miRTarBase - #MIRT396751


—
pre-miRNA Information
pre-miRNA hsa-mir-7110   
Genomic Coordinates chr3: 123161794 - 123161879
Description Homo sapiens miR-7110 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-7110-3p
Sequence 65| UCUCUCUCCCACUUCCCUGCAG |86
Evidence Experimental
Experiments Meta-analysis
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30629632 7 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs933023636 4 dbSNP
rs529799363 6 dbSNP
rs57948168 7 dbSNP
rs1172032316 9 dbSNP
rs566496167 10 dbSNP
rs903348975 11 dbSNP
rs532110591 12 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol RDX   
Synonyms DFNB24
Description radixin
Transcript NM_002906   
Expression
Putative miRNA Targets on RDX
3'UTR of RDX
(miRNA target sites are highlighted)		 
>RDX|NM_002906|3'UTR
   1 GAGCTGTTATTTTGCATATATGTTCTTCATAAGCTGAACCACCAACAGAGAAAAGCAGGCCTTTGCAGATATGATGGAAT
  81 GCATCCCACCTTGCCAAAGCACTTACACCAGTTTGACTGTGCTAGCTAAAAGACAAATTTAAGGGGAGCTCTTCAACATT
 161 AAGGCAGTATGATATCATGCTTGGTTTTCTTTTTTCTTTTGGTCCAGGGAATGGAGAATGGTGTTCCATTGCCTCTTTTC
 241 ACATTTTTTTTCTTTTTCTTTTTTTTTTCTGTTGAAGATTAACACTAATTATCACGTCTGACAAATGTGTATGTGTGGTT
 321 TCAGTTCTGTGTACATTTTAAAGGATAATGGTGAACATTTTAATGGGTTTCCCTTGCCCTTTCCATATTTAACCTATTTC
 401 CACATTCTCTCTCACTCACATTTTCTCAGTGTGCCCTTCTCTTATCTGCCATGTCCATAGCCATAATTCCACCATCATAC
 481 AGATCAGGCAGTGTTTAAAATGATGGTAGGTAGCACAGTGGACAGTCTTTGATCATCATGTAGAATATGGCTATGAATCA
 561 GGAAAGAGATTAGAACATTTAATAATGTATGTACAGCTGGTGCTTAGTTTTTTTTTAATCTAAATTTAATTACCTTATTG
 641 GATATTTGATATTTGGTTATTTAATCACAGTCATCTTTAACAGCTTACACTGATTGGTGTTTTATCTCCTGTGATCCTTT
 721 GATGGCTTTTTTTGCCTACCATTTCACAGAGGTTTAGACAGCAGTAGTAGCTCCCTAGGAGAGTTTACTGATGAAACAGC
 801 CTCTGCAAGATTTTAAAAGTTTTGTTCTTTTATAGACTGATTTAGAAAAACAAATGATTAGTTAAAAAAAGAAAATATAC
 881 ATTTGTTGGTAACTAATGTTATTTTTTAAAACCTGGACCTTTTCTGGAAGGGCAGCATATAAAAACATCAGTCCCGAGGA
 961 GGGGACAACAATACTACCTCACTACTACATCTGTGATGACTGGTTGTTCAAACACAATGGAGTGTGTAAGGTATATGTTT
1041 TATAATTCATAACCATAGCCTCGATCATCAAGAAATACTTTCGAAATTTCATTTTCCTTCAGAATATCTTAAGAGTGCTA
1121 AATTTTTAACTGCCTTTTTGTCGAGTCAAACTGTGGGATTCTGATTTGTATTAAAATTGTAAGCTCCTCACTGGTATACT
1201 ATCATCCTGGAGGGGTGTTGTATGGCTGAGCAAGAGAGAGAGAGAATGAGAGAGAGACTGTGTGTGTGTGTGTGTGTGTG
1281 TGTGTGTGTACTCTGTGTGTGTATGAGAGAGAGAAATGCTAACCTTGTAGCATGTGAAGAATGTCTGTACCTTGATACGA
1361 TAGTTACATAATCAGTATATTTGGTTTCTAGATCACTGTGCTTATTTTGTTTCAATCTCTGACTAAAAATACTTAAATTT
1441 GGTTTGTTAATTCTTATTTTAGAAATTATAATTTTAGTTTATATTAATTTCGGTTATAGCTTACTGAAGAAATCTTTCCA
1521 GTTAGAAGGAGGTTCTAATATTCACATGTTCTAATACTTTGTTTATTGTAAAACAGCTAAATTTGGAGATACGTAAAGCC
1601 TTGTTTTCTCTGTGTGGTTCAGCTACTTTCCATTTGGTATTACACAGTCAAATTTACATTTATCTATTAAAATTGCCATT
1681 TTATTAAACATTTTCATGCACAGTAGATTCAAGTTGTGTCTGAAAATATCTCTTGTGCTTTTTTGATTTTGCTGACTTTA
