pre-miRNA Information
pre-miRNA hsa-mir-6839   
Genomic Coordinates chr7: 64679064 - 64679176
Description Homo sapiens miR-6839 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6839-3p
Sequence 92| UUGGGUUUUCUCUUCAAUCCAG |113
Evidence Experimental
Experiments Meta-analysis
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN15661209 19 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1426245091 3 dbSNP
rs533324498 6 dbSNP
rs1169594864 16 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HIST1H2BE   
Synonyms H2B.h, H2B/h, H2BFH, dJ221C16.8
Description histone cluster 1 H2B family member e
Transcript NM_003523   
Expression
Putative miRNA Targets on HIST1H2BE
3'UTR of HIST1H2BE
(miRNA target sites are highlighted)
>HIST1H2BE|NM_003523|3'UTR
   1 ACTTGTCCCTGCAACTGCCTTAGTAAACCCAAAGGCTCTTTTCAGAGCCACTCA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' gaccuaacuucUCUUUUGGGUu 5'
                     || ||||||| 
Target 5' gcaactgccttAGTAAACCCAa 3'
11 - 32 147.00 -11.60
2
miRNA  3' gaccuaacuucucuuuUGGGUu 5'
                          ||::: 
Target 5' ----------------ACTTGt 3'
1 - 6 52.00 -5.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30494076 52 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs772893838 6 dbSNP
rs1421048933 7 dbSNP
rs760900720 8 dbSNP
rs1286070412 9 dbSNP
rs1368180372 9 dbSNP
rs766735705 10 dbSNP
rs776819133 12 dbSNP
rs4331976 15 dbSNP
rs911935879 16 dbSNP
rs377663923 17 dbSNP
rs561213967 18 dbSNP
rs1328602755 19 dbSNP
rs1374893001 21 dbSNP
rs1391520052 22 dbSNP
rs574763920 23 dbSNP
rs753192106 24 dbSNP
rs1246120654 28 dbSNP
rs763388326 31 dbSNP
rs764473312 32 dbSNP
rs751903027 33 dbSNP
rs755761544 36 dbSNP
rs921976813 37 dbSNP
rs753454928 38 dbSNP
rs903057247 38 dbSNP
rs1491113349 39 dbSNP
rs540248226 39 dbSNP
rs745460622 40 dbSNP
rs753333100 40 dbSNP
rs752419348 43 dbSNP
rs930888013 43 dbSNP
rs369025359 44 dbSNP
rs758083116 45 dbSNP
rs777749484 46 dbSNP
rs1196496684 48 dbSNP
rs748059770 49 dbSNP
rs532246531 51 dbSNP
rs1450334964 52 dbSNP
rs1267280805 54 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' gaccuaacuucucuuUUGGGUu 5'
                         |||||| 
Target 5' ---------------AACCCAa 3'
1 - 7
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Disease 8344.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 8344.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293/HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1067869. RNA binding protein: AGO2. Condition:Ago2 IP-seq (asynchronous cells) ...

- Kishore S; Gruber AR; Jedlinski DJ; Syed et al., 2013, Genome biology.

