miRTarBase - #MIRT366306


—
pre-miRNA Information
pre-miRNA hsa-mir-3135b   
Genomic Coordinates chr6: 32749912 - 32749979
Description Homo sapiens miR-3135b stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3135b
Sequence 7| GGCUGGAGCGAGUGCAGUGGUG |28
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1437307191 2 dbSNP
rs1202765326 3 dbSNP
rs905889141 5 dbSNP
rs922757991 8 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GDI1   
Synonyms 1A, GDIL, MRX41, MRX48, OPHN2, RABGD1A, RABGDIA, XAP-4
Description GDP dissociation inhibitor 1
Transcript NM_001493   
Expression
Putative miRNA Targets on GDI1
3'UTR of GDI1
(miRNA target sites are highlighted)		 
>GDI1|NM_001493|3'UTR
   1 TTGTGGCCGCCCCCAGCCCCTGCTGCCCCAGCCTGTGTCTGTTCTCCTCGAGGGCTCCAGCATCCTCTGCTTCCCCCACC
  81 ACGTTCCCATCACCCACCTCATTGATCCACTGACCAAATCCTTAACCCTAGCGATGGCTTGGGAGATGGGGGGTTGGATA
 161 GCATCCTCTTTCTTGGCCCTTCCTTATCCTAGGAAAAGAGGGTTCCTCTCCTTGTGTGTGTCTCTTCCCCCCACCCCTAA
 241 TTCTTCTGCTCTGTTTGGGAAGACGTGGAGGAAAAGGTGACTTCTGCCCCCACCGCTCTTACCCCCACTGTAGTGGCCTT
 321 TGGAGATGCCCCCACCTCCCCCCCACCAACTCTCGCGTGTTGGAGAGAAGGGGCCCTCCCAGCACAAAGTTGCATTCCTC
 401 CCCCCTAATTTATTCTAATTTATTAACTTTGACCCACCCTTTCTGAGCCTGCAGCCTTCCCGTGTGGCCTGAGGGCTGTC
 481 GAGTGAGCTGCCCCAGCCCCTCCCAGCCCTTGCCCAGCCTGGGGGAGTGGGGAAGGCTTGGGCATGGCCCCGTTGGAGGT
 561 TGATTTGCTGTTTTGTTTCTTGTCTTTGTGTTCTGTGGTACTTGCTGAGAGAAAAGAAAAGTGAGCCAAGCAGAAGGAGG
 641 TGGGAAAACGGACCCAAACCCCAGTGTGCCCTGCCCCATGCCTTTCCTTTAGTGGTGGGAAACCCTTATCTTGCAAAGTG
 721 AATGTGTCCCCTTCCCCACCCTCTAGTGTATTTCACAGAAAACAAAACCTCCCAATAAAACGGTTGAAACCTGAAAAAAA
 801 AAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guGGUGACGUGAG----CGAGGUCGg 5'
            |:::| : |||    |||||||| 
Target 5' gtCTGTTCTCCTCGAGGGCTCCAGCa 3'
 37 - 62 154.00 -19.21
2 
miRNA  3' guGGUGACGUGAGCGAGGUCGg 5'
            || ||||   :|| ||||| 
Target 5' agCCCCTGC---TGCCCCAGCc 3'
 15 - 33 129.00 -21.70
3 
miRNA  3' guGGUGACGUGAGCGAGGUCGg 5'
            | | || :|| || ||||| 
Target 5' gtCGAGTGAGCT-GCCCCAGCc 3'
 478 - 498 127.00 -17.20
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs782048019 2 dbSNP
rs782763010 11 dbSNP
rs55736938 19 dbSNP
rs782516329 26 dbSNP
rs975427398 28 dbSNP
rs782632974 30 dbSNP
rs782813979 44 dbSNP
rs955433519 45 dbSNP
rs190219027 47 dbSNP
rs7059013 49 dbSNP
rs782473573 50 dbSNP
rs1380695549 65 dbSNP
rs1336574825 83 dbSNP
rs782706979 84 dbSNP
rs1401828749 87 dbSNP
rs1387536998 102 dbSNP
rs781811623 107 dbSNP
rs1157170676 108 dbSNP
rs990330063 116 dbSNP
rs1453546653 120 dbSNP
rs1362847380 122 dbSNP
rs1183836992 128 dbSNP
rs1240756763 134 dbSNP
rs914709819 136 dbSNP
rs1447485694 142 dbSNP
rs1203160231 148 dbSNP
rs1286304286 148 dbSNP
rs1349765057 156 dbSNP
rs1292704356 160 dbSNP
rs1248454703 166 dbSNP
rs1380626682 166 dbSNP
rs1314489217 168 dbSNP
rs1431637035 169 dbSNP
rs1328676634 183 dbSNP
rs946452926 184 dbSNP
rs1316912657 186 dbSNP
rs1381951049 189 dbSNP
rs782152934 192 dbSNP
rs1163780240 207 dbSNP
rs782815711 209 dbSNP
rs1426184096 213 dbSNP
rs1383050888 216 dbSNP
rs879970914 223 dbSNP
rs904934005 225 dbSNP
rs939061155 228 dbSNP
rs183216290 233 dbSNP
rs1243765716 234 dbSNP
rs1190959110 237 dbSNP
rs1446147143 245 dbSNP
rs1269376359 252 dbSNP
rs1224947662 257 dbSNP
rs1056517840 259 dbSNP
rs887051731 260 dbSNP
rs1357526551 265 dbSNP
rs1291369341 266 dbSNP
rs1215237074 269 dbSNP
rs1341576109 273 dbSNP
rs1004059788 275 dbSNP
rs1227382553 279 dbSNP
rs1016723483 285 dbSNP
rs898371809 287 dbSNP
rs1403528451 290 dbSNP
