miRTarBase - #MIRT340681


—
pre-miRNA Information
pre-miRNA hsa-mir-3973   
Genomic Coordinates chr11: 36010098 - 36010204
Description Homo sapiens miR-3973 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3973
Sequence 84| ACAAAGUACAGCAUUAGCCUUAG |106
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs770990564 3 dbSNP
rs1265409247 6 dbSNP
rs776720932 7 dbSNP
rs1303596672 18 dbSNP
rs183016698 23 dbSNP
Putative Targets

Gene Information
Gene Symbol THRAP3   
Synonyms BCLAF2, TRAP150
Description thyroid hormone receptor associated protein 3
Transcript NM_005119   
Expression
Putative miRNA Targets on THRAP3
3'UTR of THRAP3
(miRNA target sites are highlighted)		 
>THRAP3|NM_005119|3'UTR
   1 GGGCCACCCTTGACGGGATTCCTGCCCAGGGGAGAGAGGCGCTGGGAAGATGGCTGGTGAGGAGCTTAACAGAGGAACCT
  81 CAAGAAGATTCTGAAAATCCTACCCCCACCCCCCACCAGCCGCACAGATTGTACTACCGCGAGAGGCATCCCTGGCGCTG
 161 TCTCCCACTGGACAGAGGAGGCTGGCCATGGGGCCCAGGGGTCAGGCCCAGCTTTTGAGCAGAATACAACGCATTGGGCT
 241 TTAGCTGTTTTTCTCATTTGTTGGTGTGTGGGGTGGGGGCAGGGGTAGGGCGGGAGAGCGATGCTTGGATTTTTGTTTCC
 321 TATTAGAAACCAACAGTTTTGTTCTAATTTCATTTCATTTGGAGCTAAGATGACTAATTTGATGATTTTCGATCTCTTTT
 401 CCCCTGTCCTGATTTTAAAAGCCCCCTCCTTTTTTTTTTTTTTTTTCTTTTTTTAGGCATATGTAGTAATATTAGAAACA
 481 TTTAATTTGGGAAACTTTGATTCTTGAAAGAGAAAACAAAAGCATGTGAATAAACTTTGAAGTGTTCACCTCAGTTTGGG
 561 ACCAAACTGCTTGGATCTTTGTAAAAACCGGTTTTGTATGTCAAGGAGGAGTTTAAGGCCTTTCCGACCACCTTGTGTTC
 641 CCCTTTTCTGCGCAGCCATGTATCACGTGGAGTTGCTCCTTACCACACCTCACGTGCCCCTGAGCCCTATTTCCTGATTT
 721 CTTCTGGGCTGGACTTCCCCGTTCTCCACCAGCAGCTCCAGTATCCCAAACTTTCTAGTCCTGCTGATCCTCCCAGCAAC
 801 GGGGTGGAAACTGGAGGGCAGTGTCTGGTCTGTTTTCTAAGAAACTTATGAATTCTATTATCTTTACAAATATGAGAAAA
 881 TTTTTTCAATATTTTTTATTAATCTTTTTATAAAATGAAAAGAAACTCCTATGATCGATTAAGGAAGGTGGTTATGGCTG
 961 GGTGGTTCAGGGGTTTTTTTGGGTTTCTTTTTTTTTTTCTTTGTCTTTTTAACCTTAAGCTGTTTAAGTTGAAGCATTCT
1041 CAGATGTTTGGGGGGAAACATCCTCTTAAAATGGGTCCTTGTGCTTGCCTTCTGGGGAGGCGGTCCTGAGCAGGTGAATC
1121 ATAAGGCATTTATGCATATGTTATATGCGGACTGCACCCACCTCTCCCCCCCAGCCTTTGCCTCTTGCGTTGTTGTGCTG
1201 CTTTCCCCTTACTTTGCTACATTTCTATAGTTAAGTTGGTTTTACTTGAATGATTCATGTTTAGGGGGAAAATGAAAATC
1281 TCCCTTAAAATTTGTTTCAACTCCTCCTGCAAATAAAATAAATGAAGTGGCAGATGTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gauucCGAUUACGAC---------AUGAAACa 5'
               |:| :|||||         ||||||| 
Target 5' gcgttGTT-GTGCTGCTTTCCCCTTACTTTGc 3'
 1187 - 1217 145.00 -10.80
2 
miRNA  3' gauucCGAUUACGAC--AUGAAACa 5'
               ||||| | ||  || |||| 
Target 5' ttggaGCTAA-GATGACTAATTTGa 3'
 359 - 382 127.00 -7.50
3 
miRNA  3' gaUUCCGAUUAC-GACAUGAAACa 5'
            || ||  :||  |  |||||| 
Target 5' caAAAGCATGTGAATAAACTTTGa 3'
