miRTarBase - #MIRT363756


—
pre-miRNA Information
pre-miRNA hsa-mir-4457   
Genomic Coordinates chr5: 1309310 - 1309377
Description Homo sapiens miR-4457 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4457
Sequence 43| UCACAAGGUAUUGACUGGCGUA |64
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1031676297 8 dbSNP
rs1249861366 14 dbSNP
rs115769169 17 dbSNP
rs968846507 19 dbSNP
rs540870271 20 dbSNP
rs993130937 22 dbSNP
Putative Targets

Gene Information
Gene Symbol EIF4EBP1   
Synonyms 4E-BP1, 4EBP1, BP-1, PHAS-I
Description eukaryotic translation initiation factor 4E binding protein 1
Transcript NM_004095   
Expression
Putative miRNA Targets on EIF4EBP1
3'UTR of EIF4EBP1
(miRNA target sites are highlighted)		 
>EIF4EBP1|NM_004095|3'UTR
   1 AGCACCAGCCATCGTGTGGAGCACTACCAAGGGGCCCCTCAGGGCCTTCCTGGGAGGAGTCCCACCAGCCAGGCCTTATG
  81 AAAGTGATCATACTGGGCAGGCGTTGGCGTGGGGTCGGACACCCCAGCCCTTTCTCCCTCACTCAGGGCACCTGCCCCCT
 161 CCTCTTCGTGAACACCAGCAGATACCTCCTTGTGCCTCCACTGATGCAGGAGCTGCCACCCCAAGGGGAGTGACCCCTGC
 241 CAGCACACCCTGCAGCCAAGGGCCAGGAAGTGGACAAGAACGAACCCTTCCTTCCGAATGATCAGCAGTTCCAGCCCCTC
 321 GCTGCTGGGGGCGCAACCACCCCTTCCTTAGGTTGATGTGCTTGGGAAAGCTCCCTCCCCCTCCTTCCCCAAGAGAGGAA
 401 ATAAAAGCCACCTTCGCCCTAGGGCCAAGAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' auGCGGUCAGUUAU---GGAACACu 5'
            | ||||  :|||   ||||||| 
Target 5' aaCACCAGCAGATACCTCCTTGTGc 3'
 171 - 195 160.00 -18.00
2 
miRNA  3' auGCGGUCAGUUAUGGAACACu 5'
            | |||| ||: :|||| || 
Target 5' ccCACCAGCCAG-GCCTTATGa 3'
 61 - 81 131.00 -15.10
3 
miRNA  3' auGCGGUCAGUUAUGGAACACu 5'
            | |||| |   |:| |||| 
Target 5' agCACCAGCC---ATCGTGTGg 3'
 1 - 19 109.00 -11.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30101184 4 COSMIC
COSN30448291 7 COSMIC
COSN31500682 14 COSMIC
COSN2275028 15 COSMIC
COSN31522013 26 COSMIC
COSN26974811 35 COSMIC
COSN20076247 40 COSMIC
COSN30469974 43 COSMIC
COSN30153999 50 COSMIC
COSN30169026 62 COSMIC
COSN31597372 64 COSMIC
COSN24398204 68 COSMIC
COSN30501423 87 COSMIC
COSN9262003 93 COSMIC
COSN30508519 97 COSMIC
COSN20051283 102 COSMIC
COSN20076434 104 COSMIC
COSN30640028 109 COSMIC
COSN26974812 110 COSMIC
COSN28874594 126 COSMIC
COSN30169023 135 COSMIC
COSN24311295 138 COSMIC
COSN23017204 151 COSMIC
COSN14341747 168 COSMIC
COSN32062531 297 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs141363035 2 dbSNP
rs753941404 5 dbSNP
rs1478680945 6 dbSNP
rs561472705 8 dbSNP
rs780095361 12 dbSNP
rs746922076 13 dbSNP
rs201004052 14 dbSNP
rs371852717 15 dbSNP
rs1488065004 16 dbSNP
rs1268198138 17 dbSNP
rs1211697771 23 dbSNP
rs1464966790 27 dbSNP
rs376946135 30 dbSNP
rs1219713912 31 dbSNP
rs772901137 34 dbSNP
rs1320462493 35 dbSNP
rs755380413 35 dbSNP
rs1276646798 36 dbSNP
rs762401667 38 dbSNP
rs554780861 39 dbSNP
rs770837501 43 dbSNP
rs1451277699 45 dbSNP
rs770459886 50 dbSNP
rs1384562916 52 dbSNP
rs1278901625 54 dbSNP
rs936532992 55 dbSNP
rs1345357624 56 dbSNP
rs764105301 57 dbSNP
rs369166115 60 dbSNP
rs1467072694 64 dbSNP
rs907911557 65 dbSNP
rs892270208 69 dbSNP
rs372784811 72 dbSNP
rs940689319 84 dbSNP
rs1378415574 87 dbSNP
rs943895977 89 dbSNP
rs1201181912 96 dbSNP
rs565301877 98 dbSNP
rs1452438375 99 dbSNP
rs532528481 103 dbSNP
rs76259589 104 dbSNP
rs149709505 109 dbSNP
rs529896805 110 dbSNP
rs1256613068 113 dbSNP
rs1198393778 116 dbSNP
rs1048013311 117 dbSNP
rs766355477 118 dbSNP
rs551875202 119 dbSNP
rs1330023227 120 dbSNP
rs1465464009 124 dbSNP
rs1309302140 133 dbSNP
rs1448963186 134 dbSNP
rs1374546144 137 dbSNP
rs1330499298 138 dbSNP
rs1470124634 141 dbSNP
rs1332391532 143 dbSNP
rs1004395543 144 dbSNP
rs1404005217 145 dbSNP
rs1174550747 146 dbSNP
rs1464691022 147 dbSNP
