miRTarBase - #MIRT346169


—
pre-miRNA Information
pre-miRNA hsa-mir-5703   
Genomic Coordinates chr2: 227472132 - 227472187
Description Homo sapiens miR-5703 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-5703
Sequence 31| AGGAGAAGUCGGGAAGGU |48
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1183679532 2 dbSNP
rs932217747 3 dbSNP
rs1209011098 5 dbSNP
rs1486736741 8 dbSNP
rs1051940023 9 dbSNP
rs1223246998 10 dbSNP
rs1232901648 11 dbSNP
rs1424402647 12 dbSNP
rs890720113 15 dbSNP
rs1350946664 17 dbSNP
rs1292388472 18 dbSNP
rs1399653485 18 dbSNP
rs752410442 18 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RAC3   
Synonyms -
Description Rac family small GTPase 3
Transcript NM_005052   
Expression
Putative miRNA Targets on RAC3
3'UTR of RAC3
(miRNA target sites are highlighted)		 
>RAC3|NM_005052|3'UTR
   1 AGCCCTGGCCCACCCGAGCCTGAGGGCTGGCGGGGAGCAGCCCTGGACGTGTCCGCTGTTGTGTTGAGACGTGTGGTGTC
  81 CCTGAGTCGGCTGTGGGGAGCGGTGGGGGTGGGCCGGGGGGAAGCATGGGGATGAGGCTGGGTGGCAGGATCCTGTCCTC
 161 TCTGCCGCCTCATTCTGGGGTGTGGCTCCAGCCTTCCCTGGCCCCCGCCGGAGGCCGGGAGGGAGCAGGGTCTCCCTCAG
 241 GGCTGCAGGGGCAGGTGCAGGGAAGCCCCAGGATGGGCTTCCCTGGAGGGGGAGGGTGGGGGGGAGTTCTGTTCCTTGTG
 321 CCCCGAGGTGGGGCAGCCCCTTCTCATTTTATACAATAAACATTCTCCACCTACAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uggaaGGGCUGAAGAGga 5'
               |||  ||||||  
Target 5' ggcagCCC--CTTCTCat 3'
 332 - 347 125.00 -11.40
2 
miRNA  3' uggaagggcugAAGAGGa 5'
                     |||||| 
Target 5' tacaataaacaTTCTCCa 3'
 352 - 369 120.00 -6.60
3 
miRNA  3' uggaAGGGCUGAAGAGGa 5'
              |||:| | ||||: 
Target 5' aggaTCCTGTCCTCTCTg 3'
 147 - 164 110.00 -10.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30601368 17 COSMIC
COSN30158787 28 COSMIC
COSN31479980 64 COSMIC
COSN32154716 163 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1255568802 3 dbSNP
rs370664335 4 dbSNP
rs1189322359 5 dbSNP
rs12936039 6 dbSNP
rs1355257576 7 dbSNP
rs754511111 8 dbSNP
rs1263344749 9 dbSNP
rs1173013830 10 dbSNP
rs554545404 16 dbSNP
rs747844892 17 dbSNP
rs374174100 18 dbSNP
rs771885438 20 dbSNP
rs941034176 22 dbSNP
rs777495091 26 dbSNP
rs746823216 28 dbSNP
rs1383784637 29 dbSNP
rs770715798 31 dbSNP
rs377700246 32 dbSNP
rs745912043 33 dbSNP
rs1278423691 34 dbSNP
rs775843344 37 dbSNP
rs763154955 42 dbSNP
rs1260161777 44 dbSNP
rs1050854338 47 dbSNP
rs1364526408 48 dbSNP
rs371330446 49 dbSNP
rs1364242800 50 dbSNP
rs376245084 51 dbSNP
rs918572318 53 dbSNP
rs540027217 54 dbSNP
rs12936090 55 dbSNP
rs1451419313 56 dbSNP
rs1018533078 58 dbSNP
rs564682706 59 dbSNP
rs1206535505 62 dbSNP
rs984365080 62 dbSNP
rs1166595561 64 dbSNP
rs768444885 66 dbSNP
rs532079247 71 dbSNP
rs1306181866 72 dbSNP
rs1352400988 78 dbSNP
rs942824108 86 dbSNP
rs543871856 89 dbSNP
rs967425196 90 dbSNP
rs562168482 97 dbSNP
rs1320021765 100 dbSNP
rs981475361 101 dbSNP
rs865837696 102 dbSNP
rs960522768 103 dbSNP
