miRTarBase - #MIRT378521


—
pre-miRNA Information
pre-miRNA hsa-mir-6752   
Genomic Coordinates chr11: 67490245 - 67490315
Description Homo sapiens miR-6752 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6752-3p
Sequence 51| UCCCUGCCCCCAUACUCCCAG |71
Evidence Experimental
Experiments Meta-analysis
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs760443460 2 dbSNP
rs746450218 4 dbSNP
rs897972135 4 dbSNP
rs766020814 10 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CDKN1A   
Synonyms CAP20, CDKN1, CIP1, MDA-6, P21, SDI1, WAF1, p21CIP1
Description cyclin dependent kinase inhibitor 1A
Transcript NM_000389   
Other Transcripts NM_078467   
Expression
Putative miRNA Targets on CDKN1A
3'UTR of CDKN1A
(miRNA target sites are highlighted)		 
>CDKN1A|NM_000389|3'UTR
   1 TCCGCCCACAGGAAGCCTGCAGTCCTGGAAGCGCGAGGGCCTCAAAGGCCCGCTCTACATCTTCTGCCTTAGTCTCAGTT
  81 TGTGTGTCTTAATTATTATTTGTGTTTTAATTTAAACACCTCCTCATGTACATACCCTGGCCGCCCCCTGCCCCCCAGCC
 161 TCTGGCATTAGAATTATTTAAACAAAAACTAGGCGGTTGAATGAGAGGTTCCTAAGAGTGCTGGGCATTTTTATTTTATG
 241 AAATACTATTTAAAGCCTCCTCATCCCGTGTTCTCCTTTTCCTCTCTCCCGGAGGTTGGGTGGGCCGGCTTCATGCCAGC
 321 TACTTCCTCCTCCCCACTTGTCCGCTGGGTGGTACCCTCTGGAGGGGTGTGGCTCCTTCCCATCGCTGTCACAGGCGGTT
 401 ATGAAATTCACCCCCTTTCCTGGACACTCAGACCTGAATTCTTTTTCATTTGAGAAGTAAACAGATGGCACTTTGAAGGG
 481 GCCTCACCGAGTGGGGGCATCATCAAAAACTTTGGAGTCCCCTCACCTCCTCTAAGGTTGGGCAGGGTGACCCTGAAGTG
 561 AGCACAGCCTAGGGCTGAGCTGGGGACCTGGTACCCTCCTGGCTCTTGATACCCCCCTCTGTCTTGTGAAGGCAGGGGGA
 641 AGGTGGGGTCCTGGAGCAGACCACCCCGCCTGCCCTCATGGCCCCTCTGACCTGCACTGGGGAGCCCGTCTCAGTGTTGA
 721 GCCTTTTCCCTCTTTGGCTCCCCTGTACCTTTTGAGGAGCCCCAGCTACCCTTCTTCTCCAGCTGGGCTCTGCAATTCCC
 801 CTCTGCTGCTGTCCCTCCCCCTTGTCCTTTCCCTTCAGTACCCTCTCAGCTCCAGGTGGCTCTGAGGTGCCTGTCCCACC
 881 CCCACCCCCAGCTCAATGGACTGGAAGGGGAAGGGACACACAAGAAGAAGGGCACCCTAGTTCTACCTCAGGCAGCTCAA
 961 GCAGCGACCGCCCCCTCCTCTAGCTGTGGGGGTGAGGGTCCCATGTGGTGGCACAGGCCCCCTTGAGTGGGGTTATCTCT
1041 GTGTTAGGGGTATATGATGGGGGAGTAGATCTTTCTAGGAGGGAGACACTGGCCCCTCAAATCGTCCAGCGACCTTCCTC
1121 ATCCACCCCATCCCTCCCCAGTTCATTGCACTTTGATTAGCAGCGGAACAAGGAGTCAGACATTTTAAGATGGTGGCAGT
1201 AGAGGCTATGGACAGGGCATGCCACGTGGGCTCATATGGGGCTGGGAGTAGTTGTCTTTCCTGGCACTAACGTTGAGCCC
1281 CTGGAGGCACTGAAGTGCTTAGTGTACTTGGAGTATTGGGGTCTGACCCCAAACACCTTCCAGCTCCTGTAACATACTGG
1361 CCTGGACTGTTTTCTCTCGGCTCCCCATGTGTCCTGGTTCCCGTTTCTCCACCTAGACTGTAAACCTCTCGAGGGCAGGG
1441 ACCACACCCTGTACTGTTCTGTGTCTTTCACAGCTCCTCCCACAATGCTGAATATACAGCAGGTGCTCAATAAATGATTC
1521 TTAGTGACTTTACTTGTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gacccucAUACC--CCCGUCCCu 5'
                 || ||  |||||||| 
Target 5' cctcctcTAAGGTTGGGCAGGGt 3'
 526 - 548 152.00 -17.90
2 