rs1016291380 155 dbSNP
rs960216692 161 dbSNP
rs569709066 164 dbSNP
rs1048925 165 dbSNP
rs947353316 168 dbSNP
rs1443363525 169 dbSNP
rs1281103699 174 dbSNP
rs1198399475 175 dbSNP
rs1343810066 183 dbSNP
rs536961665 184 dbSNP
rs28624549 187 dbSNP
rs1241670762 191 dbSNP
rs1351509972 193 dbSNP
rs751488066 197 dbSNP
rs570138233 198 dbSNP
rs1448593173 200 dbSNP
rs1342066352 201 dbSNP
rs534301662 206 dbSNP
rs1007856995 214 dbSNP
rs1394551257 215 dbSNP
rs1375056784 218 dbSNP
rs1159397856 219 dbSNP
rs566483688 229 dbSNP
rs1158594353 233 dbSNP
rs899557409 235 dbSNP
rs754838448 237 dbSNP
rs1441550537 238 dbSNP
rs1263453776 240 dbSNP
rs1218262370 247 dbSNP
rs1350879576 253 dbSNP
rs1284627372 258 dbSNP
rs1228851745 259 dbSNP
rs574471391 266 dbSNP
rs1358344727 268 dbSNP
rs541520118 270 dbSNP
rs988043932 271 dbSNP
rs11545133 273 dbSNP
rs555160609 282 dbSNP
rs1199054375 283 dbSNP
rs1317686533 286 dbSNP
rs1406507449 289 dbSNP
rs1416577392 291 dbSNP
rs1161900973 293 dbSNP
rs1475089940 296 dbSNP
rs1259678081 297 dbSNP
rs1195426741 300 dbSNP
rs1041308745 308 dbSNP
rs1261889168 309 dbSNP
rs1221636498 313 dbSNP
rs1453321984 316 dbSNP
rs1287647893 318 dbSNP
rs1467135848 318 dbSNP
rs921112776 322 dbSNP
rs1266829687 324 dbSNP
rs1279809574 326 dbSNP
rs1048934 333 dbSNP
rs1338678276 334 dbSNP
rs1269738046 336 dbSNP
rs1437278345 339 dbSNP
rs1015127099 340 dbSNP
rs1322166666 342 dbSNP
rs1461335156 358 dbSNP
rs1401521951 359 dbSNP
rs1173235045 363 dbSNP
rs1371566857 365 dbSNP
rs1476665002 374 dbSNP
rs1048146783 377 dbSNP
rs1418343566 378 dbSNP
rs888102587 381 dbSNP
rs762244825 382 dbSNP
rs1244423041 383 dbSNP
rs1220777284 387 dbSNP
rs78978523 388 dbSNP
rs1458131498 389 dbSNP
rs1259803629 391 dbSNP
rs1196510135 392 dbSNP
rs981378722 393 dbSNP
rs544157525 394 dbSNP
rs371690517 396 dbSNP
rs958841043 397 dbSNP
rs1378271284 408 dbSNP
rs896090200 412 dbSNP
rs1464396004 416 dbSNP
rs567241096 417 dbSNP
rs1023515020 420 dbSNP
rs1415782285 429 dbSNP
rs1422490834 430 dbSNP
rs1041656814 431 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' augcggucaguUAU---GGAACACu 5'
                     |||   ||||||| 
Target 5' -----------AUACCUCCUUGUGc 3'
 		1 - 14
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000338825.4 | 3UTR | AUACCUCCUUGUGCCUCCACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
83 hsa-miR-4457 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT098032 SOBP sine oculis binding protein homolog 2 2
MIRT202580 PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 2 6
MIRT247137 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT349266 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT363756 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 2 2
MIRT443586 FAM84B family with sequence similarity 84 member B 2 2
MIRT452333 EIF5AL1 eukaryotic translation initiation factor 5A-like 1 2 2
MIRT453864 ZBTB40 zinc finger and BTB domain containing 40 2 4
MIRT471486 PDE4D phosphodiesterase 4D 2 4
MIRT476290 GMFB glia maturation factor beta 2 8
MIRT479897 CCDC117 coiled-coil domain containing 117 2 4
MIRT484251 ANK1 ankyrin 1 2 2
MIRT491473 TMEM214 transmembrane protein 214 2 2
MIRT493804 GAN gigaxonin 2 6
MIRT499252 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT502271 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 4
MIRT504651 RPL9 ribosomal protein L9 2 6
MIRT505211 UBN2 ubinuclein 2 2 8
MIRT508952 SNRPB small nuclear ribonucleoprotein polypeptides B and B1 2 4
MIRT512691 POP1 POP1 homolog, ribonuclease P/MRP subunit 2 2
MIRT513320 SCUBE3 signal peptide, CUB domain and EGF like domain containing 3 2 2
MIRT513870 HOXA5 homeobox A5 2 2
MIRT517342 ZNF529 zinc finger protein 529 2 4