rs990653264 108 dbSNP
rs565864361 115 dbSNP
rs1012462048 116 dbSNP
rs116150248 116 dbSNP
rs1206379751 116 dbSNP
rs567043469 117 dbSNP
rs918228613 122 dbSNP
rs1277461670 125 dbSNP
rs1483734885 132 dbSNP
rs527932689 138 dbSNP
rs1050823573 145 dbSNP
rs970990900 146 dbSNP
rs994249329 150 dbSNP
rs1025767397 153 dbSNP
rs1364144526 155 dbSNP
rs868457886 158 dbSNP
rs984125540 159 dbSNP
rs1183245884 161 dbSNP
rs552807601 167 dbSNP
rs111618114 168 dbSNP
rs964339514 170 dbSNP
rs1039858881 171 dbSNP
rs1462831230 179 dbSNP
rs1430369448 189 dbSNP
rs1312300970 193 dbSNP
rs1389871850 194 dbSNP
rs1357512713 197 dbSNP
rs1419958931 199 dbSNP
rs922778852 200 dbSNP
rs1186282982 202 dbSNP
rs1450384438 202 dbSNP
rs946238153 204 dbSNP
rs893316201 205 dbSNP
rs1186197451 206 dbSNP
rs571018395 207 dbSNP
rs538356796 208 dbSNP
rs556665128 210 dbSNP
rs1002865320 211 dbSNP
rs1385249890 214 dbSNP
rs184321106 217 dbSNP
rs371608454 218 dbSNP
rs1410905444 220 dbSNP
rs947978104 224 dbSNP
rs1046772932 226 dbSNP
rs1277214855 230 dbSNP
rs991541762 235 dbSNP
rs906357216 237 dbSNP
rs994447516 238 dbSNP
rs1211789836 239 dbSNP
rs1023861963 242 dbSNP
rs962594123 244 dbSNP
rs1234056454 246 dbSNP
rs373737438 251 dbSNP
rs1186396760 252 dbSNP
rs1005527303 261 dbSNP
rs1018308524 263 dbSNP
rs1249426183 268 dbSNP
rs1449944040 271 dbSNP
rs1361920046 272 dbSNP
rs1171930063 280 dbSNP
rs1423146747 282 dbSNP
rs1416299602 284 dbSNP
rs1227894913 285 dbSNP
rs1335074036 287 dbSNP
rs1388226679 288 dbSNP
rs1433204177 289 dbSNP
rs1411034585 290 dbSNP
rs964416460 291 dbSNP
rs1306607734 292 dbSNP
rs535465229 293 dbSNP
rs1350784117 294 dbSNP
rs531532201 295 dbSNP
rs1322490375 297 dbSNP
rs1159245904 298 dbSNP
rs1403176446 298 dbSNP
rs1409611070 298 dbSNP
rs1030362759 299 dbSNP
rs1490455059 301 dbSNP
rs977565314 305 dbSNP
rs1273646455 308 dbSNP
rs918545228 315 dbSNP
rs1342239079 320 dbSNP
rs923661915 321 dbSNP
rs929625289 325 dbSNP
rs916235563 326 dbSNP
rs1327992921 328 dbSNP
rs1368757339 329 dbSNP
rs1274627903 338 dbSNP
rs947744723 349 dbSNP
rs1249589772 356 dbSNP
rs986422688 357 dbSNP
rs1346576195 358 dbSNP
rs1465232073 362 dbSNP
rs912237383 365 dbSNP
rs1244960206 369 dbSNP
rs906446070 371 dbSNP
rs929762522 372 dbSNP
rs151163772 374 dbSNP
rs1189223268 375 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uggaagggcugAAGAGGa 5'
                     |||||| 
Target 5' uacaauaaacaUUCUCC- 3'
 		3 - 19
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000306897.4 | 3UTR | UAUACAAUAAACAUUCUCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
158 hsa-miR-5703 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT100581 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 2
MIRT134907 CCND2 cyclin D2 2 2
MIRT145067 TNFAIP1 TNF alpha induced protein 1 2 2
MIRT164194 SCOC short coiled-coil protein 2 2
MIRT179547 CAPZA1 capping actin protein of muscle Z-line alpha subunit 1 2 2
