>PEBP1|NM_002567|3'UTR
   1 GGGGTTAGCTTGGGGACCTGAACTGTCCTGGAGGCCCCAAGCCATGTTCCCCAGTTCAGTGTTGCATGTATAATAGATTT
  81 CTCCTCTTCCTGCCCCCCTTGGCATGGGTGAGACCTGACCAGTCAGATGGTAGTTGAGGGTGACTTTTCCTGCTGCCTGG
 161 CCTTTATAATTTTACTCACTCACTCTGATTTATGTTTTGATCAAATTTGAACTTCATTTTGGGGGGTATTTTGGTACTGT
 241 GATGGGGTCATCAAATTATTAATCTGAAAATAGCAACCCAGAATGTAAAAAAGAAAAAACTGGGGGGAAAAAGACCAGGT
 321 CTACAGTGATAGAGCAAAGCATCAAAGAATCTTTAAGGGAGGTTTAAAAAAAAAAAAAAAAAAAAAGATTGGTTGCCTCT
 401 GCCTTTGTGATCCTGAGTCCAGAATGGTACACAATGTGATTTTATGGTGATGTCACTCACCTAGACAACCAGAGGCTGGC
 481 ATTGAGGCTAACCTCCAACACAGTGCATCTCAGATGCCTCAGTAGGCATCAGTATGTCACTCTGGTCCCTTTAAAGAGCA
 561 ATCCTGGAAGAAGCAGGAGGGAGGGTGGCTTTGCTGTTGTTGGGACATGGCAATCTAGACCGGTAGCAGCGCTCGCTGAC
 641 AGCTTGGGAGGAAACCTGAGATCTGTGTTTTTTAAATTGATCGTTCTTCATGGGGGTAAGAAAAGCTGGTCTGGAGTTGC
 721 TGAATGTTGCATTAATTGTGCTGTTTGCTTGTAGTTGAATAAAAATAGAAACCTGAATGAAGGAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ugAAAGGGAAGUCUCGGACCGa 5' |||:||| | ||||||| Target 5' acTTTTCCTGC--TGCCTGGCc 3'	143 - 162	160.00	-23.20
2	miRNA 3' ugaaagggaaGUCUCGGACCGa 5' ||||| ||||| Target 5' cctagacaacCAGAGGCTGGCa 3'	460 - 481	128.00	-16.50
3	miRNA 3' ugaaAGGGAAGUCUCGGACCga 5' || | | | |||:||| Target 5' gcgcTCGC-TGACAGCTTGGga 3'	629 - 649	117.00	-12.70

Mutant ID	Mutant Position	Mutant Source
COSN30123056	6	COSMIC
COSN30539645	24	COSMIC
COSN30482969	51	COSMIC
COSN4892141	52	COSMIC
COSN30464286	65	COSMIC
COSN31511746	76	COSMIC
COSN31557749	77	COSMIC
COSN30525080	82	COSMIC
COSN31574461	82	COSMIC
COSN29524399	264	COSMIC
COSN27211039	387	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1216009127	2	dbSNP
rs768702485	3	dbSNP
rs776912217	5	dbSNP
rs376087935	10	dbSNP
rs974361931	11	dbSNP
rs765377892	18	dbSNP
rs750516226	20	dbSNP
rs762982697	24	dbSNP
rs766486043	25	dbSNP
rs1441718072	26	dbSNP
rs370646691	30	dbSNP
rs751346130	32	dbSNP
rs754829304	33	dbSNP
rs13893	35	dbSNP
rs1188580749	36	dbSNP
rs1463897690	36	dbSNP
rs375333263	37	dbSNP
rs1170859122	39	dbSNP
rs936260155	41	dbSNP
rs1429975536	44	dbSNP
rs752418222	45	dbSNP
rs1414065659	47	dbSNP
rs755772247	48	dbSNP
rs771941690	49	dbSNP
rs777308603	49	dbSNP
rs748863144	52	dbSNP
rs1440311344	55	dbSNP
rs1301129974	76	dbSNP
rs932935406	83	dbSNP
rs756607181	84	dbSNP
rs1051083587	85	dbSNP
rs747036076	93	dbSNP
rs775297036	93	dbSNP
rs566181142	94	dbSNP
rs1435286157	95	dbSNP
rs1297478712	96	dbSNP
rs772553820	97	dbSNP
rs747303247	98	dbSNP
rs769092398	103	dbSNP
rs776665400	105	dbSNP
rs768040214	106	dbSNP
rs1053106814	108	dbSNP
rs190033546	121	dbSNP
rs769979542	122	dbSNP
rs754210626	124	dbSNP
rs1305027308	128	dbSNP
rs555037475	129	dbSNP
rs1347948598	134	dbSNP
rs1298604861	139	dbSNP
rs1212279637	140	dbSNP