miRNA  3' gacccucAUACCCCCGUCCCu 5'
                 |:||  ||||||| 
Target 5' tctgtctTGTGAAGGCAGGGg 3'
 618 - 638 150.00 -19.40
3 
miRNA  3' gacccucauaCCCCCGUCCCu 5'
                    | |||||||| 
Target 5' taaacctctcGAGGGCAGGGa 3'
 1421 - 1441 147.00 -18.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN8871647 4 COSMIC
COSN30107428 13 COSMIC
COSN17136499 21 COSMIC
COSN24388178 36 COSMIC
COSN30512604 38 COSMIC
COSN26970192 40 COSMIC
COSN30166588 65 COSMIC
COSN24301745 80 COSMIC
COSN30488608 90 COSMIC
COSN30469357 137 COSMIC
COSN30533369 148 COSMIC
COSN32056942 195 COSMIC
COSN17181950 363 COSMIC
COSN21122568 516 COSMIC
COSN8514252 516 COSMIC
COSN20590362 520 COSMIC
COSN26644634 575 COSMIC
COSN32057748 625 COSMIC
COSN31576773 708 COSMIC
COSN15779126 787 COSMIC
COSN28791109 848 COSMIC
COSN8514253 848 COSMIC
COSN26566755 989 COSMIC
COSN31541982 1111 COSMIC
COSN31595516 1138 COSMIC
COSN9781735 1206 COSMIC
COSN21510222 1432 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs139304346 4 dbSNP
rs747014318 5 dbSNP
rs1184573689 9 dbSNP
rs1396765368 11 dbSNP
rs1445659229 11 dbSNP
rs777207887 12 dbSNP
rs1376040331 15 dbSNP
rs1226999329 17 dbSNP
rs1059234 21 dbSNP
rs770267002 22 dbSNP
rs775069456 23 dbSNP
rs945802868 24 dbSNP
rs1475096701 28 dbSNP
rs762632530 29 dbSNP
rs201408395 32 dbSNP
rs375173291 33 dbSNP
rs41272170 34 dbSNP
rs1482370511 35 dbSNP
rs150869821 36 dbSNP
rs3176357 39 dbSNP
rs754567385 40 dbSNP
rs1166992411 41 dbSNP
rs755968076 44 dbSNP
rs1423988118 48 dbSNP
rs111926164 52 dbSNP
rs575815855 53 dbSNP
rs998171288 56 dbSNP
rs1028124783 57 dbSNP
rs952159534 59 dbSNP
rs983400213 67 dbSNP
rs907923458 69 dbSNP
rs760541872 75 dbSNP
rs1428687704 80 dbSNP
rs976707693 105 dbSNP
rs1451995360 114 dbSNP
rs951389423 117 dbSNP
rs763632708 118 dbSNP
rs1394250512 125 dbSNP
rs1322653551 126 dbSNP
rs779826646 133 dbSNP
rs922225207 136 dbSNP
rs187742871 137 dbSNP
rs914304254 138 dbSNP
rs1443635232 139 dbSNP
rs564494785 143 dbSNP
rs112675295 144 dbSNP
rs1041396487 145 dbSNP
rs1317251949 152 dbSNP
rs1210788045 155 dbSNP
rs1489707452 157 dbSNP
rs866686724 158 dbSNP
rs1245438449 163 dbSNP
rs1343160898 179 dbSNP
rs546659289 182 dbSNP
rs756718995 195 dbSNP
rs191431994 196 dbSNP
rs529170426 208 dbSNP
rs755706954 209 dbSNP
rs1056094900 222 dbSNP
rs960959039 226 dbSNP
rs1301078579 240 dbSNP
rs1423551932 245 dbSNP
rs1370821103 248 dbSNP
rs543585485 249 dbSNP
rs114982296 258 dbSNP
rs778242620 260 dbSNP
rs781689614 268 dbSNP
rs1372999209 283 dbSNP
rs41272172 284 dbSNP
rs1043234187 287 dbSNP
rs1483485414 291 dbSNP
rs925724850 291 dbSNP
rs1277091698 292 dbSNP
rs796185918 297 dbSNP
rs184374036 305 dbSNP