Article - Kishore S; Gruber AR; Jedlinski DJ; Syed et al.
- Genome biology, 2013
BACKGROUND: In recent years, a variety of small RNAs derived from other RNAs with well-known functions such as tRNAs and snoRNAs, have been identified. The functional relevance of these RNAs is largely unknown. To gain insight into the complexity of snoRNA processing and the functional relevance of snoRNA-derived small RNAs, we sequence long and short RNAs, small RNAs that co-precipitate with the Argonaute 2 protein and RNA fragments obtained in photoreactive nucleotide-enhanced crosslinking and immunoprecipitation (PAR-CLIP) of core snoRNA-associated proteins. RESULTS: Analysis of these data sets reveals that many loci in the human genome reproducibly give rise to C/D box-like snoRNAs, whose expression and evolutionary conservation are typically less pronounced relative to the snoRNAs that are currently cataloged. We further find that virtually all C/D box snoRNAs are specifically processed inside the regions of terminal complementarity, retaining in the mature form only 4-5 nucleotides upstream of the C box and 2-5 nucleotides downstream of the D box. Sequencing of the total and Argonaute 2-associated populations of small RNAs reveals that despite their cellular abundance, C/D box-derived small RNAs are not efficiently incorporated into the Ago2 protein. CONCLUSIONS: We conclude that the human genome encodes a large number of snoRNAs that are processed along the canonical pathway and expressed at relatively low levels. Generation of snoRNA-derived processing products with alternative, particularly miRNA-like, functions appears to be uncommon.
LinkOut: [PMID: 23706177]
CLIP-seq Support 1 for dataset GSM714642
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000356530.3 | 3UTR | AAACCCAAAGGCUCUUUUCAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1067869
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293/HeLa / Ago2 IP-seq (asynchronous cells)
Location of target site ENST00000356530.3 | 3UTR | AAACCCAAAGGCUCUUUUCAGAGCCACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23706177 / GSE43666
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000356530.3 | 3UTR | AACCCAAAGGCUCUUUUCAGAGCCACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000356530.3 | 3UTR | AACCCAAAGGCUCUUUUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000356530.3 | 3UTR | AAACCCAAAGGCUCUUUUCAGAGCCACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000356530.3 | 3UTR | UAAACCCAAAGGCUCUUUUCAGAGCCACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000356530.3 | 3UTR | AAACCCAAAGGCUCUUUUCAGAGCCACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
62 hsa-miR-6839-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT059162 TXNIP thioredoxin interacting protein 2 2
MIRT064872 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT065802 HOXC8 homeobox C8 2 4
MIRT106005 SDCBP syndecan binding protein 2 2
MIRT275773 TFDP1 transcription factor Dp-1 2 2
MIRT314032 PAPD7 poly(A) RNA polymerase D7, non-canonical 2 2
MIRT360277 HIST1H2BE histone cluster 1 H2B family member e 2 8
MIRT360301 HIST1H2BH histone cluster 1 H2B family member h 2 2
MIRT450086 OR2A4 olfactory receptor family 2 subfamily A member 4 2 2
MIRT468815 RSRC2 arginine and serine rich coiled-coil 2 2 6
MIRT475093 IRF2BP2 interferon regulatory factor 2 binding protein 2 2 4
MIRT477575 EIF1AD eukaryotic translation initiation factor 1A domain containing 2 2
MIRT483926 LCORL ligand dependent nuclear receptor corepressor like 2 6
MIRT504381 HIST1H1C histone cluster 1 H1 family member c 2 4
MIRT506970 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U like 1 2 6
MIRT507028 HIST1H3B histone cluster 1 H3 family member b 2 6
MIRT511561 HIST3H2BB histone cluster 3 H2B family member b 2 4
MIRT511650 HIST1H3D histone cluster 1 H3 family member d 2 6
MIRT511696 HIST1H2BL histone cluster 1 H2B family member l 2 4
MIRT511737 HIST1H2BB histone cluster 1 H2B family member b 2 6
MIRT511746 HIST1H2BA histone cluster 1 H2B family member a 2 8
MIRT515260 CSNK1E casein kinase 1 epsilon 2 2
MIRT516220 RAB3B RAB3B, member RAS oncogene family 2 4
MIRT523281 HIST1H1E histone cluster 1 H1 family member e 2 2
MIRT524121 DMXL1 Dmx like 1 2 2
MIRT530744 GPR82 G protein-coupled receptor 82 2 2
MIRT532214 CCDC117 coiled-coil domain containing 117 2 2
MIRT546182 TPRG1L tumor protein p63 regulated 1 like 2 2
MIRT558638 CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 2 2
MIRT559562 ARF1 ADP ribosylation factor 1 2 4
MIRT560680 HIST1H1T histone cluster 1 H1 family member t 2 2
MIRT570746 AAK1 AP2 associated kinase 1 2 2
MIRT609518 RAB3IP RAB3A interacting protein 2 2
MIRT612583 SYNGAP1 synaptic Ras GTPase activating protein 1 2 4
MIRT615733 RIOK3 RIO kinase 3 2 2
MIRT616068 SIX1 SIX homeobox 1 2 2
MIRT617903 SGCD sarcoglycan delta 2 2
MIRT620851 SERPING1 serpin family G member 1 2 2
MIRT625107 SLC1A5 solute carrier family 1 member 5 2 2
MIRT625120 NUP93 nucleoporin 93 2 2
MIRT625893 LINC00632 long intergenic non-protein coding RNA 632 2 2
MIRT626569 MED7 mediator complex subunit 7 2 2
MIRT626694 ZFP14 ZFP14 zinc finger protein 2 4
MIRT626808 PRR11 proline rich 11 2 2
MIRT628131 HM13 histocompatibility minor 13 2 2
MIRT636596 DCAF5 DDB1 and CUL4 associated factor 5 2 2
MIRT649866 SLFN12L schlafen family member 12 like 2 2
MIRT652133 TRPM7 transient receptor potential cation channel subfamily M member 7 2 2
MIRT652663 TIMELESS timeless circadian clock 2 2
MIRT658335 FAM83D family with sequence similarity 83 member D 2 2
MIRT660615 ANKS4B ankyrin repeat and sterile alpha motif domain containing 4B 2 2
MIRT666304 SLC22A3 solute carrier family 22 member 3 2 2
MIRT668528 ERGIC2 ERGIC and golgi 2 2 2
MIRT692510 PARD3 par-3 family cell polarity regulator 2 2
MIRT694784 DHFRL1 dihydrofolate reductase 2 2 2
MIRT700510 PTPN14 protein tyrosine phosphatase, non-receptor type 14 2 2
MIRT701438 NFYA nuclear transcription factor Y subunit alpha 2 2
MIRT710155 MTRF1L mitochondrial translational release factor 1 like 2 2
MIRT711436 DLC1 DLC1 Rho GTPase activating protein 2 2
MIRT716979 GPR155 G protein-coupled receptor 155 2 2
MIRT720155 POU2F2 POU class 2 homeobox 2 2 2
MIRT722512 DSTYK dual serine/threonine and tyrosine protein kinase 2 2

Error report submission