pre-miRNA Information
pre-miRNA hsa-mir-548ac   
Genomic Coordinates chr1: 116560024 - 116560111
Description Homo sapiens miR-548ac stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-548ac
Sequence 53| CAAAAACCGGCAAUUACUUUUG |74
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 1 - 116560056 29233923 MiREDiBase
A-to-I 5 1 - 116560055 29233923 MiREDiBase
A-to-I 6 1 - 116560054 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1182074110 6 dbSNP
rs1392446444 6 dbSNP
rs1326234665 7 dbSNP
rs556579863 8 dbSNP
rs993390910 9 dbSNP
rs901450363 13 dbSNP
rs538553306 22 dbSNP
Putative Targets

Gene Information
Gene Symbol ALYREF   
Synonyms ALY, ALY/REF, BEF, REF, THOC4
Description Aly/REF export factor
Transcript NM_005782   
Expression
Putative miRNA Targets on ALYREF
3'UTR of ALYREF
(miRNA target sites are highlighted)
>ALYREF|NM_005782|3'UTR
   1 ACAGACCAGCAAATCCGCGTGCGGAACAGGACCCAGGCGTCTCCTCTTGCTCCCTGGTTGGGGGGCGGTGGCTGGGGCTG
  81 TGCGGCCAATGATGGATTTGTTTCTTTTATGTTTTAAAATAGGATTTAAAAACTCATGTAAAGGTTTTTTTTTTTTCTTT
 161 TTTTTTTTTTTTAATTCTGAAACAGACCTGTTTTGTACCGAGTTATTTTTGGGATAAATTTTACTGGTTGCTGTTGTGGA
 241 GAAGGTGGCGTTTCCACCTTTTCCATAATAAAATAGAAATGTGTGTAGAACTGGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' guUUUCAUUA-ACGGCCAAAAAc 5'
            ||| | || |   ||||||| 
Target 5' aaAAACTCATGTAAAGGTTTTTt 3'
128 - 150 152.00 -5.70
2
miRNA  3' guUUUCAUUAACGGCCAAaaac 5'
            ||| |  || |:||||    
Target 5' atAAATT--TTACTGGTTgctg 3'
214 - 233 100.00 -9.10
3
miRNA  3' guuuucAUUAACGGCCAAaaac 5'
                |: |  |:||||    
Target 5' tcctctTGCTCCCTGGTTgggg 3'
42 - 63 88.00 -6.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31535757 15 COSMIC
COSN30469271 16 COSMIC
COSN26965876 17 COSMIC
COSN30100246 18 COSMIC
COSN5268339 39 COSMIC
COSN30144975 49 COSMIC
COSN30544105 52 COSMIC
COSN30455772 54 COSMIC
COSN30143667 60 COSMIC
COSN5421227 64 COSMIC
COSN31613622 67 COSMIC
COSN30514273 83 COSMIC
COSN31583499 113 COSMIC
COSN19639130 138 COSMIC
COSN31523355 154 COSMIC
COSN30497151 155 COSMIC
COSN24729313 156 COSMIC
COSN17035292 157 COSMIC
COSN28641218 158 COSMIC
COSN31923298 158 COSMIC
COSN26074980 166 COSMIC
COSN31529693 200 COSMIC
COSN26643844 213 COSMIC
COSN31483163 241 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs747578388 2 dbSNP
rs779790027 2 dbSNP
rs550241378 4 dbSNP
rs749899365 6 dbSNP
rs761527548 6 dbSNP
rs764543521 10 dbSNP
rs780801463 10 dbSNP
rs763559518 16 dbSNP
rs765655164 17 dbSNP
rs759827154 18 dbSNP
rs374614336 19 dbSNP
rs754571266 21 dbSNP
rs932599838 21 dbSNP
rs760699373 22 dbSNP
rs773380671 23 dbSNP
rs1355707547 24 dbSNP
rs371360910 28 dbSNP
rs1361589661 29 dbSNP
rs1292847460 33 dbSNP
rs772021827 34 dbSNP
rs145890926 39 dbSNP
rs778991439 42 dbSNP
rs377486921 43 dbSNP
rs1210700313 44 dbSNP
rs1258576577 45 dbSNP
rs1006687270 46 dbSNP
rs1373069281 47 dbSNP
rs749034093 48 dbSNP
rs1384422837 50 dbSNP
rs1484367107 52 dbSNP
rs193202460 53 dbSNP
rs776034522 56 dbSNP
rs374420797 57 dbSNP
rs188689322 60 dbSNP
rs1264759711 61 dbSNP
rs1242600749 63 dbSNP
rs1429248588 64 dbSNP
rs538320932 65 dbSNP