1761 AAAGGATTAATCTGGGCAGACATTATGTAAAAGAAAGGTTGCGTTTAATATATTTTTTGAACTTTGTAGGACAAAACATA
1841 GCTGGTTAACCTTGAAGTGACTGTTGTACCATGGTTGTGCACATGCTTCAGAATCCTATGGAAGAGAATATTCCTACTTG
1921 CAGTACATCAAAGGAATGGATGGTGGACCCTACTATTCATGTTTTGAGACATAAATGTTCACTTTAAAGCAATTGCATAA
2001 TAGATAAAAACCTGAACTTTCATTGGATTTTTGTTAATTTTCCTCATTTTGAATTATGTGCACTACCATAGCTACATCAG
2081 TTTGATACAGTATTGAAAAATTATCAGTTATATTTTGCTGTTTATGATCTATTTGTAGATTAGGATTAAAATGGATTTAA
2161 TCCATTTTTAAGGCTGTGTGAATTTTTCTAAACAAGAACCATTTGCAATATGGATTTCTTAGAGATTAAACCAATTATAA
2241 CTTATTAGCAGTCGCGAGCACATGTTCATATAGTCAATGTAAAAATACACTAATGAGTATTTGGTAAATCCCAGTAGGCT
2321 TTTACCATTAGCATAATTTTGTGTTGTACAATTAAGTTACAATTACATCTCTAATTTTGGATAATATTCATTGGTTAACA
2401 ATAAAGTGACAAAAGCTCATGCCTTCAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gacgUCCCUUCACCCUCUCUCu 5'
              || ||| || ||||||| 
Target 5' agagAGAGAA-TGAGAGAGAGa 3'
 1237 - 1257 161.00 -15.40
2 
miRNA  3' gaCGUCCCUUCACCCUCUCUCu 5'
            |:: | :  || ||||||| 
Target 5' ctGTGTGTGTATGAGAGAGAGa 3'
 1293 - 1314 148.00 -16.00
3 
miRNA  3' gaCGUCCCUUCACCCUCUCUCu 5'
            ||   |||   ||| |||| 
Target 5' tgGCTATGAATCAGGAAAGAGa 3'
 548 - 569 120.00 -10.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
302341 79 ClinVar
302340 156 ClinVar
878215 302 ClinVar
878214 414 ClinVar
302339 429 ClinVar
302338 463 ClinVar
878213 474 ClinVar
302337 525 ClinVar
302336 725 ClinVar
877178 740 ClinVar
877177 762 ClinVar
302335 800 ClinVar
877176 855 ClinVar
302334 885 ClinVar
302333 924 ClinVar
302332 1058 ClinVar
302331 1083 ClinVar
877175 1143 ClinVar
302330 1173 ClinVar
879969 1201 ClinVar
879968 1215 ClinVar
302328 1246 ClinVar
302329 1246 ClinVar
302327 1251 ClinVar
302326 1258 ClinVar
302325 1264 ClinVar
879967 1264 ClinVar
302324 1284 ClinVar
302323 1288 ClinVar
302315 1290 ClinVar
302316 1290 ClinVar
302317 1290 ClinVar
302318 1290 ClinVar
302319 1290 ClinVar
302320 1290 ClinVar
302321 1290 ClinVar
302322 1290 ClinVar
302312 1291 ClinVar
302313 1291 ClinVar
302314 1291 ClinVar
302309 1292 ClinVar
302310 1292 ClinVar
302311 1292 ClinVar
302308 1313 ClinVar
302307 1315 ClinVar
879612 1358 ClinVar
302306 1368 ClinVar
879611 1375 ClinVar
879610 1383 ClinVar
879609 1536 ClinVar
302305 1579 ClinVar
879608 1632 ClinVar
879607 1898 ClinVar
302304 1955 ClinVar
302303 1961 ClinVar
302302 2006 ClinVar
302301 2057 ClinVar
878149 2070 ClinVar
878148 2085 ClinVar
878147 2112 ClinVar
878146 2253 ClinVar
302300 2423 ClinVar
COSN30499278 44 COSMIC
COSN31558414 53 COSMIC
COSN30513666 73 COSMIC
COSN30110206 102 COSMIC
COSN26556994 106 COSMIC
COSN31505729 171 COSMIC
COSN30542805 174 COSMIC
COSN31515169 176 COSMIC
COSN31549739 201 COSMIC
COSN31519138 871 COSMIC
