pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-664a |
Genomic Coordinates | chr1: 220200538 - 220200619 |
Description | Homo sapiens miR-664 stem-loop |
Comment | This miRNA sequence overlaps an annotated snoRNA, ACA38b. However, both miR and miR* sequences are identified in reference , and the sequence is homologous with rat mir-664. |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-664a-3p | |||||||||||||||||||||||||||||||||||||||||||||
Sequence | 49| UAUUCAUUUAUCCCCAGCCUACA |71 | |||||||||||||||||||||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||||||||||||||||||||
Experiments | Illumina | DRVs in miRNA |
|
|||||||||||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | ARID1A | ||||||||||||||||||||
Synonyms | B120, BAF250, BAF250a, BM029, C1orf4, CSS2, ELD, MRD14, OSA1, P270, SMARCF1, hELD, hOSA1 | ||||||||||||||||||||
Description | AT-rich interaction domain 1A | ||||||||||||||||||||
Transcript | NM_006015 | ||||||||||||||||||||
Other Transcripts | NM_139135 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on ARID1A | |||||||||||||||||||||
3'UTR of ARID1A (miRNA target sites are highlighted) |
>ARID1A|NM_006015|3'UTR 1 CAGCCGTGGGACACCTCCCCCCCCCGTGTGTGTGTGCGTGTGTGGAGAACTTAGAAACTGACTGTTGCCCTTTATTTATG 81 CAAAACCACCTCAGAATCCAGTTTACCCTGTGCTGTCCAGCTTCTCCCTTGGGAAAAAGTCTCTCCTGTTTCTCTCTCCT 161 CCTTCCACCTCCCCTCCCTCCATCACCTCACGCCTTTCTGTTCCTTGTCCTCACCTTACTCCCCTCAGGACCCTACCCCA 241 CCCTCTTTGAAAAGACAAAGCTCTGCCTACATAGAAGACTTTTTTTATTTTAACCAAAGTTACTGTTGTTTACAGTGAGT 321 TTGGGGAAAAAAAATAAAATAAAAATGGCTTTCCCAGTCCTTGCATCAACGGGATGCCACATTTCATAACTGTTTTTAAT 401 GGTAAAAAAAAAAAAAAAAAATACAAAAAAAAATTCTGAAGGACAAAAAAGGTGACTGCTGAACTGTGTGTGGTTTATTG 481 TTGTACATTCACAATCTTGCAGGAGCCAAGAAGTTCGCAGTTGTGAACAGACCCTGTTCACTGGAGAGGCCTGTGCAGTA 561 GAGTGTAGACCCTTTCATGTACTGTACTGTACACCTGATACTGTAAACATACTGTAATAATAATGTCTCACATGGAAACA 641 GAAAACGCTGGGTCAGCAGCAAGCTGTAGTTTTTAAAAATGTTTTTAGTTAAACGTTGAGGAGAAAAAAAAAAAAGGCTT 721 TTCCCCCAAAGTATCATGTGTGAACCTACAACACCCTGACCTCTTTCTCTCCTCCTTGATTGTATGAATAACCCTGAGAT 801 CACCTCTTAGAACTGGTTTTAACCTTTAGCTGCAGCGGCTACGCTGCCACGTGTGTATATATATGACGTTGTACATTGCA 881 CATACCCTTGGATCCCCACAGTTTGGTCCTCCTCCCAGCTACCCCTTTATAGTATGACGAGTTAACAAGTTGGTGACCTG 961 CACAAAGCGAGACACAGCTATTTAATCTCTTGCCAGATATCGCCCCTCTTGGTGCGATGCTGTACAGGTCTCTGTAAAAA 1041 GTCCTTGCTGTCTCAGCAGCCAATCAACTTATAGTTTATTTTTTTCTGGGTTTTTGTTTTGTTTTGTTTTCTTTCTAATC 1121 GAGGTGTGAAAAAGTTCTAGGTTCAGTTGAAGTTCTGATGAAGAAACACAATTGAGATTTTTTCAGTGATAAAATCTGCA 1201 TATTTGTATTTCAACAATGTAGCTAAAACTTGATGTAAATTCCTCCTTTTTTTCCTTTTTTGGCTTAATGAATATCATTT 1281 ATTCAGTATGAAATCTTTATACTATATGTTCCACGTGTTAAGAATAAATGTACATTAAATCTTGGTAAGACTTT Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | TZM-bl |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
CLIP-seq Support 1 for dataset GSM1462574 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | TZM-bl / TZM-bl ami BaL |
Location of target site | ENST00000324856.7 | 3UTR | AACCUACAACACCCUGACCUCUUUCUCUCCUCCUUGAUUGUAUGAAUAACCCUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
88 hsa-miR-664a-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT035824 | HIAT1 | major facilitator superfamily domain containing 14A | 1 | 1 | ||||||||