rs1392023381 66 dbSNP
rs149852847 66 dbSNP
rs368637516 66 dbSNP
rs980374743 67 dbSNP
rs1359479928 74 dbSNP
rs1293920152 80 dbSNP
rs907458252 83 dbSNP
rs373834333 84 dbSNP
rs369093482 87 dbSNP
rs1011728766 90 dbSNP
rs946223257 91 dbSNP
rs1281521162 94 dbSNP
rs1392307857 101 dbSNP
rs1390550344 104 dbSNP
rs549542402 107 dbSNP
rs1054224558 110 dbSNP
rs1463422395 111 dbSNP
rs1251161281 114 dbSNP
rs574723667 118 dbSNP
rs935725961 123 dbSNP
rs1425743439 125 dbSNP
rs1471993811 129 dbSNP
rs1156649412 130 dbSNP
rs1344304909 131 dbSNP
rs1457381299 132 dbSNP
rs1321988346 133 dbSNP
rs1368086073 137 dbSNP
rs913648382 138 dbSNP
rs1276012356 139 dbSNP
rs910914455 144 dbSNP
rs1361686041 146 dbSNP
rs1283923206 149 dbSNP
rs1317760702 150 dbSNP
rs1050222640 151 dbSNP
rs1271385788 152 dbSNP
rs1468120550 153 dbSNP
rs1419445900 154 dbSNP
rs1247276078 157 dbSNP
rs1478964173 157 dbSNP
rs879002268 157 dbSNP
rs374325618 158 dbSNP
rs1472726947 159 dbSNP
rs898440451 161 dbSNP
rs1391805188 162 dbSNP
rs1469710434 163 dbSNP
rs1038267687 164 dbSNP
rs939825482 166 dbSNP
rs1208131302 168 dbSNP
rs1327222535 169 dbSNP
rs1279364556 170 dbSNP
rs908388180 170 dbSNP
rs1230584787 172 dbSNP
rs1291713534 172 dbSNP
rs1202294359 173 dbSNP
rs1210578317 173 dbSNP
rs1232121602 173 dbSNP
rs1292031819 173 dbSNP
rs1334422712 173 dbSNP
rs545535430 173 dbSNP
rs1056216028 174 dbSNP
rs1240103416 175 dbSNP
rs958129113 177 dbSNP
rs556404891 178 dbSNP
rs1474639063 179 dbSNP
rs1163350941 184 dbSNP
rs939134449 188 dbSNP
rs185825836 189 dbSNP
rs1320533955 192 dbSNP
rs1328829130 195 dbSNP
rs1371684392 198 dbSNP
rs1311434701 199 dbSNP
rs1245720040 200 dbSNP
rs1355063695 200 dbSNP
rs1286049886 205 dbSNP
rs1337484321 206 dbSNP
rs980870657 224 dbSNP
rs985518603 225 dbSNP
rs1207044442 228 dbSNP
rs1456222766 239 dbSNP
rs1382224182 242 dbSNP
rs955312843 249 dbSNP
rs922515037 251 dbSNP
rs1453941082 253 dbSNP
rs1441511451 256 dbSNP
rs1187768562 258 dbSNP
rs1238816820 264 dbSNP
rs972610995 265 dbSNP
rs1166790488 268 dbSNP
rs1391393101 274 dbSNP
rs914799736 282 dbSNP
rs990407219 283 dbSNP
rs1455439242 290 dbSNP
rs1396858521 291 dbSNP
rs1336445393 292 dbSNP
rs34992198 295 dbSNP
rs759633919 297 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084079. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' guUUUCAUUA-ACGGCCAAAAAc 5'
            ||| | || |   ||||||| 
Target 5' aaAAACUCAUGUAAAGGUUUUUu 3'
10 - 32
Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084079
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_AbnovaAb
Location of target site ENST00000331204.4 | 3UTR | AUAGGAUUUAAAAACUCAUGUAAAGGUUUUUUUUUUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
275 hsa-miR-548ac Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055863 BUB3 BUB3, mitotic checkpoint protein 2 2
MIRT074959 LEPROT leptin receptor overlapping transcript 2 2
MIRT076823 SUZ12 SUZ12 polycomb repressive complex 2 subunit 2 4
MIRT078708 LLGL2 LLGL2, scribble cell polarity complex component 2 2
MIRT099610 ID4 inhibitor of DNA binding 4, HLH protein 2 4
MIRT103362 CBX3 chromobox 3 2 2
MIRT111801 MPZL1 myelin protein zero like 1 2 2