rs1039501629 307 dbSNP
rs1275518074 308 dbSNP
rs1387758636 311 dbSNP
rs539152524 313 dbSNP
rs1233808733 315 dbSNP
rs1347344575 321 dbSNP
rs866398753 327 dbSNP
rs189270770 330 dbSNP
rs566360271 333 dbSNP
rs1370764937 336 dbSNP
rs1046926038 344 dbSNP
rs1374607192 345 dbSNP
rs1407714364 352 dbSNP
rs377595930 355 dbSNP
rs887116254 358 dbSNP
rs181350370 377 dbSNP
rs1017456404 381 dbSNP
rs1302198995 385 dbSNP
rs3176358 386 dbSNP
rs1002260135 397 dbSNP
rs373590939 397 dbSNP
rs1454501485 398 dbSNP
rs1338842504 412 dbSNP
rs1363084136 416 dbSNP
rs866383890 416 dbSNP
rs976121091 430 dbSNP
rs1179838684 434 dbSNP
rs1296509107 440 dbSNP
rs575126168 442 dbSNP
rs1035203096 443 dbSNP
rs535732427 444 dbSNP
rs1309634071 451 dbSNP
rs960823517 458 dbSNP
rs922162572 467 dbSNP
rs1261233743 476 dbSNP
rs953675606 478 dbSNP
rs532581570 482 dbSNP
rs1281079083 488 dbSNP
rs777824384 489 dbSNP
rs879879447 493 dbSNP
rs1245700146 494 dbSNP
rs749588003 497 dbSNP
rs879309299 498 dbSNP
rs1176417316 499 dbSNP
rs1458233139 501 dbSNP
rs1410545818 513 dbSNP
rs557591236 514 dbSNP
rs1469781325 526 dbSNP
rs1238310449 527 dbSNP
rs914777007 529 dbSNP
rs978433655 530 dbSNP
rs1439329339 532 dbSNP
rs925725564 533 dbSNP
rs942480428 537 dbSNP
rs1039405016 541 dbSNP
rs575878563 545 dbSNP
rs1186756151 547 dbSNP
rs572991639 548 dbSNP
rs1241195720 553 dbSNP
rs946204604 587 dbSNP
rs1431092774 592 dbSNP
rs541799707 606 dbSNP
rs1286032990 612 dbSNP
rs1221894791 613 dbSNP
rs922442057 615 dbSNP
rs933792625 616 dbSNP
rs546335483 618 dbSNP
rs1047001332 625 dbSNP
rs1055493853 632 dbSNP
rs894366694 638 dbSNP
rs367706888 640 dbSNP
rs995702977 642 dbSNP
rs1316639627 646 dbSNP
rs1400543397 648 dbSNP
rs1414782201 651 dbSNP
rs184742749 655 dbSNP
rs941387040 656 dbSNP
rs1048397424 664 dbSNP
rs370572240 665 dbSNP
rs189202045 668 dbSNP
rs757862523 669 dbSNP
rs1289515919 683 dbSNP
rs540666701 692 dbSNP
rs1213364316 693 dbSNP
rs1446277683 700 dbSNP
rs1292232768 702 dbSNP
rs1247641087 708 dbSNP
rs774512258 709 dbSNP
rs1364417768 711 dbSNP
rs1004007357 717 dbSNP
rs1268992201 723 dbSNP
rs1014932119 733 dbSNP
rs1350764432 737 dbSNP
rs1305357860 741 dbSNP
rs1002289641 742 dbSNP
rs1365225649 743 dbSNP
rs1346497851 750 dbSNP
rs1225909893 754 dbSNP
rs1035067351 755 dbSNP
rs1169270853 760 dbSNP
rs997905489 770 dbSNP
rs1266718439 772 dbSNP
rs6457937 775 dbSNP
rs1269272527 778 dbSNP
rs529198430 781 dbSNP
rs990366166 796 dbSNP
rs544057426 812 dbSNP
rs1009737725 815 dbSNP
rs1021650885 821 dbSNP
rs968318210 822 dbSNP
rs1292832469 834 dbSNP
rs562367477 841 dbSNP
rs1214437185 843 dbSNP
rs139090547 846 dbSNP
rs967514962 851 dbSNP
rs980065929 853 dbSNP
rs1345101601 858 dbSNP