MIRT035826 | FUS | FUS RNA binding protein | 1 | 1 | ||||||||
MIRT069432 | SIVA1 | SIVA1 apoptosis inducing factor | 2 | 2 | ||||||||
MIRT071494 | CALM1 | calmodulin 1 | 2 | 2 | ||||||||
MIRT100410 | HSPA1B | heat shock protein family A (Hsp70) member 1B | 2 | 2 | ||||||||
MIRT143469 | CHD9 | chromodomain helicase DNA binding protein 9 | 2 | 2 | ||||||||
MIRT191113 | ARF6 | ADP ribosylation factor 6 | 2 | 2 | ||||||||
MIRT235584 | SNRPB2 | small nuclear ribonucleoprotein polypeptide B2 | 2 | 8 | ||||||||
MIRT339131 | ARID1A | AT-rich interaction domain 1A | 2 | 2 | ||||||||
MIRT437450 | MAT1A | methionine adenosyltransferase 1A | 1 | 1 | ||||||||
MIRT442234 | BTD | biotinidase | 2 | 2 | ||||||||
MIRT443321 | SLC35G1 | solute carrier family 35 member G1 | 2 | 2 | ||||||||
MIRT443769 | HLF | HLF, PAR bZIP transcription factor | 2 | 2 | ||||||||
MIRT444352 | KIAA1211 | KIAA1211 | 2 | 2 | ||||||||
MIRT456348 | OLIG3 | oligodendrocyte transcription factor 3 | 2 | 8 | ||||||||
MIRT458866 | CD55 | CD55 molecule (Cromer blood group) | 2 | 2 | ||||||||
MIRT466169 | TMED5 | transmembrane p24 trafficking protein 5 | 2 | 2 | ||||||||
MIRT470445 | PPP1R15B | protein phosphatase 1 regulatory subunit 15B | 2 | 6 | ||||||||
MIRT471524 | PCGF3 | polycomb group ring finger 3 | 2 | 6 | ||||||||
MIRT477744 | EDN1 | endothelin 1 | 2 | 2 | ||||||||
MIRT482885 | CACNA2D3 | calcium voltage-gated channel auxiliary subunit alpha2delta 3 | 2 | 2 | ||||||||
MIRT496336 | PTPRT | protein tyrosine phosphatase, receptor type T | 2 | 2 | ||||||||
MIRT497703 | ARL6IP6 | ADP ribosylation factor like GTPase 6 interacting protein 6 | 2 | 2 | ||||||||
MIRT499068 | CTBP1 | C-terminal binding protein 1 | 2 | 4 | ||||||||
MIRT500296 | ZNF667 | zinc finger protein 667 | 2 | 8 | ||||||||
MIRT500506 | ZBTB34 | zinc finger and BTB domain containing 34 | 2 | 8 | ||||||||
MIRT501964 | MAPK8 | mitogen-activated protein kinase 8 | 2 | 2 | ||||||||
MIRT505457 | SUB1 | SUB1 homolog, transcriptional regulator | 2 | 4 | ||||||||
MIRT505955 | RAN | RAN, member RAS oncogene family | 2 | 6 | ||||||||
MIRT507512 | DYNLL2 | dynein light chain LC8-type 2 | 2 | 4 | ||||||||
MIRT512953 | MKI67 | marker of proliferation Ki-67 | 2 | 2 | ||||||||
MIRT520450 | TSPAN2 | tetraspanin 2 | 2 | 6 | ||||||||
MIRT525997 | MAGEL2 | MAGE family member L2 | 2 | 2 | ||||||||
MIRT526424 | ZNF695 | zinc finger protein 695 | 2 | 2 | ||||||||
MIRT527364 | KRTAP13-2 | keratin associated protein 13-2 | 2 | 2 | ||||||||
MIRT529612 | H1F0 | H1 histone family member 0 | 2 | 2 | ||||||||
MIRT529811 | TMLHE | trimethyllysine hydroxylase, epsilon | 2 | 2 | ||||||||
MIRT530971 | EXO5 | exonuclease 5 | 2 | 4 | ||||||||
MIRT531294 | WNT7A | Wnt family member 7A | 2 | 2 | ||||||||
MIRT531870 | POF1B | premature ovarian failure, 1B | 2 | 2 | ||||||||
MIRT532116 | G6PC | glucose-6-phosphatase catalytic subunit | 2 | 2 | ||||||||
MIRT533534 | TPR | translocated promoter region, nuclear basket protein | 2 | 2 | ||||||||
MIRT545934 | ZBTB44 | zinc finger and BTB domain containing 44 | 2 | 4 | ||||||||
MIRT546649 | RPS6KA5 | ribosomal protein S6 kinase A5 | 2 | 2 | ||||||||