MIRT114050 AKAP11 A-kinase anchoring protein 11 2 12
MIRT133719 SKI SKI proto-oncogene 2 2
MIRT136817 NHLRC3 NHL repeat containing 3 2 6
MIRT149926 LDLR low density lipoprotein receptor 2 2
MIRT166915 TNPO1 transportin 1 2 2
MIRT168142 SOX4 SRY-box 4 2 10
MIRT190787 STRN3 striatin 3 2 4
MIRT207471 RMND5A required for meiotic nuclear division 5 homolog A 2 2
MIRT250951 CDK5R1 cyclin dependent kinase 5 regulatory subunit 1 2 4
MIRT271993 ARF1 ADP ribosylation factor 1 2 4
MIRT282618 IGF1R insulin like growth factor 1 receptor 2 8
MIRT294153 ZNF845 zinc finger protein 845 2 2
MIRT309060 C4ORF3 chromosome 4 open reading frame 3 2 2
MIRT318548 SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein 2 2
MIRT319752 LUC7L2 LUC7 like 2, pre-mRNA splicing factor 2 2
MIRT331324 TM9SF3 transmembrane 9 superfamily member 3 2 2
MIRT337204 TOMM20 translocase of outer mitochondrial membrane 20 2 6
MIRT346145 ALYREF Aly/REF export factor 2 2
MIRT347727 LSM14A LSM14A, mRNA processing body assembly factor 2 2
MIRT350503 MRGBP MRG domain binding protein 2 6
MIRT356409 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 2
MIRT357986 GRPEL2 GrpE like 2, mitochondrial 2 2
MIRT374399 M6PR mannose-6-phosphate receptor, cation dependent 2 6
MIRT442727 TMEM158 transmembrane protein 158 (gene/pseudogene) 2 2
MIRT443411 HMX3 H6 family homeobox 3 2 2
MIRT444408 FRMD5 FERM domain containing 5 2 2
MIRT444469 PTPRG protein tyrosine phosphatase, receptor type G 2 2
MIRT444650 HSBP1 heat shock factor binding protein 1 2 2
MIRT444861 EXD2 exonuclease 3'-5' domain containing 2 2 2
MIRT445685 TNFSF15 TNF superfamily member 15 2 2
MIRT446001 CD1D CD1d molecule 2 2
MIRT446074 RABIF RAB interacting factor 2 2
MIRT446308 ACSL3 acyl-CoA synthetase long chain family member 3 2 2
MIRT446432 ABHD2 abhydrolase domain containing 2 2 2
MIRT447269 C3orf30 chromosome 3 open reading frame 30 2 2
MIRT447759 TMCC3 transmembrane and coiled-coil domain family 3 2 2
MIRT448161 P2RY10 purinergic receptor P2Y10 2 2
MIRT449049 ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif 5 2 2
MIRT449275 PALM2 paralemmin 2 2 2
MIRT450122 IMP3 IMP3, U3 small nucleolar ribonucleoprotein 2 2
MIRT450155 GABRB3 gamma-aminobutyric acid type A receptor beta3 subunit 2 2
MIRT451289 ZNF101 zinc finger protein 101 2 2
MIRT459253 ADRBK1 G protein-coupled receptor kinase 2 2 2
MIRT462554 NUDT19 nudix hydrolase 19 2 2
MIRT464470 UGCG UDP-glucose ceramide glucosyltransferase 2 2
MIRT465120 TSC22D2 TSC22 domain family member 2 2 4
MIRT467996 SKIL SKI like proto-oncogene 2 2
MIRT468718 SDC4 syndecan 4 2 2
MIRT469269 RHOB ras homolog family member B 2 2
MIRT470675 POLR2D RNA polymerase II subunit D 2 4
MIRT470723 POGK pogo transposable element derived with KRAB domain 2 2
MIRT471438 PDIA6 protein disulfide isomerase family A member 6 2 2
MIRT471502 PDE4D phosphodiesterase 4D 2 4
MIRT471988 NR2F2 nuclear receptor subfamily 2 group F member 2 2 4
MIRT472386 NEK7 NIMA related kinase 7 2 2
MIRT475028 KANSL1 KAT8 regulatory NSL complex subunit 1 2 8
MIRT479411 CDKN1B cyclin dependent kinase inhibitor 1B 2 10