MIRT518947 LSG1 large 60S subunit nuclear export GTPase 1 2 2
MIRT520867 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone 2 2
MIRT528325 GIGYF2 GRB10 interacting GYF protein 2 2 2
MIRT531990 SLCO1B3 solute carrier organic anion transporter family member 1B3 2 2
MIRT533298 USP46 ubiquitin specific peptidase 46 2 2
MIRT545257 TRIM36 tripartite motif containing 36 2 4
MIRT547038 POGZ pogo transposable element derived with ZNF domain 2 2
MIRT556103 MOAP1 modulator of apoptosis 1 2 2
MIRT558321 DR1 down-regulator of transcription 1 2 2
MIRT558521 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT560906 TMED10 transmembrane p24 trafficking protein 10 2 2
MIRT568448 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT570586 OTUD7B OTU deubiquitinase 7B 2 2
MIRT572799 SIGLEC14 sialic acid binding Ig like lectin 14 2 2
MIRT573863 C9orf78 chromosome 9 open reading frame 78 2 2
MIRT575058 P2ry1 purinergic receptor P2Y, G-protein coupled 1 2 5
MIRT609931 SLC38A1 solute carrier family 38 member 1 2 4
MIRT610836 ZNF585A zinc finger protein 585A 2 4
MIRT611474 P2RY1 purinergic receptor P2Y1 2 7
MIRT613569 YY2 YY2 transcription factor 2 2
MIRT618626 GREB1 growth regulation by estrogen in breast cancer 1 2 2
MIRT620606 SAP30 Sin3A associated protein 30 2 2
MIRT621017 CLSTN3 calsyntenin 3 2 4
MIRT635314 FAM179A TOG array regulator of axonemal microtubules 2 2 2
MIRT635919 GLTSCR2 NOP53 ribosome biogenesis factor 2 2
MIRT640598 TM9SF4 transmembrane 9 superfamily member 4 2 2
MIRT641784 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 4
MIRT644067 IQCE IQ motif containing E 2 2
MIRT648288 TRAPPC2L trafficking protein particle complex 2 like 2 2
MIRT658085 FOXR2 forkhead box R2 2 2
MIRT659077 DEPTOR DEP domain containing MTOR interacting protein 2 2
MIRT665307 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT665975 SYTL4 synaptotagmin like 4 2 2
MIRT666302 SLC25A25 solute carrier family 25 member 25 2 2
MIRT674906 RASSF9 Ras association domain family member 9 2 2
MIRT680086 THAP1 THAP domain containing 1 2 2
MIRT681488 DIP2A disco interacting protein 2 homolog A 2 2
MIRT691244 DFNB59 pejvakin 2 2
MIRT692362 AGTRAP angiotensin II receptor associated protein 2 2
MIRT693035 MB21D1 Mab-21 domain containing 1 2 2
MIRT693837 STAT5A signal transducer and activator of transcription 5A 2 2
MIRT694479 LRTOMT leucine rich transmembrane and O-methyltransferase domain containing 2 2
MIRT696070 ZNF264 zinc finger protein 264 2 2
MIRT696578 TTC21B tetratricopeptide repeat domain 21B 2 2
MIRT696760 MTFMT mitochondrial methionyl-tRNA formyltransferase 2 2
MIRT697307 ZNF652 zinc finger protein 652 2 2
MIRT700152 RNF115 ring finger protein 115 2 2
MIRT701056 PARP2 poly(ADP-ribose) polymerase 2 2 2
MIRT701198 OTUD3 OTU deubiquitinase 3 2 2
MIRT701335 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT702656 ITGA3 integrin subunit alpha 3 2 2
MIRT703618 FBXO45 F-box protein 45 2 2
MIRT704673 CHTOP chromatin target of PRMT1 2 2
MIRT708894 ZNF780A zinc finger protein 780A 2 2
MIRT711620 DGKH diacylglycerol kinase eta 2 2
MIRT713745 TMEM81 transmembrane protein 81 2 2
MIRT719712 CD101 CD101 molecule 2 2
MIRT720294 DLGAP3 DLG associated protein 3 2 2
MIRT722606 CCDC152 coiled-coil domain containing 152 2 2
MIRT724566 ACSBG1 acyl-CoA synthetase bubblegum family member 1 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4457 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-miR-4457 Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-4457 Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-4457 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)

Error report submission