COSN20108734 920 COSMIC
COSN31519141 994 COSMIC
COSN31520253 1072 COSMIC
COSN15958193 1082 COSMIC
COSN31528043 1083 COSMIC
COSN31579662 1097 COSMIC
COSN31594675 1135 COSMIC
COSN26504913 1142 COSMIC
COSN31603315 1232 COSMIC
COSN6984878 1293 COSMIC
COSN20230674 1304 COSMIC
COSN31606935 1793 COSMIC
COSN31484031 1841 COSMIC
COSN26636970 1850 COSMIC
COSN31547980 2007 COSMIC
COSN31518385 2154 COSMIC
COSN26559599 2162 COSMIC
COSN31544835 2224 COSMIC
COSN4718688 2228 COSMIC
COSN17037735 2232 COSMIC
COSN32058582 2253 COSMIC
COSN31545261 2255 COSMIC
COSN30176983 2418 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs777439092 2 dbSNP
rs1409799137 4 dbSNP
rs375311118 5 dbSNP
rs752431465 10 dbSNP
rs767229138 15 dbSNP
rs1014659243 16 dbSNP
rs1313480998 18 dbSNP
rs1333696815 21 dbSNP
rs1004658030 24 dbSNP
rs754563078 29 dbSNP
rs752353543 30 dbSNP
rs750839939 41 dbSNP
rs765513561 51 dbSNP
rs1442398985 55 dbSNP
rs1466379081 71 dbSNP
rs377557089 72 dbSNP
rs55953813 79 dbSNP
rs1293011955 83 dbSNP
rs996119078 97 dbSNP
rs1194648658 106 dbSNP
rs1171503884 108 dbSNP
rs759401700 110 dbSNP
rs1438467077 111 dbSNP
rs11541502 116 dbSNP
rs1433162069 119 dbSNP
rs1394702926 120 dbSNP
rs548988204 121 dbSNP
rs1444289745 128 dbSNP
rs1182716630 132 dbSNP
rs1181141463 134 dbSNP
rs1459328413 136 dbSNP
rs186249296 156 dbSNP
rs1000903738 161 dbSNP
rs1410067535 166 dbSNP
rs902588989 169 dbSNP
rs1042520656 172 dbSNP
rs1451554409 176 dbSNP
rs949509069 182 dbSNP
rs1177097628 190 dbSNP
rs1385450792 196 dbSNP
rs1225787178 197 dbSNP
rs770941392 202 dbSNP
rs1340096595 206 dbSNP
rs1055751233 209 dbSNP
rs1261382733 214 dbSNP
rs1282972485 215 dbSNP
rs1461034118 216 dbSNP
rs1204562635 235 dbSNP
rs1209158940 239 dbSNP
rs1190877397 252 dbSNP
rs532505138 252 dbSNP
rs560083718 252 dbSNP
rs759550917 254 dbSNP
rs1346784664 258 dbSNP
rs1403342038 259 dbSNP
rs973084492 259 dbSNP
rs1286198951 264 dbSNP
rs1336983020 269 dbSNP
rs1380904250 269 dbSNP
rs1404748703 269 dbSNP
rs1318128529 272 dbSNP
rs1327497977 277 dbSNP
rs1230342182 278 dbSNP
rs963042023 284 dbSNP
rs551505568 286 dbSNP
rs1224314040 287 dbSNP
rs760508274 295 dbSNP
rs1396589566 296 dbSNP
rs181457865 302 dbSNP
rs1260869069 306 dbSNP
rs983181176 318 dbSNP
rs1357277556 338 dbSNP
rs190627175 343 dbSNP
rs1413873470 344 dbSNP
rs544220930 345 dbSNP
rs996454744 347 dbSNP
rs1455440858 363 dbSNP
rs1378979871 373 dbSNP
rs1362175471 380 dbSNP
rs964652395 396 dbSNP
rs1386204343 413 dbSNP
rs1032703901 420 dbSNP
rs1000851378 422 dbSNP
rs902536061 425 dbSNP
rs146390813 429 dbSNP
rs1186255744 430 dbSNP
rs1485514057 431 dbSNP
rs1238681401 439 dbSNP
rs1259873411 444 dbSNP
rs562078184 445 dbSNP
rs1351132723 447 dbSNP
rs1218648761 448 dbSNP