 517 - 540 121.00 -6.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31537247 15 COSMIC
COSN30143632 39 COSMIC
COSN30495988 42 COSMIC
COSN15664368 91 COSMIC
COSN31491472 97 COSMIC
COSN1444423 137 COSMIC
COSN31574145 140 COSMIC
COSN31585968 158 COSMIC
COSN30133951 194 COSMIC
COSN1103622 199 COSMIC
COSN28517050 448 COSMIC
COSN6034805 576 COSMIC
COSN26217012 582 COSMIC
COSN31563818 652 COSMIC
COSN31533887 667 COSMIC
COSN20921661 822 COSMIC
COSN1103624 964 COSMIC
COSN22162899 1300 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1228897107 1 dbSNP
rs1296707975 5 dbSNP
rs1181117857 8 dbSNP
rs1253783366 10 dbSNP
rs768443156 13 dbSNP
rs773411849 15 dbSNP
rs763228847 16 dbSNP
rs1159434862 18 dbSNP
rs766416691 25 dbSNP
rs747285622 32 dbSNP
rs531217301 33 dbSNP
rs751640563 34 dbSNP
rs1244080362 35 dbSNP
rs759687988 41 dbSNP
rs373689420 42 dbSNP
rs1042214346 46 dbSNP
rs1446802939 51 dbSNP
rs1447036257 53 dbSNP
rs546276115 54 dbSNP
rs1377420331 57 dbSNP
rs1181478364 63 dbSNP
rs1398096822 74 dbSNP
rs1294454079 78 dbSNP
rs1324022724 81 dbSNP
rs1317805388 85 dbSNP
rs1216901841 89 dbSNP
rs904579738 101 dbSNP
rs1347127834 102 dbSNP
rs1000675446 103 dbSNP
rs546217428 109 dbSNP
rs564658883 114 dbSNP
rs889114426 115 dbSNP
rs1182163108 117 dbSNP
rs528690330 122 dbSNP
rs770659174 123 dbSNP
rs962206433 128 dbSNP
rs546257305 129 dbSNP
rs41267281 139 dbSNP
rs1027829404 140 dbSNP
rs1263758546 141 dbSNP
rs951854902 142 dbSNP
rs528984121 143 dbSNP
rs980909888 145 dbSNP
rs926346929 147 dbSNP
rs1398661690 148 dbSNP
rs1280254245 152 dbSNP
rs1269963204 153 dbSNP
rs532088612 157 dbSNP
rs960330903 158 dbSNP
rs778570862 160 dbSNP
rs1253182487 163 dbSNP
rs1473819951 168 dbSNP
rs1183430911 173 dbSNP
rs1487289042 175 dbSNP
rs992041543 179 dbSNP
rs1457131405 181 dbSNP
rs778495483 185 dbSNP
rs1163516204 187 dbSNP
rs568801993 189 dbSNP
rs1367002674 196 dbSNP
rs1427598469 198 dbSNP
rs1307113787 202 dbSNP
rs1426859448 204 dbSNP
rs1351106496 217 dbSNP
rs913800009 231 dbSNP
rs763160480 232 dbSNP
rs77858929 235 dbSNP
rs1043595528 240 dbSNP
rs1339910935 272 dbSNP
rs1435888612 274 dbSNP
rs1245559151 281 dbSNP
rs1370064776 281 dbSNP
rs1235255799 286 dbSNP
rs771872018 292 dbSNP
rs1351210433 293 dbSNP
rs936139738 297 dbSNP
rs551390208 299 dbSNP
rs12401872 300 dbSNP
rs889127934 301 dbSNP
rs1008863017 310 dbSNP
rs1247918914 311 dbSNP
rs1484351119 323 dbSNP
rs1040666356 324 dbSNP
rs1177612349 334 dbSNP
rs898051434 337 dbSNP
rs1438230347 340 dbSNP
rs1160781927 346 dbSNP
rs114673194 353 dbSNP
rs1422751685 356 dbSNP
rs548637094 358 dbSNP
rs12401880 366 dbSNP
rs1386716253 367 dbSNP