rs1363321859 293 dbSNP
rs781867947 295 dbSNP
rs1028435098 297 dbSNP
rs1409987257 299 dbSNP
rs1421034377 302 dbSNP
rs955623575 303 dbSNP
rs1477468641 307 dbSNP
rs1429967671 310 dbSNP
rs1201279865 320 dbSNP
rs1489818271 327 dbSNP
rs1268376681 335 dbSNP
rs1205492096 338 dbSNP
rs1439593865 338 dbSNP
rs986836950 341 dbSNP
rs782470523 343 dbSNP
rs1285821840 345 dbSNP
rs1222049796 346 dbSNP
rs868982656 355 dbSNP
rs1442532251 356 dbSNP
rs782608366 357 dbSNP
rs1464684803 358 dbSNP
rs990361323 371 dbSNP
rs914825698 373 dbSNP
rs1479294637 405 dbSNP
rs781789172 406 dbSNP
rs1063371 416 dbSNP
rs1424239716 423 dbSNP
rs970248782 424 dbSNP
rs1177948797 431 dbSNP
rs1471267500 435 dbSNP
rs980254752 436 dbSNP
rs1231430270 439 dbSNP
rs782603998 443 dbSNP
rs11549303 444 dbSNP
rs1461873245 461 dbSNP
rs939077085 462 dbSNP
rs782715555 463 dbSNP
rs1323232659 468 dbSNP
rs782440002 478 dbSNP
rs1225883044 479 dbSNP
rs782668861 481 dbSNP
rs1277481800 482 dbSNP
rs1382890767 490 dbSNP
rs782290807 492 dbSNP
rs1468188961 494 dbSNP
rs1358554429 496 dbSNP
rs1159520544 506 dbSNP
rs11549302 508 dbSNP
rs113193055 513 dbSNP
rs1038292161 525 dbSNP
rs1406042736 527 dbSNP
rs1178267627 536 dbSNP
rs1445246012 545 dbSNP
rs898401330 552 dbSNP
rs1182237955 553 dbSNP
rs1243241406 556 dbSNP
rs1218379462 575 dbSNP
rs1315566152 582 dbSNP
rs1281631081 583 dbSNP
rs1239014933 589 dbSNP
rs1359471762 602 dbSNP
rs782369773 603 dbSNP
rs1449882425 606 dbSNP
rs1289428995 607 dbSNP
rs996665101 614 dbSNP
rs1049998994 617 dbSNP
rs1343224419 635 dbSNP
rs1425562926 638 dbSNP
rs1387372106 639 dbSNP
rs782656600 642 dbSNP
rs1423387239 643 dbSNP
rs1008689429 662 dbSNP
rs1263031109 665 dbSNP
rs1031679622 677 dbSNP
rs1188815839 685 dbSNP
rs1485073693 686 dbSNP
rs1262947100 688 dbSNP
rs1223752135 691 dbSNP
rs1490402320 693 dbSNP
rs1293572343 704 dbSNP
rs1241963434 705 dbSNP
rs782219682 705 dbSNP
rs782386174 715 dbSNP
rs782370077 719 dbSNP
rs1216292267 729 dbSNP
rs1359548997 731 dbSNP
rs1297335803 732 dbSNP
rs111431799 740 dbSNP
rs1011581229 741 dbSNP
rs1049729 747 dbSNP
rs781927333 748 dbSNP
rs1301587197 758 dbSNP
rs1457422389 761 dbSNP
rs782672995 763 dbSNP
rs970283115 767 dbSNP
rs980277679 774 dbSNP
rs1173103013 775 dbSNP
rs928770307 776 dbSNP
rs1423595778 778 dbSNP
rs1200595109 782 dbSNP
rs1481654738 783 dbSNP
rs1270513731 794 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' guggugacgugagCGAGGUCGg 5'
                       |||||||| 
Target 5' ----------aggGCUCCAGCa 3'
 		1 - 12
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 2664.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' guggugacgugagCGAGGUCGg 5'
                       |||||||| 
Target 5' ----------aggGCUCCAGCa 3'
 		1 - 12
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000447750.2 | 3UTR | AGGGCUCCAGCAUCCUCUGCUUCCCCCACCAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000447750.2 | 3UTR | AGGGCUCCAGCAUCCUCUGCUUCCCCCACCACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
305 hsa-miR-3135b Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT079084 BIRC5 baculoviral IAP repeat containing 5 2 6
MIRT118055 SLC1A5 solute carrier family 1 member 5 2 2
MIRT195529 SNTB2 syntrophin beta 2 2 2
MIRT312491 SLC26A2 solute carrier family 26 member 2 2 2
MIRT366306 GDI1 GDP dissociation inhibitor 1 2 4
MIRT448908 CLCN6 chloride voltage-gated channel 6 2 4
MIRT451874 SOD2 superoxide dismutase 2 2 8
MIRT454235 OSBPL10 oxysterol binding protein like 10 2 15
MIRT454512 ZFYVE27 zinc finger FYVE-type containing 27 2 2