rs181534480 870 dbSNP
rs551145694 874 dbSNP
rs566590564 877 dbSNP
rs186592256 880 dbSNP
rs10046116 885 dbSNP
rs548971366 897 dbSNP
rs1401216744 907 dbSNP
rs567103693 914 dbSNP
rs772094412 918 dbSNP
rs991560468 919 dbSNP
rs1479367670 922 dbSNP
rs933848673 943 dbSNP
rs74801436 948 dbSNP
rs908342499 966 dbSNP
rs557652835 970 dbSNP
rs1203248566 971 dbSNP
rs1324860987 972 dbSNP
rs1265599057 987 dbSNP
rs1346545037 991 dbSNP
rs1323184962 998 dbSNP
rs1308173710 1008 dbSNP
rs1393307997 1013 dbSNP
rs1059247 1023 dbSNP
rs1486210553 1028 dbSNP
rs191000568 1031 dbSNP
rs1286834345 1032 dbSNP
rs1448911279 1043 dbSNP
rs1038653449 1049 dbSNP
rs1178582184 1050 dbSNP
rs375384268 1051 dbSNP
rs939842159 1055 dbSNP
rs1373329428 1061 dbSNP
rs1040878666 1067 dbSNP
rs540064877 1071 dbSNP
rs1258434302 1089 dbSNP
rs1308574600 1104 dbSNP
rs937985105 1105 dbSNP
rs776135188 1111 dbSNP
rs558063177 1112 dbSNP
rs889082589 1115 dbSNP
rs1261637880 1119 dbSNP
rs1011602474 1121 dbSNP
rs1315327520 1122 dbSNP
rs1306631788 1135 dbSNP
rs761473919 1142 dbSNP
rs1385000901 1148 dbSNP
rs1232064352 1152 dbSNP
rs1450298684 1161 dbSNP
rs573326094 1165 dbSNP
rs3176359 1166 dbSNP
rs903998141 1177 dbSNP
rs960052426 1184 dbSNP
rs1157825566 1190 dbSNP
rs555737213 1191 dbSNP
rs1386505260 1206 dbSNP
rs1181247844 1207 dbSNP
rs1461236031 1210 dbSNP
rs749899530 1213 dbSNP
rs1263105800 1224 dbSNP
rs1207246532 1226 dbSNP
rs573926464 1227 dbSNP
rs1223431084 1228 dbSNP
rs544119216 1234 dbSNP
rs1163000989 1236 dbSNP
rs930958513 1238 dbSNP
rs983778153 1243 dbSNP
rs1296287341 1251 dbSNP
rs1802569 1257 dbSNP
rs1383705783 1265 dbSNP
rs1382434582 1266 dbSNP
rs1297375941 1267 dbSNP
rs1424855287 1270 dbSNP
rs1426782231 1272 dbSNP
rs908447221 1273 dbSNP
rs1161106457 1277 dbSNP
rs1443541621 1279 dbSNP
rs1306606588 1281 dbSNP
rs1802570 1296 dbSNP
rs182235412 1299 dbSNP
rs185976780 1300 dbSNP
rs544851636 1304 dbSNP
rs1261412400 1309 dbSNP
rs1200644254 1311 dbSNP
rs1490893779 1314 dbSNP
rs1300371776 1319 dbSNP
rs1376345118 1321 dbSNP
rs1340234208 1328 dbSNP
rs1244523840 1350 dbSNP
rs963715824 1361 dbSNP
rs1324648171 1365 dbSNP
rs1277296198 1375 dbSNP
rs745953295 1380 dbSNP
rs1361208671 1382 dbSNP
rs932480638 1386 dbSNP
rs11550973 1388 dbSNP
rs527383432 1389 dbSNP
rs1396519804 1390 dbSNP
rs1169167214 1392 dbSNP
rs548775480 1394 dbSNP
rs1011571683 1397 dbSNP
rs1423597658 1398 dbSNP
rs73730143 1403 dbSNP
rs903433616 1404 dbSNP
rs982916069 1416 dbSNP
rs1267037831 1426 dbSNP
rs531369735 1431 dbSNP
rs778257166 1432 dbSNP
rs1194188901 1434 dbSNP
rs1183138065 1440 dbSNP
rs1337340457 1441 dbSNP
rs1257405417 1445 dbSNP
rs1223890425 1449 dbSNP
rs1036363838 1452 dbSNP