rs568716293 369 dbSNP
rs527951081 377 dbSNP
rs1407622575 381 dbSNP
rs182785489 392 dbSNP
rs1330945041 395 dbSNP
rs1374904188 396 dbSNP
rs1447282790 398 dbSNP
rs1001992409 399 dbSNP
rs1033808611 401 dbSNP
rs1279900794 405 dbSNP
rs1167797590 406 dbSNP
rs960381539 409 dbSNP
rs535986693 411 dbSNP
rs991759012 422 dbSNP
rs1197386411 423 dbSNP
rs1301045078 427 dbSNP
rs1020566341 428 dbSNP
rs1458780864 428 dbSNP
rs988098534 428 dbSNP
rs1233780588 429 dbSNP
rs1170002040 430 dbSNP
rs1329374933 430 dbSNP
rs1449241886 430 dbSNP
rs541773552 430 dbSNP
rs759475880 430 dbSNP
rs78206872 430 dbSNP
rs1401346685 431 dbSNP
rs1396689243 432 dbSNP
rs1317166330 438 dbSNP
rs1445469446 439 dbSNP
rs1363373635 441 dbSNP
rs1217506533 442 dbSNP
rs1355970094 442 dbSNP
rs1227917434 443 dbSNP
rs966621768 445 dbSNP
rs557311088 446 dbSNP
rs1442218344 447 dbSNP
rs376060302 447 dbSNP
rs925175893 447 dbSNP
rs75716416 448 dbSNP
rs932444180 448 dbSNP
rs1255937466 453 dbSNP
rs1475810057 455 dbSNP
rs1457070368 456 dbSNP
rs1203830407 462 dbSNP
rs1244435285 467 dbSNP
rs986233974 473 dbSNP
rs910616276 474 dbSNP
rs1412577892 476 dbSNP
rs1187504694 480 dbSNP
rs1390358004 482 dbSNP
rs1376045382 483 dbSNP
rs1430103971 499 dbSNP
rs944702117 503 dbSNP
rs1275829700 507 dbSNP
rs1341817337 509 dbSNP
rs11545217 510 dbSNP
rs1040426960 521 dbSNP
rs1273883657 526 dbSNP
rs187450906 530 dbSNP
rs11545215 531 dbSNP
rs1199150527 539 dbSNP
rs1282877889 540 dbSNP
rs1377002959 542 dbSNP
rs15514 557 dbSNP
rs114408391 567 dbSNP
rs1216508581 576 dbSNP
rs564644082 590 dbSNP
rs1193944492 591 dbSNP
rs929611358 592 dbSNP
rs1477149258 597 dbSNP
rs547005009 603 dbSNP
rs1395451921 607 dbSNP
rs1419084171 619 dbSNP
rs887957633 620 dbSNP
rs1386960115 621 dbSNP
rs1322248205 625 dbSNP
rs1329037947 626 dbSNP
rs1234962202 627 dbSNP
rs570073566 632 dbSNP
rs1002762042 633 dbSNP
rs1321494939 649 dbSNP
rs1239789100 652 dbSNP
rs780094007 653 dbSNP
rs1217842306 657 dbSNP
rs1301015494 659 dbSNP
rs1033404779 660 dbSNP
rs1450156811 661 dbSNP
rs1225870353 663 dbSNP
rs1395854430 665 dbSNP
rs1438851019 668 dbSNP
rs1264498631 672 dbSNP
rs896270965 677 dbSNP
rs573074879 684 dbSNP
rs1013271003 695 dbSNP
rs1020617068 699 dbSNP
rs1207493709 710 dbSNP
rs1242350323 717 dbSNP
rs966342365 727 dbSNP
rs1486604912 730 dbSNP
rs979382358 737 dbSNP
rs1375644508 738 dbSNP
rs768450827 741 dbSNP
rs1480746456 742 dbSNP
rs1178538261 749 dbSNP
rs953920299 751 dbSNP
rs985668985 761 dbSNP
rs1456791808 768 dbSNP
rs1264997491 776 dbSNP
rs1354349315 787 dbSNP
rs773392975 796 dbSNP
rs1253897259 800 dbSNP
rs145676394 801 dbSNP
rs766528947 802 dbSNP
rs919291199 805 dbSNP