MIRT548063 | GNS | glucosamine (N-acetyl)-6-sulfatase | 2 | 2 | ||||||||
MIRT548288 | FAM3C | family with sequence similarity 3 member C | 2 | 4 | ||||||||
MIRT551018 | SPPL3 | signal peptide peptidase like 3 | 2 | 2 | ||||||||
MIRT551139 | ZNF678 | zinc finger protein 678 | 2 | 2 | ||||||||
MIRT552398 | ZNF487P | zinc finger protein 487 | 1 | 1 | ||||||||
MIRT555640 | PHIP | pleckstrin homology domain interacting protein | 2 | 4 | ||||||||
MIRT556267 | MAPK6 | mitogen-activated protein kinase 6 | 2 | 2 | ||||||||
MIRT558864 | CD2AP | CD2 associated protein | 2 | 2 | ||||||||
MIRT559239 | BEND4 | BEN domain containing 4 | 2 | 2 | ||||||||
MIRT559438 | ARSJ | arylsulfatase family member J | 2 | 2 | ||||||||
MIRT559793 | ZNF415 | zinc finger protein 415 | 2 | 2 | ||||||||
MIRT562572 | CBX6 | chromobox 6 | 2 | 2 | ||||||||
MIRT562741 | ZNF83 | zinc finger protein 83 | 2 | 2 | ||||||||
MIRT564737 | ZNF23 | zinc finger protein 23 | 2 | 2 | ||||||||
MIRT565174 | LINC00598 | long intergenic non-protein coding RNA 598 | 2 | 2 | ||||||||
MIRT566301 | PPM1A | protein phosphatase, Mg2+/Mn2+ dependent 1A | 2 | 2 | ||||||||
MIRT571656 | SERBP1 | SERPINE1 mRNA binding protein 1 | 2 | 2 | ||||||||
MIRT610720 | NAV2 | neuron navigator 2 | 2 | 2 | ||||||||
MIRT611486 | ADCYAP1R1 | ADCYAP receptor type I | 2 | 4 | ||||||||
MIRT617118 | KANK2 | KN motif and ankyrin repeat domains 2 | 2 | 2 | ||||||||
MIRT617836 | SIGLEC10 | sialic acid binding Ig like lectin 10 | 2 | 2 | ||||||||
MIRT636145 | VLDLR | very low density lipoprotein receptor | 2 | 2 | ||||||||
MIRT638060 | YAE1D1 | Yae1 domain containing 1 | 2 | 4 | ||||||||
MIRT640159 | CDK13 | cyclin dependent kinase 13 | 2 | 2 | ||||||||
MIRT644257 | WEE2 | WEE1 homolog 2 | 2 | 2 | ||||||||
MIRT646838 | TLDC1 | TBC/LysM-associated domain containing 1 | 2 | 2 | ||||||||
MIRT653074 | ST8SIA4 | ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 | 2 | 2 | ||||||||
MIRT657671 | GPR26 | G protein-coupled receptor 26 | 2 | 2 | ||||||||
MIRT660601 | AP3M2 | adaptor related protein complex 3 mu 2 subunit | 2 | 2 | ||||||||
MIRT668908 | CREB1 | cAMP responsive element binding protein 1 | 2 | 2 | ||||||||
MIRT672685 | GTF2H5 | general transcription factor IIH subunit 5 | 2 | 2 | ||||||||
MIRT680977 | DCAF17 | DDB1 and CUL4 associated factor 17 | 2 | 2 | ||||||||
MIRT682271 | RS1 | retinoschisin 1 | 2 | 2 | ||||||||
MIRT702058 | RNMT | RNA guanine-7 methyltransferase | 2 | 2 | ||||||||
MIRT707786 | UNK | unkempt family zinc finger | 2 | 2 | ||||||||
MIRT709238 | RANGAP1 | Ran GTPase activating protein 1 | 2 | 2 | ||||||||
MIRT710119 | MED23 | mediator complex subunit 23 | 2 | 2 | ||||||||
MIRT710675 | ADAP2 | ArfGAP with dual PH domains 2 | 2 | 2 | ||||||||
MIRT712884 | NIPBL | NIPBL, cohesin loading factor | 2 | 2 | ||||||||
MIRT719015 | HPGD | 15-hydroxyprostaglandin dehydrogenase | 2 | 2 | ||||||||
MIRT723323 | COLEC10 | collectin subfamily member 10 | 2 | 2 | ||||||||
MIRT724947 | TXNL1 | thioredoxin like 1 | 2 | 2 | ||||||||
MIRT725535 | EN2 | engrailed homeobox 2 | 2 | 2 | ||||||||
MIRT734156 | FHL1 | four and a half LIM domains 1 | 3 | 0 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|