MIRT457728 SMOX spermine oxidase 2 2
MIRT459797 POTED POTE ankyrin domain family member D 2 10
MIRT459905 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 12
MIRT462667 HMOX1 heme oxygenase 1 2 2
MIRT466798 SUPT16H SPT16 homolog, facilitates chromatin remodeling subunit 2 2
MIRT468954 RPS14 ribosomal protein S14 2 2
MIRT469458 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT470214 PRRC2B proline rich coiled-coil 2B 2 2
MIRT470503 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT476142 GPR137C G protein-coupled receptor 137C 2 8
MIRT476864 FHL2 four and a half LIM domains 2 2 4
MIRT478052 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 10
MIRT480647 BSCL2 BSCL2, seipin lipid droplet biogenesis associated 2 2
MIRT488513 CD3E CD3e molecule 2 2
MIRT497664 PRMT3 protein arginine methyltransferase 3 2 2
MIRT498656 AP3B2 adaptor related protein complex 3 beta 2 subunit 2 6
MIRT499315 ZNF485 zinc finger protein 485 2 10
MIRT499761 CIRH1A UTP4, small subunit processome component 2 8
MIRT501131 SLC2A1 solute carrier family 2 member 1 2 2
MIRT502292 GNG12 G protein subunit gamma 12 2 6
MIRT503452 PNMA2 paraneoplastic Ma antigen 2 2 6
MIRT507072 H2AFX H2A histone family member X 2 4
MIRT509947 TOMM70A translocase of outer mitochondrial membrane 70 2 6
MIRT514508 SHISA9 shisa family member 9 2 4
MIRT515507 GTF2F1 general transcription factor IIF subunit 1 2 2
MIRT515912 MFAP2 microfibril associated protein 2 2 2
MIRT516412 COPA coatomer protein complex subunit alpha 2 2
MIRT516477 RAB32 RAB32, member RAS oncogene family 2 2
MIRT517863 NCAPD2 non-SMC condensin I complex subunit D2 2 4
MIRT518785 MED16 mediator complex subunit 16 2 4
MIRT518952 GRK7 G protein-coupled receptor kinase 7 2 2
MIRT519227 PYCARD PYD and CARD domain containing 2 2
MIRT522561 MCAM melanoma cell adhesion molecule 2 4
MIRT523767 FBXO27 F-box protein 27 2 4
MIRT528364 ZMYM1 zinc finger MYM-type containing 1 2 4
MIRT529369 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 4
MIRT529978 TNFAIP8L1 TNF alpha induced protein 8 like 1 2 2
MIRT530454 SULT1B1 sulfotransferase family 1B member 1 2 2
MIRT531643 C19orf52 translocase of inner mitochondrial membrane 29 2 4
MIRT531751 TXK TXK tyrosine kinase 2 2
MIRT531915 SLC4A1 solute carrier family 4 member 1 (Diego blood group) 2 2
MIRT532024 FHDC1 FH2 domain containing 1 2 2
MIRT533117 YIPF4 Yip1 domain family member 4 2 4
MIRT534713 RFX7 regulatory factor X7 2 2
MIRT535473 PARVB parvin beta 2 6
MIRT535769 MYCN MYCN proto-oncogene, bHLH transcription factor 2 2
MIRT536744 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT537943 DSN1 DSN1 homolog, MIS12 kinetochore complex component 2 2
MIRT539525 ABCF1 ATP binding cassette subfamily F member 1 2 4
MIRT540255 FAM89A family with sequence similarity 89 member A 2 2
MIRT540440 RBM43 RNA binding motif protein 43 2 2
MIRT542984 ERC1 ELKS/RAB6-interacting/CAST family member 1 2 2
MIRT543426 LAMTOR3 late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 2 2
MIRT544676 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT544727 NDRG1 N-myc downstream regulated 1 2 2
MIRT545196 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT553254 TVP23C trans-golgi network vesicle protein 23 homolog C 2 2
MIRT553277 TVP23B trans-golgi network vesicle protein 23 homolog B 2 2
MIRT565018 VIM vimentin 2 2
MIRT565931 SAMD4B sterile alpha motif domain containing 4B 2 2
MIRT569796 CSF1 colony stimulating factor 1 2 2