rs1293364640 813 dbSNP
rs1368704762 819 dbSNP
rs1407101605 827 dbSNP
rs929263444 829 dbSNP
rs1462591370 830 dbSNP
rs1164948207 836 dbSNP
rs1399157555 838 dbSNP
rs1463705414 846 dbSNP
rs769708122 846 dbSNP
rs191053226 850 dbSNP
rs888000276 858 dbSNP
rs938265796 862 dbSNP
rs556220224 871 dbSNP
rs1227252111 874 dbSNP
rs1317595589 877 dbSNP
rs1196972079 881 dbSNP
rs866404486 882 dbSNP
rs1480841181 892 dbSNP
rs1318415492 894 dbSNP
rs1218900345 897 dbSNP
rs1254022688 902 dbSNP
rs1188096407 905 dbSNP
rs1422281454 905 dbSNP
rs1476135391 905 dbSNP
rs1264453182 917 dbSNP
rs528948156 920 dbSNP
rs569789094 920 dbSNP
rs1013322984 928 dbSNP
rs1042088235 929 dbSNP
rs1201240868 935 dbSNP
rs148820898 937 dbSNP
rs1472219921 941 dbSNP
rs562458504 949 dbSNP
rs1212815765 951 dbSNP
rs933167275 964 dbSNP
rs1000914577 965 dbSNP
rs1050111157 967 dbSNP
rs866887126 973 dbSNP
rs1209224490 974 dbSNP
rs910305985 975 dbSNP
rs532799544 977 dbSNP
rs1486649637 981 dbSNP
rs1211488471 984 dbSNP
rs954128244 984 dbSNP
rs1487024842 987 dbSNP
rs1006794013 988 dbSNP
rs1019495943 988 dbSNP
rs1419812455 988 dbSNP
rs369334345 988 dbSNP
rs551666728 988 dbSNP
rs1426965691 994 dbSNP
rs765815116 996 dbSNP
rs1314030791 999 dbSNP
rs941671330 1000 dbSNP
rs919301306 1002 dbSNP
rs1037766838 1004 dbSNP
rs1410962593 1006 dbSNP
rs55766604 1011 dbSNP
rs1218863798 1014 dbSNP
rs11545220 1016 dbSNP
rs1301050675 1021 dbSNP
rs551617970 1024 dbSNP
rs1279680114 1026 dbSNP
rs1374921251 1029 dbSNP
rs1226069148 1032 dbSNP
rs950763010 1036 dbSNP
rs1242155959 1041 dbSNP
rs1487990789 1046 dbSNP
rs897530334 1047 dbSNP
rs1359624351 1049 dbSNP
rs1455881918 1051 dbSNP
rs1174602914 1057 dbSNP
rs1380280164 1075 dbSNP
rs909198963 1076 dbSNP
rs1161462449 1077 dbSNP
rs938302912 1079 dbSNP
rs1435775265 1083 dbSNP
rs1324138823 1085 dbSNP
rs1055296182 1102 dbSNP
rs918093545 1103 dbSNP
rs1308226874 1111 dbSNP
rs1348500401 1111 dbSNP
rs1225388518 1113 dbSNP
rs1284798725 1122 dbSNP
rs949516235 1123 dbSNP
rs1482714290 1128 dbSNP
rs535620455 1129 dbSNP
rs902230634 1135 dbSNP
rs1194697672 1137 dbSNP
rs1232660345 1141 dbSNP
rs759774404 1144 dbSNP
rs1000605516 1149 dbSNP
rs548876873 1150 dbSNP
rs1409268890 1158 dbSNP
rs1404871095 1159 dbSNP
rs1162819981 1163 dbSNP
rs142488193 1165 dbSNP
rs1386102182 1166 dbSNP
rs532867924 1166 dbSNP
rs768051606 1167 dbSNP
rs1444027110 1168 dbSNP
rs1167168363 1169 dbSNP
rs889456690 1171 dbSNP
rs1335152669 1172 dbSNP
rs1411054449 1173 dbSNP
rs1331486658 1175 dbSNP
rs1270375030 1176 dbSNP
rs1436434605 1182 dbSNP
rs1207014552 1183 dbSNP
rs1233988191 1188 dbSNP
rs2937378 1189 dbSNP
rs767212095 1190 dbSNP