MIRT480514 C11orf57 chromosome 11 open reading frame 57 2 2
MIRT481700 AR androgen receptor 2 2
MIRT482543 ACTB actin beta 2 4
MIRT482627 ABCE1 ATP binding cassette subfamily E member 1 2 2
MIRT484725 INHBA inhibin beta A subunit 2 12
MIRT487778 ANKEF1 ankyrin repeat and EF-hand domain containing 1 2 16
MIRT491883 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT494653 ARNTL aryl hydrocarbon receptor nuclear translocator like 2 2
MIRT497366 SF1 splicing factor 1 2 2
MIRT499156 HSPA1B heat shock protein family A (Hsp70) member 1B 2 8
MIRT502830 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 2 6
MIRT502944 CDC37L1 cell division cycle 37 like 1 2 8
MIRT503942 FBXL13 F-box and leucine rich repeat protein 13 2 4
MIRT504235 MYO6 myosin VI 2 2
MIRT504453 MC2R melanocortin 2 receptor 2 2
MIRT506022 PURA purine rich element binding protein A 2 2
MIRT508028 BCAT1 branched chain amino acid transaminase 1 2 4
MIRT508299 YES1 YES proto-oncogene 1, Src family tyrosine kinase 2 4
MIRT511515 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT512307 AMER1 APC membrane recruitment protein 1 2 6
MIRT514565 XRCC3 X-ray repair cross complementing 3 2 4
MIRT515657 MYBPC1 myosin binding protein C, slow type 2 2
MIRT518429 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 2 2
MIRT520378 UBE2D1 ubiquitin conjugating enzyme E2 D1 2 4
MIRT521604 PSMA2 proteasome subunit alpha 2 2 4
MIRT521725 PPP3R1 protein phosphatase 3 regulatory subunit B, alpha 2 4
MIRT522579 MBNL3 muscleblind like splicing regulator 3 2 4
MIRT522731 LRRC55 leucine rich repeat containing 55 2 8
MIRT524547 CDC5L cell division cycle 5 like 2 4
MIRT525371 SYNM synemin 2 2
MIRT526489 PPIA peptidylprolyl isomerase A 2 4
MIRT527197 CLASP1 cytoplasmic linker associated protein 1 2 2
MIRT527285 FBLN2 fibulin 2 2 2
MIRT527383 MGARP mitochondria localized glutamic acid rich protein 2 2
MIRT527409 SMU1 DNA replication regulator and spliceosomal factor 2 6
MIRT527454 COL4A3 collagen type IV alpha 3 chain 2 2
MIRT528348 TBC1D22B TBC1 domain family member 22B 2 2
MIRT529104 ZNF100 zinc finger protein 100 2 2
MIRT529317 ATRNL1 attractin like 1 2 2
MIRT529328 PDE5A phosphodiesterase 5A 2 2
MIRT529750 SEL1L SEL1L ERAD E3 ligase adaptor subunit 2 2
MIRT530277 MKRN3 makorin ring finger protein 3 2 2
MIRT531415 TMEM18 transmembrane protein 18 2 2
MIRT532544 WDR13 WD repeat domain 13 2 2
MIRT533245 VKORC1L1 vitamin K epoxide reductase complex subunit 1 like 1 2 2
MIRT534659 RNF20 ring finger protein 20 2 2
MIRT534818 RAB33B RAB33B, member RAS oncogene family 2 2
MIRT537492 FAM169A family with sequence similarity 169 member A 2 2
MIRT538778 CABLES1 Cdk5 and Abl enzyme substrate 1 2 2
MIRT539122 ARL10 ADP ribosylation factor like GTPase 10 2 2
MIRT540964 SLC25A43 solute carrier family 25 member 43 2 2
MIRT541403 CDC27 cell division cycle 27 2 2
MIRT543353 ZNF829 zinc finger protein 829 2 2
MIRT543623 MFAP3 microfibril associated protein 3 2 2
MIRT543649 YY2 YY2 transcription factor 2 2
MIRT544945 SNCB synuclein beta 2 2