rs1385906506 1460 dbSNP
rs766360274 1460 dbSNP
rs1446722024 1461 dbSNP
rs1166317774 1462 dbSNP
rs564442732 1473 dbSNP
rs1419284609 1477 dbSNP
rs941154808 1479 dbSNP
rs1136646 1483 dbSNP
rs1471247583 1499 dbSNP
rs1427573585 1509 dbSNP
rs549777937 1512 dbSNP
rs1470615589 1515 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 1026.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gacccucauaccCCCGUCCCu 5'
                      |||||||| 
Target 5' -----------aGGGCAGGGa 3'
 		1 - 10
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166 , TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5 PAR-CLIP data was present in ERX177628. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_6 PAR-CLIP data was present in ERX177616. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_6 PAR-CLIP data was present in ERX177627. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_5 PAR-CLIP data was present in ERX177631. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_9 PAR-CLIP data was present in ERX177619. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_9 PAR-CLIP data was present in ERX177615. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_5 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000244741.5 | 3UTR | AGGGCAGGGACCACACCCUGUACUGUUCUGUGUCUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000244741.5 | 3UTR | ACCACACCCUGUACUGUUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000244741.5 | 3UTR | UUUCUCCACCUAGACUGUAAACCUCUCGAGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
110 hsa-miR-6752-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT152341 TNFSF9 TNF superfamily member 9 2 2
MIRT273594 SP1 Sp1 transcription factor 2 2
MIRT291927 TPM4 tropomyosin 4 2 4
MIRT311186 ANKRD33B ankyrin repeat domain 33B 2 4
MIRT378521 CDKN1A cyclin dependent kinase inhibitor 1A 2 4
MIRT452467 SORCS2 sortilin related VPS10 domain containing receptor 2 2 2
MIRT478636 CTDNEP1 CTD nuclear envelope phosphatase 1 2 2
MIRT496343 TMEM81 transmembrane protein 81 2 2
MIRT496646 MFAP3 microfibril associated protein 3 2 2
MIRT496711 DNAJC30 DnaJ heat shock protein family (Hsp40) member C30 2 2
MIRT499242 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT519777 ZNF354B zinc finger protein 354B 2 6
MIRT520883 STX17 syntaxin 17 2 2
MIRT522476 ZAK mitogen-activated protein kinase kinase kinase 20 2 2
MIRT523587 G3BP2 G3BP stress granule assembly factor 2 2 6
MIRT525240 KCNJ12 potassium voltage-gated channel subfamily J member 12 2 2
MIRT527025 PABPN1L poly(A) binding protein nuclear 1 like, cytoplasmic 2 2
MIRT527709 IL17REL interleukin 17 receptor E like 2 2