rs1185945763 1192 dbSNP
rs1019507564 1199 dbSNP
rs549182643 1202 dbSNP
rs1283082134 1212 dbSNP
rs1167563936 1221 dbSNP
rs1383144049 1228 dbSNP
rs1394556325 1234 dbSNP
rs1247684998 1236 dbSNP
rs1411477198 1239 dbSNP
rs1329277433 1251 dbSNP
rs567506557 1253 dbSNP
rs1412854580 1257 dbSNP
rs1295174545 1269 dbSNP
rs1341231198 1270 dbSNP
rs374986866 1271 dbSNP
rs1057413796 1275 dbSNP
rs1214896190 1287 dbSNP
rs1275047759 1294 dbSNP
rs1440564991 1299 dbSNP
rs1274110453 1301 dbSNP
rs796109572 1301 dbSNP
rs796850928 1302 dbSNP
rs1209333997 1303 dbSNP
rs1260154377 1304 dbSNP
rs1462863191 1307 dbSNP
rs3193856 1310 dbSNP
rs1186876314 1311 dbSNP
rs1371608911 1311 dbSNP
rs912413106 1332 dbSNP
rs950888167 1340 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gauuccgauuacGACAUGAAACa 5'
                      || ||||||| 
Target 5' -----cuuucccCU-UACUUUGc 3'
 		1 - 17
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_005119 | 3UTR | UGAAGCAUUCUCAGAUGUUUGGGGGGAAACAUCCUCUUAAAAUGGGUCCUUGUGCUUGCCUUCUGGGGAGGCGGUCCUGAGCAGGUGAAUCAUAAGGCAUUUAUGCAUAUGUUAUAUGCGGACUGCACCCACCUCUCCCCCCCAGCCUUUGCCUCUUGCGUUGUUGUGCUGCUUUCCCCUUACUUUGCUACAUUUCUAUAGUUAAGUUGGUUUUACUUGAAUGAUUCAUGUUUAGGGGGAAAAUGAAAAUCUCCCUUAAAAUUUGUUUCAACUCCUCCUGCAAAUAAAAUAAAUGAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_005119 | 3UTR | UAUAUGCGGACUGCACCCACCUCUCCCCCCCAGCCUUUGCCUCUUGCGUUGUUGUGCUGCUUUCCCCUUACUUUGCUACAUUUCUAUAGUUAAGUUGGUUUUACUUGAAUGAUUCAUGUUUAGGGGGAAAAUGAAAAUCUCCCUUAAAAUUUGUUUCAACUCCUCCUGCAAAUAAAAUAAAUGAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_005119 | 3UTR | GUUUGGGGGGAAACAUCCUCUUAAAAUGGGUCCUUGUGCUUGCCUUCUGGGGAGGCGGUCCUGAGCAGGUGAAUCAUAAGGCAUUUAUGCAUAUGUUAUAUGCGGACUGCACCCACCUCUCCCCCCCAGCCUUUGCCUCUUGCGUUGUUGUGCUGCUUUCCCCUUACUUUGCUACAUUUCUAUAGUUAAGUUGGUUUUACUUGAAUGAUUCAUGUUUAGGGGGAAAAUGAAAAUCUCCCUUAAAAUUUGUUUCAACUCCUCCUGCAAAUAAAAUAAAUGAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_005119 | 3UTR | GGACUGCACCCACCUCUCCCCCCCAGCCUUUGCCUCUUGCGUUGUUGUGCUGCUUUCCCCUUACUUUGCUACAUUUCUAUAGUUAAGUUGGUUUUACUUGAAUGAUUCAUGUUUAGGGGGAAAAUGAAAAUCUCCCUUAAAAUUUGUUUCAACUCCUCCUGCAAAUAAAAUAAAUGAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_005119 | 3UTR | CGGACUGCACCCACCUCUCCCCCCCAGCCUUUGCCUCUUGCGUUGUUGUGCUGCUUUCCCCUUACUUUGCUACAUUUCUAUAGUUAAGUUGGUUUUACUUGAAUGAUUCAUGUUUAGGGGGAAAAUGAAAAUCUCCCUUAAAAUUUGUUUCAACUCCUCCUGCAAAUAAAAUAAAUGAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_005119 | 3UTR | AUAAACUUUGAAGUGUUCACCUCAGUUUGGGACCAAACUGCUUGGAUCUUUGUAAAAACCGGUUUUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_005119 | 3UTR | CGGACUGCACCCACCUCUCCCCCCCAGCCUUUGCCUCUUGCGUUGUUGUGCUGCUUUCCCCUUACUUUGCUACAUUUCUAUAGUUAAGUUGGUUUUACUUGAAUGAUUCAUGUUUAGGGGGAAAAUGAAAAUCUCCCUUAAAAUUUGUUUCAACUCCUCCUGCAAAUAAAAUAAAUGAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000354618.5 | 3UTR | CUUUCCCCUUACUUUGCUACAUUUCUAUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