MIRT570259 PRSS16 protease, serine 16 2 2
MIRT570785 ORC6 origin recognition complex subunit 6 2 2
MIRT571144 HM13 histocompatibility minor 13 2 2
MIRT572818 MYO1C myosin IC 2 2
MIRT575204 Entpd4 ectonucleoside triphosphate diphosphohydrolase 4 2 3
MIRT575284 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 2 2
MIRT575304 Osbpl10 oxysterol binding protein-like 10 2 9
MIRT575325 Fbxo6 F-box protein 6 2 2
MIRT575381 Ang angiogenin, ribonuclease, RNase A family, 5 2 3
MIRT575675 Map1b microtubule-associated protein 1B 2 2
MIRT576902 Poteg POTE ankyrin domain family, member G 2 2
MIRT607049 IDS iduronate 2-sulfatase 2 2
MIRT607067 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 2 2
MIRT607492 HEBP2 heme binding protein 2 2 2
MIRT607524 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT607657 BTN3A2 butyrophilin subfamily 3 member A2 2 2
MIRT607797 RHBDL2 rhomboid like 2 2 2
MIRT607844 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT607931 ANG angiogenin 2 3
MIRT607968 SNX22 sorting nexin 22 2 2
MIRT608076 ZFP14 ZFP14 zinc finger protein 2 2
MIRT608100 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT608143 SYAP1 synapse associated protein 1 2 2
MIRT608905 ZNF790 zinc finger protein 790 2 2
MIRT612930 GPRIN3 GPRIN family member 3 2 2
MIRT616768 LONP2 lon peptidase 2, peroxisomal 2 2
MIRT617446 CCS copper chaperone for superoxide dismutase 2 2
MIRT617554 MTO1 mitochondrial tRNA translation optimization 1 2 2
MIRT618774 HLA-E major histocompatibility complex, class I, E 2 2
MIRT618928 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT619248 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT620572 WBSCR27 methyltransferase like 27 2 4
MIRT622655 POU2F3 POU class 2 homeobox 3 2 4
MIRT623175 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT624167 DGKE diacylglycerol kinase epsilon 2 2
MIRT625270 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 2 2
MIRT625398 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 2 2
MIRT625696 OPTN optineurin 2 2
MIRT626095 MKLN1 muskelin 1 2 2
MIRT626433 CHDH choline dehydrogenase 2 2
MIRT627015 FIG4 FIG4 phosphoinositide 5-phosphatase 2 2
MIRT627079 SF3A1 splicing factor 3a subunit 1 2 2
MIRT627142 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT627349 TSHZ2 teashirt zinc finger homeobox 2 2 2
MIRT627422 THAP2 THAP domain containing 2 2 2
MIRT627443 TAS2R5 taste 2 receptor member 5 2 2
MIRT627882 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT628080 KAT7 lysine acetyltransferase 7 2 4
MIRT628278 CYB5D1 cytochrome b5 domain containing 1 2 2
MIRT629096 F2RL1 F2R like trypsin receptor 1 2 2
MIRT629238 CINP cyclin dependent kinase 2 interacting protein 2 2
MIRT629288 UNC13A unc-13 homolog A 2 2
MIRT629409 ADM2 adrenomedullin 2 2 2
MIRT629586 RFC2 replication factor C subunit 2 2 2
MIRT629637 WDR31 WD repeat domain 31 2 2
MIRT629876 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT629986 NARS asparaginyl-tRNA synthetase 2 2
MIRT630045 TERF2 telomeric repeat binding factor 2 2 2
MIRT630063 NIP7 NIP7, nucleolar pre-rRNA processing protein 2 2
MIRT630129 ARHGEF5 Rho guanine nucleotide exchange factor 5 2 2
MIRT630157 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT630254 SMTNL2 smoothelin like 2 2 2
MIRT630280 PSMB5 proteasome subunit beta 5 2 2
MIRT630349 NKAP NFKB activating protein 2 2
MIRT630499 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT630554 ROBO1 roundabout guidance receptor 1 2 4