MIRT530778 GPD1 glycerol-3-phosphate dehydrogenase 1 2 2
MIRT531883 SCN1B sodium voltage-gated channel beta subunit 1 2 2
MIRT533043 ZBTB46 zinc finger and BTB domain containing 46 2 2
MIRT535062 PPP2R5D protein phosphatase 2 regulatory subunit B'delta 2 4
MIRT536512 KCTD15 potassium channel tetramerization domain containing 15 2 2
MIRT543793 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 2 2
MIRT563977 HCFC1 host cell factor C1 2 2
MIRT569472 MAN2A2 mannosidase alpha class 2A member 2 2 2
MIRT570600 NFIX nuclear factor I X 2 2
MIRT571402 MED4 mediator complex subunit 4 2 2
MIRT608418 PPIC peptidylprolyl isomerase C 2 6
MIRT608928 REXO2 RNA exonuclease 2 2 4
MIRT609357 ZNF664 zinc finger protein 664 2 2
MIRT611189 WBSCR17 polypeptide N-acetylgalactosaminyltransferase 17 2 4
MIRT615266 DPF2 double PHD fingers 2 2 2
MIRT615408 VDAC2 voltage dependent anion channel 2 2 2
MIRT616323 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT616566 ZNF512B zinc finger protein 512B 2 2
MIRT616745 TAZ tafazzin 2 2
MIRT617316 MBOAT1 membrane bound O-acyltransferase domain containing 1 2 2
MIRT620030 NFAM1 NFAT activating protein with ITAM motif 1 2 2
MIRT621166 RTTN rotatin 2 2
MIRT623501 KCNQ3 potassium voltage-gated channel subfamily Q member 3 2 2
MIRT623524 KCNK10 potassium two pore domain channel subfamily K member 10 2 2
MIRT629683 TNFAIP8L1 TNF alpha induced protein 8 like 1 2 2
MIRT630795 TGIF2 TGFB induced factor homeobox 2 2 2
MIRT634638 HIP1 huntingtin interacting protein 1 2 4
MIRT636788 RAB40B RAB40B, member RAS oncogene family 2 2
MIRT640332 DAAM2 dishevelled associated activator of morphogenesis 2 2 2
MIRT640557 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 2
MIRT643319 TMEM151B transmembrane protein 151B 2 2
MIRT643991 DUSP28 dual specificity phosphatase 28 2 2
MIRT644618 CD300E CD300e molecule 2 2
MIRT646445 XRCC2 X-ray repair cross complementing 2 2 2
MIRT648020 SLCO4C1 solute carrier organic anion transporter family member 4C1 2 2
MIRT648077 ZMIZ2 zinc finger MIZ-type containing 2 2 2
MIRT649618 ITPKC inositol-trisphosphate 3-kinase C 2 2
MIRT650414 ZNF442 zinc finger protein 442 2 2
MIRT650850 SEMA4G semaphorin 4G 2 2
MIRT654694 PSMB5 proteasome subunit beta 5 2 2
MIRT655512 PAIP2B poly(A) binding protein interacting protein 2B 2 2
MIRT657620 GRAP2 GRB2-related adaptor protein 2 2 2
MIRT658009 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 2 2
MIRT658329 FAM83F family with sequence similarity 83 member F 2 2
MIRT658832 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT658920 DPY19L4 dpy-19 like 4 2 2
MIRT661058 RPL18A ribosomal protein L18a 2 2