136 hsa-miR-3973 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT060560 CCND1 cyclin D1 2 2
MIRT060977 LAMC1 laminin subunit gamma 1 2 2
MIRT067617 TMPO thymopoietin 2 2
MIRT072503 RAB8B RAB8B, member RAS oncogene family 2 2
MIRT092048 ABHD5 abhydrolase domain containing 5 2 6
MIRT093449 MSMO1 methylsterol monooxygenase 1 2 2
MIRT093538 GALNT7 polypeptide N-acetylgalactosaminyltransferase 7 2 6
MIRT095404 UBE2D2 ubiquitin conjugating enzyme E2 D2 2 2
MIRT103367 CBX3 chromobox 3 2 2
MIRT110447 PLEKHA1 pleckstrin homology domain containing A1 2 10
MIRT161196 ZBTB38 zinc finger and BTB domain containing 38 2 2
MIRT161903 FXR1 FMR1 autosomal homolog 1 2 2
MIRT192775 B2M beta-2-microglobulin 2 2
MIRT195782 ATMIN ATM interactor 2 6
MIRT228194 BNC2 basonuclin 2 2 2
MIRT237882 WHSC1 nuclear receptor binding SET domain protein 2 2 4
MIRT249021 PABPC3 poly(A) binding protein cytoplasmic 3 2 8
MIRT273958 SPRYD4 SPRY domain containing 4 2 2
MIRT309023 USP53 ubiquitin specific peptidase 53 2 2
MIRT312596 G3BP1 G3BP stress granule assembly factor 1 2 4
MIRT315536 MARCKS myristoylated alanine rich protein kinase C substrate 2 2
MIRT319305 CAV1 caveolin 1 2 2
MIRT324436 TBC1D13 TBC1 domain family member 13 2 2
MIRT325710 CSTF2 cleavage stimulation factor subunit 2 2 2
MIRT340681 THRAP3 thyroid hormone receptor associated protein 3 2 2
MIRT404628 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT443473 ACPP acid phosphatase, prostate 2 2
MIRT443545 ZNRF2 zinc and ring finger 2 2 2
MIRT446290 RIMKLB ribosomal modification protein rimK like family member B 2 2
MIRT447066 MCC mutated in colorectal cancers 2 2
MIRT447365 RASA2 RAS p21 protein activator 2 2 2
MIRT450079 ZNF354C zinc finger protein 354C 2 2
MIRT454270 PSMA1 proteasome subunit alpha 1 2 2
MIRT456032 CRYZ crystallin zeta 2 8
MIRT462069 CCDC77 coiled-coil domain containing 77 2 4
MIRT466379 TGOLN2 trans-golgi network protein 2 2 4
MIRT470352 PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon 2 2
MIRT471866 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 4
MIRT474453 KLHL11 kelch like family member 11 2 8
MIRT476188 GOLGA8A golgin A8 family member A 2 10
MIRT476645 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 2 2
MIRT481544 ARL10 ADP ribosylation factor like GTPase 10 2 10
MIRT481791 APEX1 apurinic/apyrimidinic endodeoxyribonuclease 1 2 2