rs1013684855 453 dbSNP
rs1263480698 456 dbSNP
rs896607487 457 dbSNP
rs886047645 463 dbSNP
rs1055295598 472 dbSNP
rs1416925325 472 dbSNP
rs1364700221 491 dbSNP
rs1348076466 494 dbSNP
rs1421927625 503 dbSNP
rs1162120233 504 dbSNP
rs1259693866 506 dbSNP
rs1365476256 512 dbSNP
rs1425925720 524 dbSNP
rs144848373 525 dbSNP
rs573624635 535 dbSNP
rs1371298076 538 dbSNP
rs1390968704 545 dbSNP
rs1308010632 554 dbSNP
rs920175355 559 dbSNP
rs532278020 562 dbSNP
rs1289371678 563 dbSNP
rs1340855691 567 dbSNP
rs1320010429 571 dbSNP
rs1223210136 575 dbSNP
rs941675396 587 dbSNP
rs907558267 588 dbSNP
rs1176219361 589 dbSNP
rs1384182125 591 dbSNP
rs1250768690 601 dbSNP
rs1441208460 603 dbSNP
rs1182133382 604 dbSNP
rs983126821 610 dbSNP
rs954485692 616 dbSNP
rs1352792928 617 dbSNP
rs543545438 617 dbSNP
rs974591120 617 dbSNP
rs1420663602 619 dbSNP
rs780444817 621 dbSNP
rs1285318087 624 dbSNP
rs770101389 625 dbSNP
rs1163340109 628 dbSNP
rs1312626092 637 dbSNP
rs1381785073 645 dbSNP
rs1228746775 647 dbSNP
rs1475101595 648 dbSNP
rs1314798963 666 dbSNP
rs964927559 691 dbSNP
rs1032238223 695 dbSNP
rs1251453883 696 dbSNP
rs1000798443 703 dbSNP
rs966667779 708 dbSNP
rs1242850133 711 dbSNP
rs1462066884 714 dbSNP
rs1417962664 717 dbSNP
rs1020969342 720 dbSNP
rs1013630972 721 dbSNP
rs1195765538 721 dbSNP
rs896560772 722 dbSNP
rs1444994205 723 dbSNP
rs1468376630 724 dbSNP
rs574825897 725 dbSNP
rs1209931842 733 dbSNP
rs1405021380 739 dbSNP
rs558073403 740 dbSNP
rs776440558 741 dbSNP
rs1304415960 746 dbSNP
rs1359778335 748 dbSNP
rs1002357147 756 dbSNP
rs1319399412 762 dbSNP
rs539984720 764 dbSNP
rs781384543 765 dbSNP
rs1262141123 766 dbSNP
rs1232646426 767 dbSNP
rs1442687808 774 dbSNP
rs1038558330 781 dbSNP
rs940283235 786 dbSNP
rs886065273 795 dbSNP
rs1187626572 796 dbSNP
rs1258476778 799 dbSNP
rs886047644 800 dbSNP
rs1047381003 809 dbSNP
rs1479515199 829 dbSNP
rs1224961362 831 dbSNP
rs757837151 833 dbSNP
rs1324913339 837 dbSNP
rs933012439 844 dbSNP
rs923028819 853 dbSNP
rs752002973 855 dbSNP
rs974917892 863 dbSNP
rs185094188 864 dbSNP
rs1298769999 871 dbSNP
rs1396735091 871 dbSNP
rs1323933862 875 dbSNP
rs142279957 885 dbSNP
rs1402525173 897 dbSNP
rs1397832961 899 dbSNP
rs1170013232 912 dbSNP
rs925116477 916 dbSNP
rs35381725 924 dbSNP
rs966614405 927 dbSNP
rs1193839648 935 dbSNP
rs1020916869 940 dbSNP
rs1198786963 947 dbSNP
rs1247426535 954 dbSNP
rs1250655101 955 dbSNP
rs1175708008 956 dbSNP
rs1212505623 966 dbSNP
rs1438389144 968 dbSNP
rs537872061 971 dbSNP
rs1274942553 978 dbSNP
rs992146749 1002 dbSNP
rs778188655 1014 dbSNP
rs1193866351 1022 dbSNP
rs1338451273 1024 dbSNP
rs1301972203 1033 dbSNP
rs961014059 1035 dbSNP
rs567257716 1040 dbSNP
rs1438080531 1051 dbSNP