MIRT197051 NKIRAS2 NFKB inhibitor interacting Ras like 2 2 2
MIRT202410 RBM38 RNA binding motif protein 38 2 2
MIRT243306 SLC25A36 solute carrier family 25 member 36 2 2
MIRT273441 DAZAP2 DAZ associated protein 2 2 4
MIRT288608 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT324287 LURAP1L leucine rich adaptor protein 1 like 2 2
MIRT338925 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT346169 RAC3 Rac family small GTPase 3 2 2
MIRT370127 TRIB3 tribbles pseudokinase 3 2 2
MIRT442261 FBXW11 F-box and WD repeat domain containing 11 2 2
MIRT443368 PLXNA2 plexin A2 2 2
MIRT443635 ELP6 elongator acetyltransferase complex subunit 6 2 2
MIRT444007 GOLGA8H golgin A8 family member H 2 2
MIRT444019 GOLGA8M golgin A8 family member M 2 2
MIRT444180 HAL histidine ammonia-lyase 2 2
MIRT446553 GOLGA8J golgin A8 family member J 2 2
MIRT448121 CCDC80 coiled-coil domain containing 80 2 2
MIRT449475 ZNF84 zinc finger protein 84 2 2
MIRT449752 SMYD2 SET and MYND domain containing 2 2 2
MIRT450172 KLF7 Kruppel like factor 7 2 2
MIRT451418 TJP3 tight junction protein 3 2 4
MIRT451771 USP36 ubiquitin specific peptidase 36 2 2
MIRT451870 SOD2 superoxide dismutase 2 2 8
MIRT452184 KIAA1456 KIAA1456 2 2
MIRT453514 C14orf144 chromosome 14 open reading frame 144 2 2
MIRT453639 SLC4A2 solute carrier family 4 member 2 2 2
MIRT454010 ALKBH5 alkB homolog 5, RNA demethylase 2 2
MIRT454632 FAM83H family with sequence similarity 83 member H 2 2
MIRT454949 TPM2 tropomyosin 2 2 2
MIRT455358 KDM5C lysine demethylase 5C 2 2
MIRT455591 TAF12 TATA-box binding protein associated factor 12 2 2
MIRT455647 YARS tyrosyl-tRNA synthetase 2 2
MIRT456128 SAMD10 sterile alpha motif domain containing 10 2 2
MIRT456529 TMEM63A transmembrane protein 63A 2 2
MIRT456581 NID1 nidogen 1 2 2
MIRT456780 MTHFSD methenyltetrahydrofolate synthetase domain containing 2 2
MIRT457561 ZNF34 zinc finger protein 34 2 2
MIRT458110 GPIHBP1 glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 2 2
MIRT458450 RPRM reprimo, TP53 dependent G2 arrest mediator homolog 2 2
MIRT458734 CES2 carboxylesterase 2 2 2
MIRT459767 IDH3A isocitrate dehydrogenase 3 (NAD(+)) alpha 2 2
MIRT459793 POTED POTE ankyrin domain family member D 2 10
MIRT460160 CCL16 C-C motif chemokine ligand 16 2 2
MIRT461799 FXR2 FMR1 autosomal homolog 2 2 2
MIRT462595 MYL12A myosin light chain 12A 2 2
MIRT462708 MAPK13 mitogen-activated protein kinase 13 2 2
MIRT463289 ZFP91 ZFP91 zinc finger protein 2 2
MIRT464780 UBE2G1 ubiquitin conjugating enzyme E2 G1 2 2
MIRT465440 TP53 tumor protein p53 2 2
MIRT465681 TNPO2 transportin 2 2 2
MIRT466543 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT467268 SPOPL speckle type BTB/POZ protein like 2 2
MIRT467430 SND1 staphylococcal nuclease and tudor domain containing 1 2 2
MIRT467587 SLC7A5 solute carrier family 7 member 5 2 6
MIRT469755 RAB2B RAB2B, member RAS oncogene family 2 2