rs1357081742	149	dbSNP
rs1285929771	154	dbSNP
rs1011328812	158	dbSNP
rs1445697501	163	dbSNP
rs773414641	175	dbSNP
rs1471445201	179	dbSNP
rs776253234	183	dbSNP
rs763142231	185	dbSNP
rs1157970867	186	dbSNP
rs1001645322	192	dbSNP
rs1419043967	196	dbSNP
rs1189644875	200	dbSNP
rs1418053792	201	dbSNP
rs151312052	215	dbSNP
rs867592991	216	dbSNP
rs1003234394	221	dbSNP
rs1454738715	221	dbSNP
rs537630753	225	dbSNP
rs1158043448	227	dbSNP
rs1279918441	238	dbSNP
rs1358529911	240	dbSNP
rs898527980	246	dbSNP
rs1035627086	248	dbSNP
rs1348692209	251	dbSNP
rs1407692078	266	dbSNP
rs140493981	275	dbSNP
rs1316329198	297	dbSNP
rs1051077	301	dbSNP
rs1389737941	303	dbSNP
rs886373615	309	dbSNP
rs1353282616	312	dbSNP
rs147065157	326	dbSNP
rs1803762	328	dbSNP
rs963159339	332	dbSNP
rs1156374929	344	dbSNP
rs1373327455	345	dbSNP
rs1018995741	348	dbSNP
rs1437045667	351	dbSNP
rs1051175	360	dbSNP
rs993609676	361	dbSNP
rs1161864652	366	dbSNP
rs1204641657	366	dbSNP
rs1261290390	366	dbSNP
rs1422458715	366	dbSNP
rs1486195003	366	dbSNP
rs767298850	366	dbSNP
rs879234482	366	dbSNP
rs1370867126	367	dbSNP
rs572796238	376	dbSNP
rs965757030	383	dbSNP
rs974500954	388	dbSNP
rs1381193901	393	dbSNP
rs1384991380	393	dbSNP
rs796300380	398	dbSNP
rs1051753509	400	dbSNP
rs1028657474	403	dbSNP
rs1456880293	423	dbSNP
rs1417773126	425	dbSNP
rs1333623083	432	dbSNP
rs1476359535	432	dbSNP
rs1211437913	433	dbSNP
rs1192690841	434	dbSNP
rs912830247	435	dbSNP
rs957223348	445	dbSNP
rs757906364	453	dbSNP
rs934621890	455	dbSNP
rs989843927	464	dbSNP
rs1208105695	466	dbSNP
rs1272457365	491	dbSNP
rs183317176	493	dbSNP
rs946341278	496	dbSNP
rs1232880030	504	dbSNP
rs1268070163	506	dbSNP
rs1226300639	523	dbSNP
rs893221568	535	dbSNP
rs981592123	545	dbSNP
rs947499771	550	dbSNP
rs1044197644	554	dbSNP
rs928821515	570	dbSNP
rs937405804	580	dbSNP
rs1803761	585	dbSNP
rs561797889	597	dbSNP
rs1002728479	598	dbSNP
rs1055848153	600	dbSNP
rs1394718510	614	dbSNP
rs898589157	618	dbSNP
rs187751153	622	dbSNP
rs1047076833	623	dbSNP
rs1475887221	624	dbSNP
rs1051470	625	dbSNP
rs564380079	628	dbSNP
rs533223417	632	dbSNP
rs369148106	635	dbSNP
rs1018727915	636	dbSNP
rs1224288007	655	dbSNP
rs1328093879	657	dbSNP
rs1469747638	660	dbSNP
rs1352748037	662	dbSNP
rs1270673174	666	dbSNP
rs565987198	669	dbSNP
rs1444305075	678	dbSNP
rs1195010297	679	dbSNP
rs534995548	683	dbSNP
rs995970892	684	dbSNP
rs1029129274	691	dbSNP
rs1369558368	692	dbSNP
rs1354610376	696	dbSNP
rs1443812828	717	dbSNP
rs974519302	725	dbSNP
rs1028755620	734	dbSNP
rs957159876	737	dbSNP
rs746926984	738	dbSNP
rs1019975216	750	dbSNP
rs564397593	755	dbSNP
rs967615796	773	dbSNP
rs113655132	777	dbSNP

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.