>MTRNR2L1|NM_001190452|3'UTR
   1 TACAACAAGACGAGAAGACCCTAAGGAGCTTTAATTTATGAATGCAAACAAGACCAAATAGGCCCGCAGGCCCTAAACTA
  81 CCAGACCTGCGTTAAACATTTCGGTTGGGGCGACCTCGGAGTATAACCTAACCTCCGAGCAACATATGCTGAGACTATAC
 161 CAGTCAAGGCGAATATCCACATACAATTGACCCAATAATTTGACCAACGGAACAAGTTACCCTAGTGATAACAGTACAAT
 241 CCTATTCTAGGGTCCACATCGACAGTAGCATTAACGACCTCGATGTTGGATCAGGACATCCCAATGGTGCAGCCGCTATT
 321 AAAGGTTCGTTTGTTCAACGATTAGAGTCCTATGTGATCTGAGTTCAGACCGGAGTAATCCAGGTTGGTTTCTATCTATT
 401 CTACATTTCTTCCAGTACGAAAGGATAAGAGAAATGGGGCCCACTTCATAAAGTGCCCCTGCCCCATAGATGATATTATC
 481 TCAGCATTTTACTGTACCCACACCCACCCAAGAACAGGGTTTGTTAAGA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ucuccgucCAAGGACCUAGUa 5' | | :||||||| Target 5' acgacctcGATGTTGGATCAg 3'	274 - 294	145.00	-10.80
2	miRNA 3' ucuccgUCCAAG-GACCUAGUa 5' |||||| :| | ||| Target 5' tattaaAGGTTCGTTTGTTCAa 3'	317 - 338	99.00	-7.80
3	miRNA 3' ucuccGUCCAAGG--AC-CUAGua 5' :|| ||| || |||| Target 5' acgatTAGAGTCCTATGTGATCtg 3'	338 - 361	98.00	-7.20