MIRT469984 PTPN14 protein tyrosine phosphatase, non-receptor type 14 2 2
MIRT470183 PSMD11 proteasome 26S subunit, non-ATPase 11 2 2
MIRT471057 PIM2 Pim-2 proto-oncogene, serine/threonine kinase 2 2
MIRT471862 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 4
MIRT473386 MBD4 methyl-CpG binding domain 4, DNA glycosylase 2 6
MIRT473891 M6PR mannose-6-phosphate receptor, cation dependent 2 8
MIRT474002 LRRC20 leucine rich repeat containing 20 2 2
MIRT474031 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT475519 HRK harakiri, BCL2 interacting protein 2 2
MIRT476138 GPR137C G protein-coupled receptor 137C 2 8
MIRT476282 GMFB glia maturation factor beta 2 10
MIRT476364 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT478048 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 10
MIRT479018 COL5A1 collagen type V alpha 1 chain 2 2
MIRT479438 CDKN1A cyclin dependent kinase inhibitor 1A 2 2
MIRT479568 CDC42SE1 CDC42 small effector 1 2 2
MIRT480040 CANX calnexin 2 2
MIRT480213 CABLES1 Cdk5 and Abl enzyme substrate 1 2 2
MIRT482211 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT482676 NXN nucleoredoxin 2 4
MIRT482817 TRAF6 TNF receptor associated factor 6 2 2
MIRT483404 SPATA6 spermatogenesis associated 6 2 4
MIRT483969 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 2 2
MIRT484204 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT484506 SYT7 synaptotagmin 7 2 2
MIRT485143 RASL10B RAS like family 10 member B 2 2
MIRT487006 C2orf82 chromosome 2 open reading frame 82 2 2
MIRT487924 KCND1 potassium voltage-gated channel subfamily D member 1 2 2
MIRT488393 PDE4DIP phosphodiesterase 4D interacting protein 2 2
MIRT488692 NAT9 N-acetyltransferase 9 (putative) 2 2
MIRT488974 REXO2 RNA exonuclease 2 2 2
MIRT490699 FSTL4 follistatin like 4 2 2
MIRT491740 SEMA3F semaphorin 3F 2 2
MIRT493790 GATA6 GATA binding protein 6 2 2
MIRT494234 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT497254 ELOVL6 ELOVL fatty acid elongase 6 2 2
MIRT501128 SLC2A1 solute carrier family 2 member 1 2 2
MIRT503775 ZNF12 zinc finger protein 12 2 6
MIRT505913 REST RE1 silencing transcription factor 2 2
MIRT506591 MECP2 methyl-CpG binding protein 2 2 4
MIRT507833 CCNT1 cyclin T1 2 2
MIRT510635 TMEM167A transmembrane protein 167A 2 4
MIRT512854 TBC1D13 TBC1 domain family member 13 2 9
MIRT514504 SHISA9 shisa family member 9 2 4
MIRT518899 CDC14B cell division cycle 14B 2 2
MIRT522615 MAP7D1 MAP7 domain containing 1 2 4
MIRT526675 MTMR1 myotubularin related protein 1 2 2
MIRT527325 SIAH3 siah E3 ubiquitin protein ligase family member 3 2 2
MIRT528362 ZMYM1 zinc finger MYM-type containing 1 2 4
MIRT528886 MARC1 mitochondrial amidoxime reducing component 1 2 2
MIRT530656 TRIM56 tripartite motif containing 56 2 2
MIRT537173 GFPT2 glutamine-fructose-6-phosphate transaminase 2 2 4
MIRT547922 HNRNPU heterogeneous nuclear ribonucleoprotein U 2 2