MIRT631266 CENPM centromere protein M 2 2
MIRT631405 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT632472 RPS15A ribosomal protein S15a 2 2
MIRT632513 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT632598 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT632996 DUSP18 dual specificity phosphatase 18 2 2
MIRT633084 CXorf21 chromosome X open reading frame 21 2 2
MIRT633241 ZNF573 zinc finger protein 573 2 2
MIRT633538 PGBD5 piggyBac transposable element derived 5 2 2
MIRT634340 SGOL1 shugoshin 1 2 2
MIRT634602 KIAA1919 major facilitator superfamily domain containing 4B 2 2
MIRT635052 MYH11 myosin heavy chain 11 2 2
MIRT635106 MAVS mitochondrial antiviral signaling protein 2 2
MIRT635238 QPRT quinolinate phosphoribosyltransferase 2 2
MIRT635324 BMS1 BMS1, ribosome biogenesis factor 2 2
MIRT636270 RNF157 ring finger protein 157 2 2
MIRT636452 LRCH3 leucine rich repeats and calponin homology domain containing 3 2 2
MIRT636518 FMN1 formin 1 2 2
MIRT636655 CDK4 cyclin dependent kinase 4 2 2
MIRT636757 SLC16A5 solute carrier family 16 member 5 2 2
MIRT637136 BAMBI BMP and activin membrane bound inhibitor 2 2
MIRT637190 ROMO1 reactive oxygen species modulator 1 2 2
MIRT637290 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT637535 RGS9BP regulator of G protein signaling 9 binding protein 2 2
MIRT637695 CEP89 centrosomal protein 89 2 2
MIRT637790 OLA1 Obg like ATPase 1 2 2
MIRT637927 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT638451 PLXDC2 plexin domain containing 2 2 2
MIRT640674 ARSK arylsulfatase family member K 2 2
MIRT642645 PTGR2 prostaglandin reductase 2 2 2
MIRT643084 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT644238 SLC35E3 solute carrier family 35 member E3 2 2
MIRT644667 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT645094 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT645995 ACP6 acid phosphatase 6, lysophosphatidic 2 2
MIRT646510 FAM217B family with sequence similarity 217 member B 2 2
MIRT647015 ADCY2 adenylate cyclase 2 3 2
MIRT647097 SEC23B Sec23 homolog B, coat complex II component 2 2
MIRT647716 NFX1 nuclear transcription factor, X-box binding 1 2 4
MIRT648042 FADS6 fatty acid desaturase 6 2 2
MIRT648512 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT648867 ABCA6 ATP binding cassette subfamily A member 6 2 2
MIRT649184 DNPEP aspartyl aminopeptidase 2 2
MIRT649662 TEP1 telomerase associated protein 1 2 2
MIRT651425 YME1L1 YME1 like 1 ATPase 2 2
MIRT651467 XIAP X-linked inhibitor of apoptosis 2 2
MIRT652400 TMEM40 transmembrane protein 40 2 2
MIRT652598 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT653225 SOX17 SRY-box 17 2 2
MIRT653693 SLC25A33 solute carrier family 25 member 33 2 2
MIRT654124 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT656472 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 2
MIRT658907 DPY19L4 dpy-19 like 4 2 2
MIRT661103 SPIB Spi-B transcription factor 2 2
MIRT661240 ARL17B ADP ribosylation factor like GTPase 17B 2 2
MIRT661293 LIN52 lin-52 DREAM MuvB core complex component 2 2
MIRT662237 PGBD4 piggyBac transposable element derived 4 2 2
MIRT662546 MTAP methylthioadenosine phosphorylase 2 2
MIRT662622 MCM8 minichromosome maintenance 8 homologous recombination repair factor 2 2
MIRT662738 LRRC3C leucine rich repeat containing 3C 2 2
MIRT662846 OMD osteomodulin 2 2
MIRT662909 MED18 mediator complex subunit 18 2 2
MIRT662958 JPH2 junctophilin 2 2 2
MIRT663342 ZNF74 zinc finger protein 74 2 2
