2 2
MIRT491888 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 2 2
MIRT491981 UNK unkempt family zinc finger 2 2
MIRT492400 SDK1 sidekick cell adhesion molecule 1 2 2
MIRT493647 HDLBP high density lipoprotein binding protein 2 2
MIRT494010 DUSP9 dual specificity phosphatase 9 2 2
MIRT494167 CNOT6L CCR4-NOT transcription complex subunit 6 like 2 2
MIRT495712 PADI1 peptidyl arginine deiminase 1 2 2
MIRT496873 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT499175 RBPJL recombination signal binding protein for immunoglobulin kappa J region like 2 2
MIRT501652 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT506645 MAPK1 mitogen-activated protein kinase 1 2 4
MIRT510590 TUBB2A tubulin beta 2A class IIa 2 6
MIRT511907 FKBP1A FK506 binding protein 1A 2 2
MIRT513063 ANKRD45 ankyrin repeat domain 45 2 2
MIRT513104 DYNAP dynactin associated protein 2 2
MIRT521804 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT523520 GLUL glutamate-ammonia ligase 2 2
MIRT525085 FRK fyn related Src family tyrosine kinase 2 2
MIRT530930 SCIN scinderin 2 2
MIRT533501 TRIM71 tripartite motif containing 71 2 2
MIRT538560 CECR2 CECR2, histone acetyl-lysine reader 2 2
MIRT544556 CSNK2A1 casein kinase 2 alpha 1 2 2
MIRT555912 ORMDL3 ORMDL sphingolipid biosynthesis regulator 3 2 2
MIRT560405 TMEM69 transmembrane protein 69 2 2
MIRT560664 RTN3 reticulon 3 2 2
MIRT564061 CDT1 chromatin licensing and DNA replication factor 1 2 2
MIRT565504 SP1 Sp1 transcription factor 2 2
MIRT570014 COL1A2 collagen type I alpha 2 chain 2 2
MIRT572321 HSPB6 heat shock protein family B (small) member 6 2 2
MIRT573229 TRIM21 tripartite motif containing 21 2 2
MIRT573487 IQSEC3 IQ motif and Sec7 domain 3 2 2
MIRT574137 MARVELD1 MARVEL domain containing 1 2 2
MIRT574323 ZNF703 zinc finger protein 703 2 2
MIRT620939 OSMR oncostatin M receptor 2 2
MIRT650080 MTL5 testis expressed metallothionein like protein 2 2
MIRT684553 ZNF708 zinc finger protein 708 2 2
MIRT685841 ANGEL1 angel homolog 1 2 2
MIRT688551 DCAF16 DDB1 and CUL4 associated factor 16 2 2
MIRT701985 MIER3 MIER family member 3 2 2
MIRT703899 EPT1 selenoprotein I 2 2
MIRT706388 MC2R melanocortin 2 receptor 2 2
MIRT707487 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT711885 INSIG2 insulin induced gene 2 2 2
MIRT719164 KIF6 kinesin family member 6 2 2
MIRT721294 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT721775 ARL6IP4 ADP ribosylation factor like GTPase 6 interacting protein 4 2 2
MIRT723763 NKIRAS2 NFKB inhibitor interacting Ras like 2 2 2
MIRT725485 GPR26 G protein-coupled receptor 26 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miR-4271 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (BGC823)
hsa-miR-4271 Platinum-based doublet chemotherapy sensitive High Lung Adenocarcinoma tissue
hsa-miR-4271 Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-4271 Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PATU8988)
hsa-miR-4271 Cisplatin 5460033 NSC119875 approved resistant Low Tongue Squamous Cell Carcinoma cell line (CAL-27, SCC-9)
hsa-miR-4271 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (H460)
hsa-miR-4271 Anlotinib 25017411 NSC832523 sensitive Low Non-Small Cell Lung Cancer cell line (A549, PDC, H460)
hsa-miR-4271 Gefitinib 123631 NSC715055 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, PDC, H460)
hsa-miR-4271 Icotinib 22024915 NSC800770 sensitive Low Non-Small Cell Lung Cancer cell line (A549, PDC, H460)
hsa-miR-4271 Erlotinib 176870 NSC718781 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, PDC, H460)
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-mir-4271 Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-4271 Androstenedione+Letrozole resistant cell line (MCF-7)
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved sensitive cell line (BGC-823)
hsa-miR-4271 Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (cytosolic RNA)
hsa-miR-4271 Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (total RNA)
hsa-miR-4271 Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-4271 Platinum-based doublet chemotherapy sensitive tissue (lung adenocarcinoma)
hsa-miR-4271 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-4271 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-4271 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4271 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-4271 Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission