miRTarBase - #MIRT366312


—
pre-miRNA Information
pre-miRNA hsa-mir-2467   
Genomic Coordinates chr2: 239351724 - 239351804
Description Homo sapiens miR-2467 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-2467-3p
Sequence 52| AGCAGAGGCAGAGAGGCUCAGG |73
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1229163654 1 dbSNP
rs1276897169 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GDI1   
Synonyms 1A, GDIL, MRX41, MRX48, OPHN2, RABGD1A, RABGDIA, XAP-4
Description GDP dissociation inhibitor 1
Transcript NM_001493   
Expression
Putative miRNA Targets on GDI1
3'UTR of GDI1
(miRNA target sites are highlighted)		 
>GDI1|NM_001493|3'UTR
   1 TTGTGGCCGCCCCCAGCCCCTGCTGCCCCAGCCTGTGTCTGTTCTCCTCGAGGGCTCCAGCATCCTCTGCTTCCCCCACC
  81 ACGTTCCCATCACCCACCTCATTGATCCACTGACCAAATCCTTAACCCTAGCGATGGCTTGGGAGATGGGGGGTTGGATA
 161 GCATCCTCTTTCTTGGCCCTTCCTTATCCTAGGAAAAGAGGGTTCCTCTCCTTGTGTGTGTCTCTTCCCCCCACCCCTAA
 241 TTCTTCTGCTCTGTTTGGGAAGACGTGGAGGAAAAGGTGACTTCTGCCCCCACCGCTCTTACCCCCACTGTAGTGGCCTT
 321 TGGAGATGCCCCCACCTCCCCCCCACCAACTCTCGCGTGTTGGAGAGAAGGGGCCCTCCCAGCACAAAGTTGCATTCCTC
 401 CCCCCTAATTTATTCTAATTTATTAACTTTGACCCACCCTTTCTGAGCCTGCAGCCTTCCCGTGTGGCCTGAGGGCTGTC
 481 GAGTGAGCTGCCCCAGCCCCTCCCAGCCCTTGCCCAGCCTGGGGGAGTGGGGAAGGCTTGGGCATGGCCCCGTTGGAGGT
 561 TGATTTGCTGTTTTGTTTCTTGTCTTTGTGTTCTGTGGTACTTGCTGAGAGAAAAGAAAAGTGAGCCAAGCAGAAGGAGG
 641 TGGGAAAACGGACCCAAACCCCAGTGTGCCCTGCCCCATGCCTTTCCTTTAGTGGTGGGAAACCCTTATCTTGCAAAGTG
 721 AATGTGTCCCCTTCCCCACCCTCTAGTGTATTTCACAGAAAACAAAACCTCCCAATAAAACGGTTGAAACCTGAAAAAAA
 801 AAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ggaCUCGGAG-AGACGGAGACGa 5'
             |:||: |  |  ||||||| 
Target 5' cgaGGGCTCCAGCATCCTCTGCt 3'
 49 - 71 147.00 -17.70
2 
miRNA  3' ggacucGGAGA-GACGGAGACGa 5'
                || ||  | |:||||| 
Target 5' cccccaCCCCTAATTCTTCTGCt 3'
 228 - 250 132.00 -14.20
3 
miRNA  3' ggacucggagagAC-GGAGACGa 5'
                      || |:||||| 
Target 5' tggaggaaaaggTGACTTCTGCc 3'
 266 - 288 126.00 -10.12
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs782048019 2 dbSNP
rs782763010 11 dbSNP
rs55736938 19 dbSNP
rs782516329 26 dbSNP
rs975427398 28 dbSNP
rs782632974 30 dbSNP
rs782813979 44 dbSNP
rs955433519 45 dbSNP
rs190219027 47 dbSNP
rs7059013 49 dbSNP
rs782473573 50 dbSNP
rs1380695549 65 dbSNP
rs1336574825 83 dbSNP
rs782706979 84 dbSNP
rs1401828749 87 dbSNP
rs1387536998 102 dbSNP
rs781811623 107 dbSNP
rs1157170676 108 dbSNP
rs990330063 116 dbSNP
rs1453546653 120 dbSNP
rs1362847380 122 dbSNP
rs1183836992 128 dbSNP
rs1240756763 134 dbSNP
rs914709819 136 dbSNP
rs1447485694 142 dbSNP
rs1203160231 148 dbSNP
rs1286304286 148 dbSNP
rs1349765057 156 dbSNP
rs1292704356 160 dbSNP
rs1248454703 166 dbSNP
rs1380626682 166 dbSNP
rs1314489217 168 dbSNP
rs1431637035 169 dbSNP
rs1328676634 183 dbSNP
rs946452926 184 dbSNP
rs1316912657 186 dbSNP
rs1381951049 189 dbSNP
rs782152934 192 dbSNP
rs1163780240 207 dbSNP
rs782815711 209 dbSNP
rs1426184096 213 dbSNP
rs1383050888 216 dbSNP
rs879970914 223 dbSNP
rs904934005 225 dbSNP
rs939061155 228 dbSNP
rs183216290 233 dbSNP
rs1243765716 234 dbSNP
rs1190959110 237 dbSNP
rs1446147143 245 dbSNP
rs1269376359 252 dbSNP
rs1224947662 257 dbSNP
rs1056517840 259 dbSNP
rs887051731 260 dbSNP
rs1357526551 265 dbSNP
rs1291369341 266 dbSNP
rs1215237074 269 dbSNP
rs1341576109 273 dbSNP
rs1004059788 275 dbSNP
rs1227382553 279 dbSNP
rs1016723483 285 dbSNP
rs898371809 287 dbSNP
rs1403528451 290 dbSNP
rs1363321859 293 dbSNP
rs781867947 295 dbSNP
rs1028435098 297 dbSNP
rs1409987257 299 dbSNP
rs1421034377 302 dbSNP
rs955623575 303 dbSNP
rs1477468641 307 dbSNP
rs1429967671 310 dbSNP
rs1201279865 320 dbSNP
rs1489818271 327 dbSNP
rs1268376681 335 dbSNP
rs1205492096 338 dbSNP
rs1439593865 338 dbSNP
rs986836950 341 dbSNP
rs782470523 343 dbSNP
rs1285821840 345 dbSNP
rs1222049796 346 dbSNP
rs868982656 355 dbSNP
rs1442532251 356 dbSNP
rs782608366 357 dbSNP
rs1464684803 358 dbSNP
rs990361323 371 dbSNP
rs914825698 373 dbSNP
rs1479294637 405 dbSNP
rs781789172 406 dbSNP
rs1063371 416 dbSNP
rs1424239716 423 dbSNP
rs970248782 424 dbSNP
rs1177948797 431 dbSNP
rs1471267500 435 dbSNP
rs980254752 436 dbSNP
rs1231430270 439 dbSNP
rs782603998 443 dbSNP
rs11549303 444 dbSNP
rs1461873245 461 dbSNP
rs939077085 462 dbSNP
rs782715555 463 dbSNP
rs1323232659 468 dbSNP
rs782440002 478 dbSNP
rs1225883044 479 dbSNP
rs782668861 481 dbSNP
rs1277481800 482 dbSNP
rs1382890767 490 dbSNP
rs782290807 492 dbSNP
rs1468188961 494 dbSNP
rs1358554429 496 dbSNP
rs1159520544 506 dbSNP
rs11549302 508 dbSNP
rs113193055 513 dbSNP
rs1038292161 525 dbSNP
rs1406042736 527 dbSNP
rs1178267627 536 dbSNP
rs1445246012 545 dbSNP
rs898401330 552 dbSNP
rs1182237955 553 dbSNP
rs1243241406 556 dbSNP
rs1218379462 575 dbSNP
rs1315566152 582 dbSNP
rs1281631081 583 dbSNP
rs1239014933 589 dbSNP
rs1359471762 602 dbSNP
rs782369773 603 dbSNP
rs1449882425 606 dbSNP
rs1289428995 607 dbSNP
rs996665101 614 dbSNP
rs1049998994 617 dbSNP
rs1343224419 635 dbSNP
rs1425562926 638 dbSNP
rs1387372106 639 dbSNP
rs782656600 642 dbSNP
rs1423387239 643 dbSNP
rs1008689429 662 dbSNP
rs1263031109 665 dbSNP
rs1031679622 677 dbSNP
rs1188815839 685 dbSNP
rs1485073693 686 dbSNP
rs1262947100 688 dbSNP
rs1223752135 691 dbSNP
rs1490402320 693 dbSNP
rs1293572343 704 dbSNP
rs1241963434 705 dbSNP
rs782219682 705 dbSNP
rs782386174 715 dbSNP
rs782370077 719 dbSNP
rs1216292267 729 dbSNP
rs1359548997 731 dbSNP
rs1297335803 732 dbSNP
rs111431799 740 dbSNP
rs1011581229 741 dbSNP
rs1049729 747 dbSNP
rs781927333 748 dbSNP
rs1301587197 758 dbSNP
rs1457422389 761 dbSNP
rs782672995 763 dbSNP
rs970283115 767 dbSNP
rs980277679 774 dbSNP
rs1173103013 775 dbSNP
rs928770307 776 dbSNP
rs1423595778 778 dbSNP
rs1200595109 782 dbSNP
rs1481654738 783 dbSNP
rs1270513731 794 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ggaCUCGGAG-AGACGGAGACGa 5'
             |:||: |  |  ||||||| 
Target 5' --aGGGCUCCAGCAUCCUCUGCu 3'
 		1 - 21
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 2664.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ggaCUCGGAG-AGACGGAGACGa 5'
             |:||: |  |  ||||||| 
Target 5' --aGGGCUCCAGCAUCCUCUGCu 3'
 		1 - 21
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000447750.2 | 3UTR | AGGGCUCCAGCAUCCUCUGCUUCCCCCACCAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000447750.2 | 3UTR | AGGGCUCCAGCAUCCUCUGCUUCCCCCACCACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
251 hsa-miR-2467-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT114121 AGO1 argonaute 1, RISC catalytic component 2 2
MIRT145356 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT150206 MIDN midnolin 2 2
MIRT159200 NRBP1 nuclear receptor binding protein 1 2 2
MIRT185797 ZNF678 zinc finger protein 678 2 2
MIRT194249 FAM103A1 family with sequence similarity 103 member A1 2 6
MIRT200722 ZNF473 zinc finger protein 473 2 4
MIRT273612 SP1 Sp1 transcription factor 2 2
MIRT332778 CAPRIN1 cell cycle associated protein 1 2 4
MIRT334115 PPP6R3 protein phosphatase 6 regulatory subunit 3 2 2
MIRT343119 IGF1R insulin like growth factor 1 receptor 2 2
MIRT353944 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 2
MIRT354681 CDV3 CDV3 homolog 2 2
MIRT366312 GDI1 GDP dissociation inhibitor 1 2 4
MIRT377073 SLC35F6 solute carrier family 35 member F6 2 2
MIRT404276 PLEKHA8 pleckstrin homology domain containing A8 2 2
MIRT441762 PLA2G5 phospholipase A2 group V 2 2
MIRT442502 OSBP oxysterol binding protein 2 2
MIRT449143 UQCRB ubiquinol-cytochrome c reductase binding protein 2 2
MIRT449946 FMNL3 formin like 3 2 4
MIRT451309 LGALS3BP galectin 3 binding protein 2 2
MIRT451344 ZNF573 zinc finger protein 573 2 2
MIRT451546 CIAPIN1 cytokine induced apoptosis inhibitor 1 2 2
MIRT451977 FKBP5 FK506 binding protein 5 2 2
MIRT452212 HAVCR1 hepatitis A virus cellular receptor 1 2 8
MIRT452279 CARD8 caspase recruitment domain family member 8 2 2
MIRT452343 TG thyroglobulin 2 2
MIRT452394 TTC39B tetratricopeptide repeat domain 39B 2 2
MIRT452514 TFDP2 transcription factor Dp-2 2 6
MIRT452527 PGAM5 PGAM family member 5, mitochondrial serine/threonine protein phosphatase 2 2
MIRT453024 ZNF527 zinc finger protein 527 2 4
MIRT453678 GEMIN6 gem nuclear organelle associated protein 6 2 2
MIRT453905 GABRR2 gamma-aminobutyric acid type A receptor rho2 subunit 2 4
MIRT454568 NT5DC3 5'-nucleotidase domain containing 3 2 2
MIRT455210 GNL1 G protein nucleolar 1 (putative) 2 2
MIRT455239 PLP2 proteolipid protein 2 2 2
MIRT455934 SURF6 surfeit 6 2 2
MIRT456658 TIFA TRAF interacting protein with forkhead associated domain 2 2
MIRT456994 ZNF669 zinc finger protein 669 2 2
MIRT457314 DUSP19 dual specificity phosphatase 19 2 4
MIRT457543 ZC3H6 zinc finger CCCH-type containing 6 2 2
MIRT457641 ZNF69 zinc finger protein 69 2 2
MIRT458152 LYRM4 LYR motif containing 4 2 6
MIRT458184 ATP6V0A2 ATPase H+ transporting V0 subunit a2 2 4
MIRT458347 NOC2L NOC2 like nucleolar associated transcriptional repressor 2 2
MIRT458558 C10orf71 chromosome 10 open reading frame 71 2 2
MIRT458616 TRIM72 tripartite motif containing 72 2 4
MIRT458794 CYP8B1 cytochrome P450 family 8 subfamily B member 1 2 2
MIRT458892 PFAS phosphoribosylformylglycinamidine synthase 2 6
MIRT459148 NARF nuclear prelamin A recognition factor 2 4
MIRT459176 HSPA6 heat shock protein family A (Hsp70) member 6 2 4
MIRT459221 MRPS21 mitochondrial ribosomal protein S21 2 2
MIRT459399 MPLKIP M-phase specific PLK1 interacting protein 2 4
MIRT459427 FAM83B family with sequence similarity 83 member B 2 2
MIRT459548 BTD biotinidase 2 2
MIRT460035 CDCP1 CUB domain containing protein 1 2 4
MIRT460244 IL17RB interleukin 17 receptor B 2 4
MIRT460377 GUF1 GUF1 homolog, GTPase 2 4
MIRT460966 STK17B serine/threonine kinase 17b 2 2
MIRT461039 DCPS decapping enzyme, scavenger 2 4
MIRT461136 ZNF264 zinc finger protein 264 2 2
MIRT461201 TIPIN TIMELESS interacting protein 2 2
MIRT461394 SLFN12L schlafen family member 12 like 2 10
MIRT461433 ACSBG1 acyl-CoA synthetase bubblegum family member 1 2 2
MIRT461501 NEDD4L neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase 2 2
MIRT461771 MPDU1 mannose-P-dolichol utilization defect 1 2 2
MIRT462396 RBM28 RNA binding motif protein 28 2 2
MIRT462484 GSR glutathione-disulfide reductase 2 4
MIRT462612 C20orf27 chromosome 20 open reading frame 27 2 4
MIRT462802 NTN1 netrin 1 2 2
MIRT462859 CYP51A1 cytochrome P450 family 51 subfamily A member 1 2 2
MIRT462909 ZNRF3 zinc and ring finger 3 2 2
MIRT463017 ZNF70 zinc finger protein 70 2 2
MIRT463067 ZNF639 zinc finger protein 639 2 2
MIRT463274 ZFX zinc finger protein, X-linked 2 2
MIRT463354 ZFAND4 zinc finger AN1-type containing 4 2 2
MIRT464016 WBP2 WW domain binding protein 2 2 2
MIRT464441 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 2 2
MIRT464763 UBE2G1 ubiquitin conjugating enzyme E2 G1 2 2
MIRT464865 UBB ubiquitin B 2 8
MIRT464955 TWIST1 twist family bHLH transcription factor 1 2 2
MIRT465328 TPM3 tropomyosin 3 2 2
MIRT465626 TNRC6A trinucleotide repeat containing 6A 2 10
MIRT467085 SRRD SRR1 domain containing 2 2
MIRT467251 SPPL2A signal peptide peptidase like 2A 2 2
MIRT467379 SON SON DNA binding protein 2 4
MIRT468740 SDC2 syndecan 2 2 2
MIRT469291 RHOA ras homolog family member A 2 2
MIRT469960 PTPRF protein tyrosine phosphatase, receptor type F 2 8
MIRT470650 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT471234 PHAX phosphorylated adaptor for RNA export 2 2
MIRT471313 PGAM4 phosphoglycerate mutase family member 4 2 2
MIRT471410 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT471645 PANK2 pantothenate kinase 2 2 4
MIRT471933 NRAS NRAS proto-oncogene, GTPase 2 2
MIRT472102 NME2 NME/NM23 nucleoside diphosphate kinase 2 2 2
MIRT472119 NME1-NME2 NME1-NME2 readthrough 2 2
MIRT472183 NHP2L1 small nuclear ribonucleoprotein 13 2 2
MIRT472394 NDRG3 NDRG family member 3 2 2
MIRT472496 NACC2 NACC family member 2 2 2
MIRT473014 MRPS14 mitochondrial ribosomal protein S14 2 2
MIRT474162 LGSN lengsin, lens protein with glutamine synthetase domain 2 2
MIRT474305 LAMC1 laminin subunit gamma 1 2 2
MIRT474780 KIAA0895L KIAA0895 like 2 2
MIRT475288 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT476400 GDE1 glycerophosphodiester phosphodiesterase 1 2 8
MIRT477167 FABP3 fatty acid binding protein 3 2 2
MIRT477699 EFHD2 EF-hand domain family member D2 2 4
MIRT478298 DDX19A DEAD-box helicase 19A 2 6
MIRT478390 DCTN5 dynactin subunit 5 2 2
MIRT478850 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT478904 CPSF7 cleavage and polyadenylation specific factor 7 2 6
MIRT478935 CPA4 carboxypeptidase A4 2 2
MIRT479538 CDC5L cell division cycle 5 like 2 4
MIRT479729 CCNF cyclin F 2 2
MIRT480723 BPTF bromodomain PHD finger transcription factor 2 6
MIRT480862 BHLHB9 basic helix-loop-helix family member b9 2 2
MIRT481632 ARF1 ADP ribosylation factor 1 2 2
MIRT481705 AR androgen receptor 2 2
MIRT481737 APH1A aph-1 homolog A, gamma-secretase subunit 2 2
MIRT481995 AMOTL2 angiomotin like 2 2 2
MIRT482492 ACTR1A ARP1 actin related protein 1 homolog A 2 2
MIRT482569 ABHD2 abhydrolase domain containing 2 2 2
MIRT484316 KCNH1 potassium voltage-gated channel subfamily H member 1 2 4
MIRT485696 CCDC64 BICD family like cargo adaptor 1 2 2
MIRT487010 C2orf82 chromosome 2 open reading frame 82 2 2
MIRT488370 LBX1 ladybird homeobox 1 2 4
MIRT488736 ASGR2 asialoglycoprotein receptor 2 2 4
MIRT488917 PTGES prostaglandin E synthase 2 2
MIRT489106 ABCC5 ATP binding cassette subfamily C member 5 2 4
MIRT489511 CRLF3 cytokine receptor like factor 3 2 4
MIRT489624 ALS2CL ALS2 C-terminal like 2 2
MIRT490210 SLC37A2 solute carrier family 37 member 2 2 4
MIRT491271 DHX40 DEAH-box helicase 40 2 2
MIRT492083 TCF21 transcription factor 21 2 2
MIRT493371 KIAA1614 KIAA1614 2 2
MIRT495768 ZNF546 zinc finger protein 546 2 2
MIRT495868 SLC29A2 solute carrier family 29 member 2 2 2
MIRT498281 PADI2 peptidyl arginine deiminase 2 2 2
MIRT499162 EYA3 EYA transcriptional coactivator and phosphatase 3 2 2
MIRT499922 GPX8 glutathione peroxidase 8 (putative) 2 2
MIRT500171 CHRM3 cholinergic receptor muscarinic 3 2 2
MIRT501368 REXO1 RNA exonuclease 1 homolog 2 2
MIRT506928 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 6
MIRT507349 FAM129A family with sequence similarity 129 member A 2 6
MIRT507836 CCNT1 cyclin T1 2 2
MIRT508285 YES1 YES proto-oncogene 1, Src family tyrosine kinase 2 4
MIRT509355 COPS8 COP9 signalosome subunit 8 2 2
MIRT510893 RAB1A RAB1A, member RAS oncogene family 2 4
MIRT511886 GAS1 growth arrest specific 1 2 6
MIRT511992 E2F1 E2F transcription factor 1 2 4
MIRT512245 ARPP19 cAMP regulated phosphoprotein 19 2 4
MIRT514087 EPS15L1 epidermal growth factor receptor pathway substrate 15 like 1 2 6
MIRT514361 UBBP4 ubiquitin B pseudogene 4 2 6
MIRT517408 BMP8A bone morphogenetic protein 8a 2 2
MIRT522967 IPO5 importin 5 2 2
MIRT523151 HNRNPU heterogeneous nuclear ribonucleoprotein U 2 2
MIRT523965 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT526336 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT530886 PHOX2A paired like homeobox 2a 2 2
MIRT533255 VCAM1 vascular cell adhesion molecule 1 2 2
MIRT533514 TRIM66 tripartite motif containing 66 2 2
MIRT537041 GRAMD4 GRAM domain containing 4 2 2
MIRT537920 DSTYK dual serine/threonine and tyrosine protein kinase 2 2
MIRT540854 NUP155 nucleoporin 155 2 2
MIRT546352 SYNM synemin 2 2
MIRT547802 JARID2 jumonji and AT-rich interaction domain containing 2 2 2
MIRT547850 IFNAR2 interferon alpha and beta receptor subunit 2 2 4
MIRT551690 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT552386 ZNF526 zinc finger protein 526 2 2
MIRT555986 NFYB nuclear transcription factor Y subunit beta 2 2
MIRT557946 FAM222B family with sequence similarity 222 member B 2 2
MIRT559736 ACOX1 acyl-CoA oxidase 1 2 2
MIRT559966 PARP2 poly(ADP-ribose) polymerase 2 2 2
MIRT562721 ZNF714 zinc finger protein 714 2 2
MIRT562832 GCFC2 GC-rich sequence DNA-binding factor 2 2 2
MIRT564046 NDUFA7 NADH:ubiquinone oxidoreductase subunit A7 2 2
MIRT565336 TMEM104 transmembrane protein 104 2 2
MIRT571461 CHMP4B charged multivesicular body protein 4B 2 2
MIRT572013 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT614454 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT639478 SLC6A4 solute carrier family 6 member 4 2 2
MIRT643347 SYNJ2 synaptojanin 2 2 2
MIRT644060 IQCE IQ motif containing E 2 2
MIRT651659 VWA1 von Willebrand factor A domain containing 1 2 2
MIRT651867 UNC119B unc-119 lipid binding chaperone B 2 2
MIRT657481 HCAR2 hydroxycarboxylic acid receptor 2 2 2
MIRT657987 GAN gigaxonin 2 2
MIRT658376 FAM53C family with sequence similarity 53 member C 2 2
MIRT664295 HINT1 histidine triad nucleotide binding protein 1 2 2
MIRT675357 KLHL26 kelch like family member 26 2 2
MIRT680612 KIAA0391 KIAA0391 2 2
MIRT680642 KIAA1456 KIAA1456 2 2
MIRT680714 PCCB propionyl-CoA carboxylase beta subunit 2 2
MIRT680728 PRICKLE1 prickle planar cell polarity protein 1 2 2
MIRT680905 SCN3B sodium voltage-gated channel beta subunit 3 2 2
MIRT681171 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT681244 ZNF383 zinc finger protein 383 2 2
MIRT681372 VHLL VHL like 2 2
MIRT681439 CIITA class II major histocompatibility complex transactivator 2 2
MIRT681461 PLA2G16 phospholipase A2 group XVI 2 2
MIRT681620 F2RL2 coagulation factor II thrombin receptor like 2 2 2
MIRT681638 SCRG1 stimulator of chondrogenesis 1 2 2
MIRT681674 COX18 COX18, cytochrome c oxidase assembly factor 2 2
MIRT681921 KAT7 lysine acetyltransferase 7 2 2
MIRT681960 TFCP2 transcription factor CP2 2 2
MIRT681978 HRH4 histamine receptor H4 2 2
MIRT682007 ATP5S ATP synthase, H+ transporting, mitochondrial Fo complex subunit s (factor B) 2 2
MIRT682046 MRPS10 mitochondrial ribosomal protein S10 2 2
MIRT682059 B4GALT7 beta-1,4-galactosyltransferase 7 2 4
MIRT682120 THBS1 thrombospondin 1 2 2
MIRT682150 SMS spermine synthase 2 2
MIRT682198 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT682428 NRXN3 neurexin 3 2 2
MIRT682462 MCUR1 mitochondrial calcium uniporter regulator 1 2 2
MIRT682493 KATNAL1 katanin catalytic subunit A1 like 1 2 2
MIRT683197 PABPC1 poly(A) binding protein cytoplasmic 1 2 2
MIRT683587 GSTCD glutathione S-transferase C-terminal domain containing 2 2
MIRT686072 PTK6 protein tyrosine kinase 6 2 2
MIRT687573 MAU2 MAU2 sister chromatid cohesion factor 2 2
MIRT688786 CCNB1 cyclin B1 2 2
MIRT689379 ZNF850 zinc finger protein 850 2 2
MIRT689551 XPO6 exportin 6 2 2
MIRT690547 GNG4 G protein subunit gamma 4 2 2
MIRT690638 PSD4 pleckstrin and Sec7 domain containing 4 2 2
MIRT691191 NIF3L1 NGG1 interacting factor 3 like 1 2 2
MIRT691977 PLCXD1 phosphatidylinositol specific phospholipase C X domain containing 1 2 2
MIRT693574 PIGR polymeric immunoglobulin receptor 2 2
MIRT694000 PPIL4 peptidylprolyl isomerase like 4 2 2
MIRT694230 ZNF749 zinc finger protein 749 2 2
MIRT695227 SCAMP3 secretory carrier membrane protein 3 2 2
MIRT695280 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 2 2
MIRT695686 ATP6V0D2 ATPase H+ transporting V0 subunit d2 2 2
MIRT695736 ZNF117 zinc finger protein 117 2 2
MIRT696358 EIF2S3 eukaryotic translation initiation factor 2 subunit gamma 2 2
MIRT696380 SLC27A1 solute carrier family 27 member 1 2 2
MIRT696994 CCDC80 coiled-coil domain containing 80 2 2
MIRT700710 PNO1 partner of NOB1 homolog 2 2
MIRT702834 HOOK3 hook microtubule tethering protein 3 2 2
MIRT703541 FKBP15 FK506 binding protein 15 2 2
MIRT704065 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT705056 C5orf15 chromosome 5 open reading frame 15 2 2
MIRT705186 BTG1 BTG anti-proliferation factor 1 2 2
MIRT705386 ATP1B3 ATPase Na+/K+ transporting subunit beta 3 2 2
MIRT706173 ZNF716 zinc finger protein 716 2 2
MIRT706483 SNX27 sorting nexin family member 27 2 2
MIRT709411 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT709832 PAQR7 progestin and adipoQ receptor family member 7 2 2
MIRT712428 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT721056 DCC DCC netrin 1 receptor 2 2
MIRT756002 FZD4 frizzled class receptor 4 4 1
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-2467 Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-mir-2467 Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-mir-2467 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-2467 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-2467-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CP20)
hsa-miR-2467-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-2467-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-2467-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-2467-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-2467-3p Docetaxel+Cisplatin+5-Fluorouracil resistant tissue (hypopharyngeal squamous cell carcinoma)
hsa-miR-2467-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVSAHO)

Error report submission