MIRT663498 IYD iodotyrosine deiodinase 2 2
MIRT663525 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT663544 CCR6 C-C motif chemokine receptor 6 2 2
MIRT663905 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT663974 ZNF786 zinc finger protein 786 2 2
MIRT664352 C16orf45 chromosome 16 open reading frame 45 2 2
MIRT664419 TIGD6 tigger transposable element derived 6 2 2
MIRT664470 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT664959 PTCD3 pentatricopeptide repeat domain 3 2 2
MIRT664973 TDRD1 tudor domain containing 1 2 2
MIRT665023 ELK1 ELK1, ETS transcription factor 2 2
MIRT665201 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 2 2
MIRT665361 XKR4 XK related 4 2 2
MIRT665456 WDR17 WD repeat domain 17 2 2
MIRT666080 SSTR2 somatostatin receptor 2 2 2
MIRT666319 SLC16A10 solute carrier family 16 member 10 2 2
MIRT666488 SBNO1 strawberry notch homolog 1 2 2
MIRT666520 RNF170 ring finger protein 170 2 2
MIRT666698 RBM23 RNA binding motif protein 23 2 2
MIRT666764 RAB10 RAB10, member RAS oncogene family 2 2
MIRT667228 NFE2L1 nuclear factor, erythroid 2 like 1 2 2
MIRT667361 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT667476 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT667560 LRAT lecithin retinol acyltransferase 2 2
MIRT667750 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT668090 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT668121 GK5 glycerol kinase 5 (putative) 2 2
MIRT668168 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT668348 STXBP2 syntaxin binding protein 2 2 2
MIRT668511 ESYT2 extended synaptotagmin 2 2 2
MIRT669293 C17orf85 nuclear cap binding subunit 3 2 2
MIRT669549 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT669780 CNDP1 carnosine dipeptidase 1 2 2
MIRT669860 BROX BRO1 domain and CAAX motif containing 2 4
MIRT670019 TECPR1 tectonin beta-propeller repeat containing 1 2 2
MIRT670179 CCDC142 coiled-coil domain containing 142 2 2
MIRT671109 ZNF841 zinc finger protein 841 2 2
MIRT671353 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 2
MIRT671478 FLYWCH2 FLYWCH family member 2 2 2
MIRT671494 SLC38A9 solute carrier family 38 member 9 2 2
MIRT671555 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT671670 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT671927 PLEKHS1 pleckstrin homology domain containing S1 2 4
MIRT672198 F2 coagulation factor II, thrombin 2 2
MIRT672219 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT672254 SIK2 salt inducible kinase 2 2 2
MIRT672292 GP2 glycoprotein 2 2 2
MIRT672432 POLR2D RNA polymerase II subunit D 2 2
MIRT672599 NKPD1 NTPase KAP family P-loop domain containing 1 2 2
MIRT672903 KRBA2 KRAB-A domain containing 2 2 2
MIRT672960 ZNF655 zinc finger protein 655 2 2
MIRT673098 SYNPO2L synaptopodin 2 like 2 2
MIRT673174 TMEM56 transmembrane protein 56 2 2
MIRT673253 INO80 INO80 complex subunit 2 2
MIRT673298 RNF19B ring finger protein 19B 2 2
MIRT673577 KDELC2 KDEL motif containing 2 2 2
MIRT673739 TCF23 transcription factor 23 2 2
MIRT674029 ANKRD9 ankyrin repeat domain 9 2 2
MIRT674284 NAGK N-acetylglucosamine kinase 2 2
MIRT674340 KCMF1 potassium channel modulatory factor 1 2 2
MIRT674395 MYCBP MYC binding protein 2 2
MIRT674521 PRR23A proline rich 23A 2 2
MIRT675146 MOGAT1 monoacylglycerol O-acyltransferase 1 2 4
MIRT676027 C9orf69 transmembrane protein 250 2 2
MIRT676432 PLEKHM3 pleckstrin homology domain containing M3 2 2