MIRT545327 SPC25 SPC25, NDC80 kinetochore complex component 2 2
MIRT546094 VEZF1 vascular endothelial zinc finger 1 2 2
MIRT548605 DCUN1D3 defective in cullin neddylation 1 domain containing 3 2 2
MIRT548638 DAZAP1 DAZ associated protein 1 2 4
MIRT550318 ZNF681 zinc finger protein 681 2 2
MIRT550412 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 4
MIRT551034 SPPL3 signal peptide peptidase like 3 2 2
MIRT551602 HDGFRP2 HDGF like 2 2 2
MIRT552064 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 4
MIRT552803 YAF2 YY1 associated factor 2 2 2
MIRT553274 TVP23C trans-golgi network vesicle protein 23 homolog C 2 2
MIRT553303 TSPAN3 tetraspanin 3 2 2
MIRT553570 NPM3 nucleophosmin/nucleoplasmin 3 2 2
MIRT554844 RECK reversion inducing cysteine rich protein with kazal motifs 2 2
MIRT556069 MTF2 metal response element binding transcription factor 2 2 4
MIRT556898 ITGA2 integrin subunit alpha 2 2 2
MIRT558680 CNIH cornichon family AMPA receptor auxiliary protein 1 1 1
MIRT559032 C20orf24 chromosome 20 open reading frame 24 2 2
MIRT559108 C18orf25 chromosome 18 open reading frame 25 2 2
MIRT559864 GSKIP GSK3B interacting protein 2 2
MIRT560868 GAL3ST3 galactose-3-O-sulfotransferase 3 2 2
MIRT562268 GRB2 growth factor receptor bound protein 2 2 2
MIRT562419 EIF2S2 eukaryotic translation initiation factor 2 subunit beta 2 2
MIRT562652 ARID1A AT-rich interaction domain 1A 2 4
MIRT563771 ZNF678 zinc finger protein 678 2 2
MIRT564279 DEPDC1B DEP domain containing 1B 2 2
MIRT565253 TRA2B transformer 2 beta homolog 2 4
MIRT565307 TMEM64 transmembrane protein 64 2 2
MIRT566034 RFX1 regulatory factor X1 2 2
MIRT566714 MTMR3 myotubularin related protein 3 2 2
MIRT568087 CELF2 CUGBP Elav-like family member 2 2 2
MIRT568417 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT568766 MYBL1 MYB proto-oncogene like 1 2 2
MIRT569516 THYN1 thymocyte nuclear protein 1 2 2
MIRT571823 PHF19 PHD finger protein 19 2 2
MIRT571995 HOXA9 homeobox A9 2 2
MIRT572174 CELF1 CUGBP Elav-like family member 1 2 2
MIRT572637 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT573756 KHSRP KH-type splicing regulatory protein 2 2
MIRT574089 CCDC132 VPS50, EARP/GARPII complex subunit 2 6
MIRT574311 CMTM6 CKLF like MARVEL transmembrane domain containing 6 2 2
MIRT574512 PSAT1 phosphoserine aminotransferase 1 2 2
MIRT574559 NRBF2 nuclear receptor binding factor 2 2 2
MIRT576686 H6pd hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) 2 2
MIRT608491 NKTR natural killer cell triggering receptor 2 6
MIRT608640 ATP9A ATPase phospholipid transporting 9A (putative) 2 6
MIRT609231 TMEM189 transmembrane protein 189 2 2
MIRT609561 TCEAL4 transcription elongation factor A like 4 2 2
MIRT610193 FAM49A family with sequence similarity 49 member A 2 2
MIRT610681 SYT2 synaptotagmin 2 2 4
MIRT610725 NAV2 neuron navigator 2 2 2
MIRT610813 SGOL2 shugoshin 2 2 2
MIRT610993 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 2
MIRT611030 KCNK10 potassium two pore domain channel subfamily K member 10 2 2
MIRT611339 SLC2A4 solute carrier family 2 member 4 2 2
MIRT611511 HIPK3 homeodomain interacting protein kinase 3 2 2
MIRT611638 EDIL3 EGF like repeats and discoidin domains 3 2 2
MIRT611856 RPL3L ribosomal protein L3 like 2 2
MIRT611905 TRPC3 transient receptor potential cation channel subfamily C member 3 2 2
MIRT612047 PCNXL2 pecanex homolog 2 2 6
MIRT612340 TRIB2 tribbles pseudokinase 2 2 2
MIRT612870 INO80C INO80 complex subunit C 2 2
MIRT613555 AMPD3 adenosine monophosphate deaminase 3 2 2
MIRT614490 MMS22L MMS22 like, DNA repair protein 2 2
MIRT615098 BRD4 bromodomain containing 4 2 2
MIRT616228 PTPN11 protein tyrosine phosphatase, non-receptor type 11 2 2
MIRT617220 GDPGP1 GDP-D-glucose phosphorylase 1 2 2
MIRT617884 ESR1 estrogen receptor 1 2 2
MIRT618344 CD59 CD59 molecule (CD59 blood group) 2 2
MIRT620264 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT620660 CCDC108 cilia and flagella associated protein 65 2 2
MIRT620761 CCR5 C-C motif chemokine receptor 5 (gene/pseudogene) 2 2
MIRT621416 TXNL1 thioredoxin like 1 2 2
MIRT621676 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 2
MIRT622231 SLC25A51 solute carrier family 25 member 51 2 2
MIRT622377 SALL1 spalt like transcription factor 1 2 2
MIRT622404 RRAGC Ras related GTP binding C 2 2
MIRT622494 RC3H1 ring finger and CCCH-type domains 1 2 2
MIRT623064 NRXN1 neurexin 1 2 2
MIRT623295 MAX MYC associated factor X 2 2
MIRT623691 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT623930 FMNL3 formin like 3 2 2
MIRT623984 FAM208A family with sequence similarity 208 member A 2 2
MIRT624513 C7orf55-LUC7L2 C7orf55-LUC7L2 readthrough 2 2
MIRT624668 ARID4A AT-rich interaction domain 4A 2 2
MIRT624756 ANGPTL2 angiopoietin like 2 2 2
MIRT624949 MARCH2 membrane associated ring-CH-type finger 2 2 2
MIRT625968 RNF2 ring finger protein 2 2 2
MIRT626415 KIAA2018 upstream transcription factor family member 3 2 2
MIRT626882 AP3B1 adaptor related protein complex 3 beta 1 subunit 2 2
MIRT627157 ZNF652 zinc finger protein 652 2 2
MIRT627613 SFT2D2 SFT2 domain containing 2 2 2
MIRT627744 RAP2B RAP2B, member of RAS oncogene family 2 4
MIRT627808 PTEN phosphatase and tensin homolog 2 2
MIRT627820 PRR3 proline rich 3 2 2
MIRT630935 UNC93A unc-93 homolog A 2 2
MIRT635930 GLTSCR2 NOP53 ribosome biogenesis factor 2 2
MIRT638301 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT638437 PNRC1 proline rich nuclear receptor coactivator 1 2 2
MIRT640281 TCF24 transcription factor 24 2 2
MIRT641979 PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 2 2
MIRT644179 GIN1 gypsy retrotransposon integrase 1 2 2
MIRT644439 VDR vitamin D receptor 2 2
MIRT644974 STEAP4 STEAP4 metalloreductase 2 2
MIRT647653 B3GALNT1 beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) 2 2
MIRT648702 TNFRSF13C TNF receptor superfamily member 13C 2 2
MIRT650120 ZCCHC9 zinc finger CCHC-type containing 9 2 2
MIRT650505 UFM1 ubiquitin fold modifier 1 2 2
MIRT650701 CLNK cytokine dependent hematopoietic cell linker 2 2
MIRT651083 ZNF518B zinc finger protein 518B 2 4
MIRT653644 SLC30A1 solute carrier family 30 member 1 2 2
MIRT653788 SIX4 SIX homeobox 4 2 2