MIRT550416 ORC4 origin recognition complex subunit 4 2 2
MIRT553103 UBXN2A UBX domain protein 2A 2 2
MIRT555885 OTUD7B OTU deubiquitinase 7B 2 4
MIRT556361 MAF MAF bZIP transcription factor 2 2
MIRT557105 HOXA3 homeobox A3 2 2
MIRT560581 LCE1B late cornified envelope 1B 2 2
MIRT560872 SULT1B1 sulfotransferase family 1B member 1 2 2
MIRT561529 SOX4 SRY-box 4 2 2
MIRT561989 LRRC58 leucine rich repeat containing 58 2 2
MIRT562048 KPNA6 karyopherin subunit alpha 6 2 2
MIRT562120 IGFBP5 insulin like growth factor binding protein 5 2 2
MIRT562381 EN2 engrailed homeobox 2 2 2
MIRT563935 TAF7 TATA-box binding protein associated factor 7 2 2
MIRT565083 UHRF1BP1 UHRF1 binding protein 1 2 4
MIRT565276 TNFRSF21 TNF receptor superfamily member 21 2 2
MIRT565686 SET SET nuclear proto-oncogene 2 2
MIRT565756 SERTAD2 SERTA domain containing 2 2 2
MIRT568008 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT569186 LRRC3C leucine rich repeat containing 3C 2 2
MIRT569252 FAM129B family with sequence similarity 129 member B 2 2
MIRT569615 ASTN2 astrotactin 2 2 2
MIRT569690 FMNL3 formin like 3 2 2
MIRT569729 GPR173 G protein-coupled receptor 173 2 2
MIRT569769 SAMD14 sterile alpha motif domain containing 14 2 2
MIRT569822 CRMP1 collapsin response mediator protein 1 2 2
MIRT573272 NCAPH non-SMC condensin I complex subunit H 2 2
MIRT574932 Tbc1d13 TBC1 domain family, member 13 2 6
MIRT612255 ABCC6 ATP binding cassette subfamily C member 6 2 4
MIRT620507 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 2 2
MIRT627836 POU3F1 POU class 3 homeobox 1 2 2
MIRT630625 ANKRD32 SMC5-SMC6 complex localization factor 1 2 4
MIRT644934 PTCD2 pentatricopeptide repeat domain 2 2 2
MIRT660371 BACH2 BTB domain and CNC homolog 2 2 2
MIRT683345 SCARF1 scavenger receptor class F member 1 2 2
MIRT684975 MINOS1 mitochondrial inner membrane organizing system 1 2 2
MIRT693014 HS2ST1 heparan sulfate 2-O-sulfotransferase 1 2 2
MIRT699483 SLC10A6 solute carrier family 10 member 6 2 2
MIRT703962 EMP2 epithelial membrane protein 2 2 2
MIRT712294 PGM2L1 phosphoglucomutase 2 like 1 2 2
MIRT715896 SIPA1L1 signal induced proliferation associated 1 like 1 2 2
MIRT716635 DPY19L4 dpy-19 like 4 2 2
MIRT717241 HLA-DRB5 major histocompatibility complex, class II, DR beta 5 2 2
MIRT718163 KIAA1958 KIAA1958 2 2
MIRT723309 PRKCH protein kinase C eta 2 2
MIRT755589 SRC SRC proto-oncogene, non-receptor tyrosine kinase 5 1
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-5703 Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-mir-5703 Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-5703 Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-5703 Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-5703 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-5703 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)

Error report submission