MIRT482527 ACTB actin beta 2 4
MIRT485570 FOXQ1 forkhead box Q1 2 2
MIRT486011 LPAR2 lysophosphatidic acid receptor 2 2 2
MIRT495182 MUC20 mucin 20, cell surface associated 2 2
MIRT496047 MORC1 MORC family CW-type zinc finger 1 2 2
MIRT497114 JRKL JRK like 2 2
MIRT497494 RGS17 regulator of G protein signaling 17 2 2
MIRT497752 OXGR1 oxoglutarate receptor 1 2 2
MIRT500217 INHBA inhibin beta A subunit 2 10
MIRT501079 SMAD7 SMAD family member 7 2 8
MIRT501453 PTPN4 protein tyrosine phosphatase, non-receptor type 4 2 8
MIRT502793 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 2 6
MIRT502879 CDK4 cyclin dependent kinase 4 2 8
MIRT505796 RSBN1 round spermatid basic protein 1 2 8
MIRT506345 NUP54 nucleoporin 54 2 6
MIRT507415 ELK4 ELK4, ETS transcription factor 2 4
MIRT509272 NPM3 nucleophosmin/nucleoplasmin 3 2 6
MIRT514931 TRIM73 tripartite motif containing 73 2 2
MIRT515441 TRIM74 tripartite motif containing 74 2 2
MIRT516026 A1CF APOBEC1 complementation factor 2 2
MIRT517375 CHST6 carbohydrate sulfotransferase 6 2 2
MIRT527925 FRY FRY microtubule binding protein 2 2
MIRT529611 H1F0 H1 histone family member 0 2 2
MIRT530606 C7orf33 chromosome 7 open reading frame 33 2 4
MIRT530970 EXO5 exonuclease 5 2 4
MIRT532108 RRP8 ribosomal RNA processing 8 2 2
MIRT533006 ZFHX3 zinc finger homeobox 3 2 4
MIRT533103 YOD1 YOD1 deubiquitinase 2 2
MIRT533231 VLDLR very low density lipoprotein receptor 2 2
MIRT534073 SRPK1 SRSF protein kinase 1 2 2
MIRT534457 SCML2 Scm polycomb group protein like 2 2 4
MIRT536678 IKZF5 IKAROS family zinc finger 5 2 2
MIRT538224 CYR61 cysteine rich angiogenic inducer 61 2 2
MIRT539218 ANP32E acidic nuclear phosphoprotein 32 family member E 2 4
MIRT541157 PABPC1 poly(A) binding protein cytoplasmic 1 2 4
MIRT552682 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT554457 SAMD8 sterile alpha motif domain containing 8 2 2
MIRT556688 KLHL28 kelch like family member 28 2 2
MIRT558162 ELAVL2 ELAV like RNA binding protein 2 2 2
MIRT558195 EIF2S1 eukaryotic translation initiation factor 2 subunit alpha 2 4
MIRT558752 CHERP calcium homeostasis endoplasmic reticulum protein 2 2
MIRT561871 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT567443 GNG12 G protein subunit gamma 12 2 2
MIRT568399 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT569178 DMD dystrophin 2 2
MIRT571465 CCDC80 coiled-coil domain containing 80 2 2
MIRT575987 Fem1a feminization 1 homolog a (C. elegans) 2 5
MIRT606844 FEM1A fem-1 homolog A 2 7
MIRT615813 COQ7 coenzyme Q7, hydroxylase 2 2
MIRT619491 QSOX2 quiescin sulfhydryl oxidase 2 2 2