rs886047643 1058 dbSNP
rs1235350250 1062 dbSNP
rs1241289342 1063 dbSNP
rs1033744189 1066 dbSNP
rs1357910362 1072 dbSNP
rs1002709909 1075 dbSNP
rs1222419681 1075 dbSNP
rs1453434992 1081 dbSNP
rs746957862 1082 dbSNP
rs898627757 1082 dbSNP
rs114509945 1083 dbSNP
rs533846123 1088 dbSNP
rs1442636617 1089 dbSNP
rs759080639 1094 dbSNP
rs1440179177 1097 dbSNP
rs932980025 1098 dbSNP
rs1285123094 1100 dbSNP
rs866551189 1101 dbSNP
rs1390775295 1102 dbSNP
rs1336884067 1106 dbSNP
rs1406624369 1110 dbSNP
rs1353556830 1113 dbSNP
rs901520593 1113 dbSNP
rs1331404341 1117 dbSNP
rs1408607758 1128 dbSNP
rs566717477 1130 dbSNP
rs1381048611 1134 dbSNP
rs1245835314 1142 dbSNP
rs1285328999 1143 dbSNP
rs1359140066 1145 dbSNP
rs1038748308 1147 dbSNP
rs1272459526 1154 dbSNP
rs943116299 1156 dbSNP
rs925063839 1157 dbSNP
rs1459836883 1166 dbSNP
rs753716470 1173 dbSNP
rs1402965427 1175 dbSNP
rs551300652 1177 dbSNP
rs532933098 1184 dbSNP
rs1165638627 1185 dbSNP
rs1174635069 1192 dbSNP
rs1422309954 1193 dbSNP
rs945220103 1194 dbSNP
rs913801365 1196 dbSNP
rs181866368 1201 dbSNP
rs960709823 1203 dbSNP
rs967115079 1210 dbSNP
rs1034103027 1213 dbSNP
rs1342774754 1215 dbSNP
rs1225947880 1219 dbSNP
rs1269607062 1224 dbSNP
rs1318698996 1243 dbSNP
rs1220650403 1244 dbSNP
rs377537657 1246 dbSNP
rs886047642 1246 dbSNP
rs980837696 1246 dbSNP
rs112821905 1248 dbSNP
rs1192466055 1249 dbSNP
rs541339386 1251 dbSNP
rs1234552665 1252 dbSNP
rs1444011292 1254 dbSNP
rs1190944003 1256 dbSNP
rs1261788896 1258 dbSNP
rs867272069 1258 dbSNP
rs886047641 1258 dbSNP
rs1222483890 1259 dbSNP
rs756000998 1259 dbSNP
rs1172259771 1261 dbSNP
rs372282092 1264 dbSNP
rs778972571 1264 dbSNP
rs1017005810 1265 dbSNP
rs1426728234 1265 dbSNP
rs868358543 1265 dbSNP
rs1179521744 1269 dbSNP
rs1404819300 1272 dbSNP
rs1380963132 1274 dbSNP
rs1437130789 1279 dbSNP
rs1318284643 1280 dbSNP
rs1280840057 1281 dbSNP
rs1212752077 1282 dbSNP
rs74676538 1284 dbSNP
rs951568803 1284 dbSNP
rs1345105011 1285 dbSNP
rs201146451 1285 dbSNP
rs199826383 1286 dbSNP
rs998852823 1286 dbSNP
rs780363505 1288 dbSNP
rs1195200730 1290 dbSNP
rs1266226991 1290 dbSNP
rs1285190207 1290 dbSNP
rs1488597543 1290 dbSNP
rs375799373 1290 dbSNP
rs61030269 1290 dbSNP
rs867786685 1290 dbSNP
rs878964786 1290 dbSNP
rs879086566 1290 dbSNP
rs886047640 1290 dbSNP
rs886047637 1291 dbSNP
rs886047638 1291 dbSNP
rs886047639 1291 dbSNP
rs1351447994 1292 dbSNP
rs749108687 1292 dbSNP
rs750877967 1292 dbSNP
rs886047634 1292 dbSNP
rs886047635 1292 dbSNP
rs886047636 1292 dbSNP
rs1487892581 1293 dbSNP
rs753881085 1294 dbSNP
rs1281325820 1295 dbSNP
rs115813167 1302 dbSNP
rs1268994889 1303 dbSNP
rs1280610865 1303 dbSNP
rs1416981671 1303 dbSNP
rs140466869 1304 dbSNP