MIRT676598 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 2 2
MIRT678757 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 2
MIRT680346 ZNF281 zinc finger protein 281 2 2
MIRT680469 C3 complement C3 2 2
MIRT682828 FLG2 filaggrin family member 2 2 2
MIRT682883 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT684406 TMEM180 major facilitator superfamily domain containing 13A 2 2
MIRT685277 KIAA1143 KIAA1143 2 2
MIRT686063 KCNA7 potassium voltage-gated channel subfamily A member 7 2 2
MIRT693892 C3orf62 chromosome 3 open reading frame 62 2 2
MIRT699344 SLC35E1 solute carrier family 35 member E1 2 2
MIRT699911 RUNDC1 RUN domain containing 1 2 2
MIRT700809 PHLDA2 pleckstrin homology like domain family A member 2 2 2
MIRT701809 MRPS25 mitochondrial ribosomal protein S25 2 2
MIRT702176 LYRM4 LYR motif containing 4 2 2
MIRT702297 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT704064 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT706209 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT706631 PNPT1 polyribonucleotide nucleotidyltransferase 1 2 2
MIRT706662 RNF216 ring finger protein 216 2 2
MIRT706684 COL13A1 collagen type XIII alpha 1 chain 2 2
MIRT706707 GPR155 G protein-coupled receptor 155 2 2
MIRT706779 ANKRD36 ankyrin repeat domain 36 2 2
MIRT706846 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 2 2
MIRT706865 MAFF MAF bZIP transcription factor F 2 2
MIRT706898 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 2 2
MIRT706919 THAP6 THAP domain containing 6 2 2
MIRT706964 FANCC Fanconi anemia complementation group C 2 2
MIRT706982 XPO5 exportin 5 2 2
MIRT707017 RRP36 ribosomal RNA processing 36 2 2
MIRT707034 ACTR5 ARP5 actin related protein 5 homolog 2 2
MIRT707074 MED29 mediator complex subunit 29 2 2
MIRT709370 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 2 2
MIRT709584 ITPA inosine triphosphatase 2 2
MIRT709692 CUBN cubilin 2 2
MIRT711485 GDF7 growth differentiation factor 7 2 2
MIRT713577 SLC2A8 solute carrier family 2 member 8 2 2
MIRT722798 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 2 3
MIRT724200 MED7 mediator complex subunit 7 2 2
MIRT736146 GRB2 growth factor receptor bound protein 2 1 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-31 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-31 5-aza-2'-deoxycytidine (5-Aza-CdR) + trichostatin A(TSA) NULL NULL Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-31 Trichostatin A (TSA) NULL 444732 Microarray Pancreatic Cancer MiaPACA-2 cells 19407485 2009 up-regulated
miR-31 5-Fluorouracil approved 3385 Microarray HCT-116 colon cancer cell line 19956872 2010 down-regulated
miR-31 Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 down-regulated
miR-31 Doxorubicin approved 31703 Microarray heart 22859947 2012 up-regulated
miR-31 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Quantitative real-time PCR thymus 23024791 2012 down-regulated
miR-31 Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 up-regulated
miR-31 Budesonide approved 5281004 Microarray neonatal mice liver 20145010 2010 down-regulated
miR-31 Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice liver 20145010 2010 down-regulated
miR-31 Leptin NULL NULL Quantitative real-time PCR muscles 20800581 2010 up-regulated
miR-31 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 down-regulated