MIRT624354 CHRM3 cholinergic receptor muscarinic 3 2 2
MIRT625979 PIK3C2B phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta 2 2
MIRT628564 MELK maternal embryonic leucine zipper kinase 2 2
MIRT631329 CARHSP1 calcium regulated heat stable protein 1 2 2
MIRT639435 PKP1 plakophilin 1 2 2
MIRT640366 C1orf210 chromosome 1 open reading frame 210 2 2
MIRT640701 SKI SKI proto-oncogene 2 2
MIRT640718 CEP68 centrosomal protein 68 2 2
MIRT641217 TRIB1 tribbles pseudokinase 1 2 4
MIRT642271 SMIM17 small integral membrane protein 17 2 2
MIRT644011 PPP1R3G protein phosphatase 1 regulatory subunit 3G 2 2
MIRT645146 CUBN cubilin 2 2
MIRT653158 SPTY2D1 SPT2 chromatin protein domain containing 1 2 2
MIRT654475 RANBP2 RAN binding protein 2 2 2
MIRT656177 MRPL44 mitochondrial ribosomal protein L44 2 2
MIRT658719 ELMOD2 ELMO domain containing 2 2 2
MIRT658857 DTX3L deltex E3 ubiquitin ligase 3L 2 2
MIRT663935 ZNF554 zinc finger protein 554 2 2
MIRT664901 EMC7 ER membrane protein complex subunit 7 2 2
MIRT668801 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT673514 TNFAIP8L1 TNF alpha induced protein 8 like 1 2 4
MIRT683192 TAF1D TATA-box binding protein associated factor, RNA polymerase I subunit D 2 2
MIRT684049 FOLR1 folate receptor 1 2 2
MIRT685543 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 2
MIRT690365 RPL37A ribosomal protein L37a 2 2
MIRT691612 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT691651 SLC43A3 solute carrier family 43 member 3 2 2
MIRT694108 ZNF446 zinc finger protein 446 2 2
MIRT695618 VBP1 VHL binding protein 1 2 2
MIRT695925 ZNF174 zinc finger protein 174 2 2
MIRT696445 SUGP1 SURP and G-patch domain containing 1 2 2
MIRT697983 TSPAN6 tetraspanin 6 2 2
MIRT699769 SEMA4D semaphorin 4D 2 2
MIRT702946 HIPK3 homeodomain interacting protein kinase 3 2 2
MIRT703385 GABPB1 GA binding protein transcription factor beta subunit 1 2 2
MIRT704011 EFCAB14 EF-hand calcium binding domain 14 2 2
MIRT704182 DNAJB4 DnaJ heat shock protein family (Hsp40) member B4 2 2
MIRT704446 CTNNB1 catenin beta 1 2 2
MIRT708514 CHCHD3 coiled-coil-helix-coiled-coil-helix domain containing 3 2 2
MIRT713068 ENTHD1 ENTH domain containing 1 2 2
MIRT715799 TBL3 transducin beta like 3 2 2
MIRT716441 RPS24 ribosomal protein S24 2 2
MIRT719421 B4GALNT3 beta-1,4-N-acetyl-galactosaminyltransferase 3 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-3973 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-3973 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-3973 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)

Error report submission