MIRT662342 MYLK3 myosin light chain kinase 3 2 2
MIRT663451 FBXO2 F-box protein 2 2 2
MIRT676752 SGTB small glutamine rich tetratricopeptide repeat containing beta 2 4
MIRT684705 LRRD1 leucine rich repeats and death domain containing 1 2 2
MIRT687247 PDHB pyruvate dehydrogenase E1 beta subunit 2 2
MIRT693881 NT5C2 5'-nucleotidase, cytosolic II 2 2
MIRT693922 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT695921 ZNF174 zinc finger protein 174 2 2
MIRT702867 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT708863 TMSB4X thymosin beta 4, X-linked 2 2
MIRT708936 CRY2 cryptochrome circadian clock 2 2 2
MIRT709476 FAXC failed axon connections homolog 2 2
MIRT709752 UBD ubiquitin D 2 2
MIRT710128 VANGL2 VANGL planar cell polarity protein 2 2 2
MIRT710274 FAM107A family with sequence similarity 107 member A 2 2
MIRT711146 TMEM174 transmembrane protein 174 2 2
MIRT712582 ATP2B4 ATPase plasma membrane Ca2+ transporting 4 2 2
MIRT712648 TXNL4A thioredoxin like 4A 2 2
MIRT713325 TMEM44 transmembrane protein 44 2 2
MIRT713413 PEX16 peroxisomal biogenesis factor 16 2 2
MIRT713891 RNF19B ring finger protein 19B 2 2
MIRT714549 COL14A1 collagen type XIV alpha 1 chain 2 2
MIRT714809 ARHGEF19 Rho guanine nucleotide exchange factor 19 2 2
MIRT714840 SCAMP2 secretory carrier membrane protein 2 2 2
MIRT715779 DDX42 DEAD-box helicase 42 2 2
MIRT715795 TBL3 transducin beta like 3 2 2
MIRT716088 RNF150 ring finger protein 150 2 2
MIRT716712 IMP4 IMP4, U3 small nucleolar ribonucleoprotein 2 2
MIRT716737 APOL6 apolipoprotein L6 2 2
MIRT717069 MTMR6 myotubularin related protein 6 2 2
MIRT718185 HLCS holocarboxylase synthetase 2 2
MIRT719386 SECTM1 secreted and transmembrane 1 2 2
MIRT720679 SLC39A13 solute carrier family 39 member 13 2 2
MIRT721315 FAM58A cyclin Q 2 2
MIRT721396 LDLRAD4 low density lipoprotein receptor class A domain containing 4 2 2
MIRT721896 ITPR2 inositol 1,4,5-trisphosphate receptor type 2 2 2
MIRT722442 ZBTB7B zinc finger and BTB domain containing 7B 2 2
MIRT723009 FADS1 fatty acid desaturase 1 2 2
MIRT723675 CTC1 CST telomere replication complex component 1 2 2
MIRT723774 ROBO4 roundabout guidance receptor 4 2 2
MIRT723814 OR1L8 olfactory receptor family 1 subfamily L member 8 2 2
MIRT723959 TMEM184A transmembrane protein 184A 2 2
MIRT724449 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT724798 C1D C1D nuclear receptor corepressor 2 2
MIRT725626 CAMKV CaM kinase like vesicle associated 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-6752-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-6752-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)

Error report submission