miR-31 Longevinex NULL NULL Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-31 Longevinex NULL NULL Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-31 Resveratrol NULL 445154 Quantitative real-time PCR ischemia/reperfusion [I/R] rat model 21203465 2011 down-regulated
miR-31 Resveratrol NULL 445154 Quantitative real-time PCR normal heart 21203465 2011 up-regulated
miR-31 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-31 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-31 Calcium sulfate (CaS) NULL 24497 Microarray MG63E osteoblast-like cells 17618507 2008 down-regulated
miR-31 Valproate approved 3121 Quantitative real-time PCR CD4+, CD25- T cells 20427269 2010 down-regulated
miR-31 Enoxacin approved 3229 Quantitative real-time PCR HCT-116 and RKO colon cancer cell lines 21368194 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-31 Tamoxifen 2733525 NSC180973 approved sensitive Low Breast Cancer cell line (MCF-7, T47D)
hsa-mir-31 Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (HepG2, SK-HEP-1)
hsa-mir-31 Cisplatin 5460033 NSC119875 approved sensitive High Lung Adenocarcinoma cell line (A549)
hsa-mir-31 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-31 Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-mir-31 Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-mir-31 Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-31 Cisplatin 5460033 NSC119875 approved sensitive cell line (W1)
hsa-mir-31 Methotrexate 126941 NSC740 approved sensitive cell line (W1)
hsa-mir-31 Topotecan 60699 NSC609699 approved sensitive cell line (W1)
hsa-mir-31 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-mir-31 Androstenedione 6128 NSC9563 resistant cell line (MCF-7)
hsa-mir-31 Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-31 Cisplatin 5460033 NSC119875 approved resistant cell line (KYSE)
hsa-mir-31 Tamoxifen 2733525 NSC180973 approved sensitive cell line (MCF7)
hsa-mir-3135b Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-3135b Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-3135b Fulvestrant 17756771 NSC719276 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-3135b Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-3135b Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer cell line (PC-9)
hsa-miR-3135b Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (HT-29)
hsa-miR-3135b Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-3135b Paclitaxel 36314 NSC125973 approved resistant High Endometrial Serous Carcinoma cell line (USPC1)
hsa-mir-3135b Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-3135b Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-3135b Topotecan 60699 NSC609699 approved resistant cell line (W1)
hsa-mir-3135b Androstenedione 6128 NSC9563 resistant cell line (MCF-7)
hsa-mir-3135b Androstenedione+Letrozole resistant cell line (MCF-7)
hsa-mir-3135b Tamoxifen 2733525 NSC180973 approved resistant cell line (MCF7)
hsa-mir-3135b Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-3135b Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (cytosolic RNA)
hsa-miR-3135b Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-3135b Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-3135b Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-3135b Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-3135b Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-3135b Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-3135b Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-3135b Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)

Error report submission