Mutant ID	Mutant Position	Mutant Source
COSN26473675	22	COSMIC
COSN26646185	22	COSMIC
COSN26560144	25	COSMIC
COSN26647214	33	COSMIC
COSN26465094	41	COSMIC
COSN31562824	41	COSMIC
COSN30163056	56	COSMIC
COSN17038177	252	COSMIC
COSN6100778	301	COSMIC
COSN1715550	316	COSMIC
COSN29815114	360	COSMIC
COSN7162325	373	COSMIC
COSN9657148	448	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs538926233	2	dbSNP
rs77383618	2	dbSNP
rs77503166	6	dbSNP
rs1291552436	7	dbSNP
rs1264921696	8	dbSNP
rs566068826	12	dbSNP
rs1461039776	13	dbSNP
rs893132541	20	dbSNP
rs1184510443	23	dbSNP
rs866571427	24	dbSNP
rs75326150	25	dbSNP
rs770071031	27	dbSNP
rs1181679682	29	dbSNP
rs1250484426	30	dbSNP
rs775954090	34	dbSNP
rs1455623411	37	dbSNP
rs775663638	39	dbSNP
rs763326287	40	dbSNP
rs78850120	41	dbSNP
rs995213191	44	dbSNP
rs1404820251	50	dbSNP
rs1469994096	51	dbSNP
rs368915468	52	dbSNP
rs371463546	53	dbSNP
rs374751737	57	dbSNP
rs369109548	60	dbSNP
rs373391928	62	dbSNP
rs376680415	63	dbSNP
rs1386166074	66	dbSNP
rs552234490	66	dbSNP
rs73982945	67	dbSNP
rs369868628	72	dbSNP
rs373383042	85	dbSNP
rs764140064	87	dbSNP
rs1168001815	88	dbSNP
rs538071799	89	dbSNP
rs1036252559	90	dbSNP
rs1225124631	91	dbSNP
rs377757852	92	dbSNP
rs1013578102	95	dbSNP
rs370276110	98	dbSNP
rs1193341607	102	dbSNP
rs574344912	103	dbSNP
rs1340144907	104	dbSNP
rs1023297317	106	dbSNP
rs1253755661	106	dbSNP
rs1232360229	112	dbSNP
rs1331678778	113	dbSNP
rs1303121144	118	dbSNP
rs968334534	119	dbSNP
rs962358058	120	dbSNP
rs374673395	123	dbSNP
rs978131157	124	dbSNP
rs377409306	125	dbSNP
rs62051411	130	dbSNP
rs1170957580	132	dbSNP
rs1465965504	133	dbSNP
rs960675428	134	dbSNP
rs767288212	137	dbSNP
rs750161680	138	dbSNP
rs200333123	142	dbSNP
rs370428096	143	dbSNP
rs374883733	144	dbSNP
rs1262863142	145	dbSNP
rs368330834	146	dbSNP
rs17052206	148	dbSNP
rs372587318	152	dbSNP
rs374530198	158	dbSNP
rs368484307	159	dbSNP
rs1374363683	161	dbSNP
rs1182384116	162	dbSNP
rs1483835182	164	dbSNP
rs1253458647	166	dbSNP
rs192535283	169	dbSNP
rs942664975	171	dbSNP
rs572005469	172	dbSNP
rs1392910231	174	dbSNP
rs367722383	174	dbSNP
rs879076026	175	dbSNP
rs878870465	176	dbSNP
rs574604173	177	dbSNP
rs372259644	179	dbSNP
rs372579057	181	dbSNP
rs879125207	183	dbSNP
rs376786741	184	dbSNP
rs879181826	184	dbSNP
rs919813458	185	dbSNP
rs765911817	187	dbSNP
rs947384274	188	dbSNP
rs77658632	192	dbSNP
rs545510352	193	dbSNP
rs1332244292	196	dbSNP
rs74402377	200	dbSNP
rs886430917	205	dbSNP
rs564195222	209	dbSNP
rs576075646	210	dbSNP
rs903293282	219	dbSNP
rs117817427	222	dbSNP
rs1411604693	223	dbSNP
rs78367882	227	dbSNP
rs1160460743	233	dbSNP
rs75864714	236	dbSNP
rs75297232	237	dbSNP
rs1366405838	240	dbSNP
rs938754163	245	dbSNP
rs374674148	252	dbSNP
rs1040435683	253	dbSNP
rs1057335667	255	dbSNP
rs369216773	258	dbSNP
rs1206664749	260	dbSNP
rs894633550	261	dbSNP
rs371633716	262	dbSNP
rs1232632504	266	dbSNP
rs376245121	266	dbSNP
rs900599026	267	dbSNP
rs754426369	269	dbSNP
rs369557968	270	dbSNP
rs373753268	271	dbSNP
rs79701508	274	dbSNP
rs377187188	276	dbSNP
rs149048964	277	dbSNP
rs1388627544	280	dbSNP
rs1321621830	282	dbSNP
rs562272618	283	dbSNP
rs1389049022	284	dbSNP
rs1351957709	286	dbSNP
rs999762812	287	dbSNP
rs529549894	290	dbSNP
rs1186189698	298	dbSNP
rs1451496053	300	dbSNP
rs199518813	304	dbSNP
rs1025712902	305	dbSNP
rs533519016	315	dbSNP
rs559820472	316	dbSNP
rs1023350681	324	dbSNP
rs533342805	326	dbSNP
rs964223112	329	dbSNP
rs975216679	330	dbSNP
rs914511542	340	dbSNP
rs551498967	341	dbSNP
rs977448716	342	dbSNP
rs77279242	346	dbSNP
rs553737288	347	dbSNP
rs1329643140	352	dbSNP
rs1323385769	353	dbSNP
rs79732332	354	dbSNP
rs370054442	359	dbSNP
rs982712992	363	dbSNP
rs1385623193	367	dbSNP
rs938821750	372	dbSNP
rs912511348	373	dbSNP
rs1477003053	374	dbSNP
rs944687694	378	dbSNP
rs781690282	382	dbSNP
rs1490569591	384	dbSNP
rs374323120	386	dbSNP
rs79064643	387	dbSNP
rs182052360	394	dbSNP
rs1442002536	395	dbSNP
rs1308786586	399	dbSNP
rs74691216	399	dbSNP
rs112781979	400	dbSNP
rs113354100	401	dbSNP
rs761881042	402	dbSNP
rs537149549	403	dbSNP
rs878962375	405	dbSNP
rs879224525	409	dbSNP
rs879205249	412	dbSNP
rs1241634672	413	dbSNP
rs879016602	415	dbSNP
rs931495694	419	dbSNP
rs948901286	419	dbSNP
rs765540330	420	dbSNP
rs899445631	426	dbSNP
rs879062505	427	dbSNP
rs549524085	437	dbSNP
rs567906714	438	dbSNP
rs146657134	439	dbSNP
rs140223171	440	dbSNP
rs377648300	443	dbSNP
rs369777429	450	dbSNP
rs1270799192	453	dbSNP
rs374559928	455	dbSNP
rs879063075	456	dbSNP
rs1469404692	457	dbSNP
rs1408856288	458	dbSNP
rs1370563975	459	dbSNP
rs878907553	460	dbSNP
rs879112833	462	dbSNP
rs1193646687	465	dbSNP
rs377366607	467	dbSNP
rs896733418	468	dbSNP
rs370531624	470	dbSNP
rs1183754571	472	dbSNP
rs1364142364	475	dbSNP
rs1019789813	476	dbSNP
rs1249364265	477	dbSNP
rs372850651	478	dbSNP
rs377252121	485	dbSNP
rs1457385474	486	dbSNP
rs370516807	487	dbSNP
rs374166848	489	dbSNP
rs368384237	490	dbSNP
rs74598091	493	dbSNP
rs112530481	494	dbSNP
rs76396777	495	dbSNP
rs1013229318	502	dbSNP
rs770162818	505	dbSNP
rs975268046	518	dbSNP
rs546469303	519	dbSNP
rs969067439	524	dbSNP
rs1286854808	526	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.

- Neoplasia (New York, N.Y.), 2016

MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.

- Nucleic acids research, 2016

MicroRNAs (miRs) have emerged as key biological effectors in human health and disease. These small noncoding RNAs are incorporated into Argonaute (Ago) proteins, where they direct post-transcriptional gene silencing via base-pairing with target transcripts. Although miRs have become intriguing biological entities and attractive therapeutic targets, the translational impacts of miR research remain limited by a paucity of empirical miR targeting data, particularly in human primary tissues. Here, to improve our understanding of the diverse roles miRs play in cardiovascular function and disease, we applied high-throughput methods to globally profile miR:target interactions in human heart tissues. We deciphered Ago2:RNA interactions using crosslinking immunoprecipitation coupled with high-throughput sequencing (HITS-CLIP) to generate the first transcriptome-wide map of miR targeting events in human myocardium, detecting 4000 cardiac Ago2 binding sites across >2200 target transcripts. Our initial exploration of this interactome revealed an abundance of miR target sites in gene coding regions, including several sites pointing to new miR-29 functions in regulating cardiomyocyte calcium, growth and metabolism. Also, we uncovered several clinically-relevant interactions involving common genetic variants that alter miR targeting events in cardiomyopathy-associated genes. Overall, these data provide a critical resource for bolstering translational miR research in heart, and likely beyond.