MIRT656773 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT656949 KIAA1456 KIAA1456 2 2
MIRT656981 KDM5A lysine demethylase 5A 2 2
MIRT657225 TOR1AIP2 torsin 1A interacting protein 2 2 4
MIRT657706 GPC5 glypican 5 2 2
MIRT660107 BTBD3 BTB domain containing 3 2 2
MIRT662817 C9orf64 chromosome 9 open reading frame 64 2 2
MIRT665889 TGIF2 TGFB induced factor homeobox 2 2 2
MIRT668140 GINS2 GINS complex subunit 2 2 2
MIRT668566 ERCC1 ERCC excision repair 1, endonuclease non-catalytic subunit 2 2
MIRT669718 AAGAB alpha and gamma adaptin binding protein 2 2
MIRT685693 TRIM45 tripartite motif containing 45 2 2
MIRT686579 TMPPE transmembrane protein with metallophosphoesterase domain 2 2
MIRT687491 NHLRC2 NHL repeat containing 2 2 2
MIRT687805 KCNJ15 potassium voltage-gated channel subfamily J member 15 2 2
MIRT687968 HHIP hedgehog interacting protein 2 2
MIRT689487 SCIMP SLP adaptor and CSK interacting membrane protein 2 2
MIRT689595 NUDT7 nudix hydrolase 7 2 2
MIRT690501 RSRC1 arginine and serine rich coiled-coil 1 2 2
MIRT692290 XRN2 5'-3' exoribonuclease 2 2 2
MIRT693060 KIAA1324 KIAA1324 2 2
MIRT697443 ZFHX3 zinc finger homeobox 3 2 2
MIRT698475 TJP1 tight junction protein 1 2 2
MIRT699033 SOAT1 sterol O-acyltransferase 1 2 2
MIRT699785 SEMA4D semaphorin 4D 2 2
MIRT701463 NEO1 neogenin 1 2 2
MIRT701869 MRO maestro 2 2
MIRT702158 MAP3K1 mitogen-activated protein kinase kinase kinase 1 2 2
MIRT703750 FAM126B family with sequence similarity 126 member B 2 2
MIRT704277 DGS2 DiGeorge syndrome/velocardiofacial syndrome complex 2 2 2
MIRT707956 PGM3 phosphoglucomutase 3 2 2
MIRT712747 LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 2 2
MIRT712848 RHOA ras homolog family member A 2 2
MIRT712954 CCBE1 collagen and calcium binding EGF domains 1 2 2
MIRT713119 U2SURP U2 snRNP associated SURP domain containing 2 2
MIRT713148 PKIA cAMP-dependent protein kinase inhibitor alpha 2 2
MIRT715394 TADA3 transcriptional adaptor 3 2 2
MIRT715475 NEGR1 neuronal growth regulator 1 2 2
MIRT715535 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 2 2
MIRT721159 MYOCD myocardin 2 2
MIRT722719 ZNF460 zinc finger protein 460 2 2
MIRT723130 GTF2F2 general transcription factor IIF subunit 2 2 2
MIRT723259 TMLHE trimethyllysine hydroxylase, epsilon 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-54 Nicotine approved 89594 Microarray Caenorhabditis elegans 23765240 2013 up-regualted
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-548ac Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-miR-548ac Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-548ac Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-548ac Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-548ac Paclitaxel 36314 NSC125973 approved sensitive cell line (HS578T)
hsa-miR-548ac Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-548ac Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-548ac Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-548ac Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-548ac Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)

Error report submission