rs901471293 1308 dbSNP
rs1442014778 1309 dbSNP
rs1162255990 1312 dbSNP
rs189484152 1313 dbSNP
rs35062188 1314 dbSNP
rs1491036409 1315 dbSNP
rs149832663 1315 dbSNP
rs754712703 1315 dbSNP
rs866079192 1315 dbSNP
rs1313939360 1317 dbSNP
rs1377373475 1317 dbSNP
rs1007259613 1328 dbSNP
rs1310515697 1336 dbSNP
rs1321101443 1338 dbSNP
rs561745241 1349 dbSNP
rs1229654166 1355 dbSNP
rs766075876 1358 dbSNP
rs1172572641 1359 dbSNP
rs903592064 1367 dbSNP
rs540576204 1368 dbSNP
rs79924211 1375 dbSNP
rs1413662181 1385 dbSNP
rs1424963125 1390 dbSNP
rs1156280258 1393 dbSNP
rs913748853 1395 dbSNP
rs1470343865 1401 dbSNP
rs1465240472 1405 dbSNP
rs1171700881 1412 dbSNP
rs1400701570 1414 dbSNP
rs1056347714 1415 dbSNP
rs939265437 1417 dbSNP
rs564769645 1423 dbSNP
rs926597516 1430 dbSNP
rs115387220 1433 dbSNP
rs1258060286 1437 dbSNP
rs962711049 1441 dbSNP
rs1217580988 1453 dbSNP
rs1484540337 1453 dbSNP
rs909948421 1456 dbSNP
rs982845265 1457 dbSNP
rs951516857 1468 dbSNP
rs1237321791 1470 dbSNP
rs1209735780 1476 dbSNP
rs1483829364 1481 dbSNP
rs575888818 1491 dbSNP
rs1259700689 1493 dbSNP
rs998403942 1495 dbSNP
rs1286505635 1498 dbSNP
rs964638429 1503 dbSNP
rs1018556864 1512 dbSNP
rs1173678707 1518 dbSNP
rs796073834 1518 dbSNP
rs1358364715 1520 dbSNP
rs1466449240 1521 dbSNP
rs1304535955 1522 dbSNP
rs1338397290 1528 dbSNP
rs1398813413 1531 dbSNP
rs1278348129 1532 dbSNP
rs1222061841 1538 dbSNP
rs1007214328 1546 dbSNP
rs556332581 1548 dbSNP
rs1313189737 1560 dbSNP
rs1212801396 1570 dbSNP
rs1284480624 1571 dbSNP
rs772084374 1579 dbSNP
rs1043466848 1580 dbSNP
rs1009326088 1586 dbSNP
rs1294378359 1589 dbSNP
rs1190859984 1591 dbSNP
rs892264046 1592 dbSNP
rs1056695733 1593 dbSNP
rs939231267 1593 dbSNP
rs926516114 1594 dbSNP
rs1045010155 1595 dbSNP
rs1298206160 1599 dbSNP
rs1361899547 1601 dbSNP
rs941338723 1612 dbSNP
rs1367928751 1617 dbSNP
rs1221265438 1621 dbSNP
rs909895824 1662 dbSNP
rs1353601287 1664 dbSNP
rs1312619852 1668 dbSNP
rs982791503 1673 dbSNP
rs1449961806 1675 dbSNP
rs1431072231 1676 dbSNP
rs1346581615 1677 dbSNP
rs1174921092 1708 dbSNP
rs544319317 1713 dbSNP
rs922744652 1718 dbSNP
rs977312135 1729 dbSNP
rs1438932022 1730 dbSNP
rs1159216521 1732 dbSNP
rs754210041 1733 dbSNP
rs1403078008 1736 dbSNP
rs964267219 1753 dbSNP
rs1166958382 1759 dbSNP
rs1350105838 1760 dbSNP
rs1018918322 1764 dbSNP
rs1438245773 1771 dbSNP
rs1329657980 1781 dbSNP
rs979020599 1782 dbSNP
rs184280850 1786 dbSNP
rs1416963514 1787 dbSNP
rs1186877893 1794 dbSNP
rs1312068171 1798 dbSNP
rs1370007019 1801 dbSNP
rs181840405 1802 dbSNP
rs1486355652 1803 dbSNP
rs1290748939 1812 dbSNP
rs1243991268 1825 dbSNP
rs1196986425 1826 dbSNP
rs533746098 1830 dbSNP
rs566675319 1831 dbSNP
rs1457174560 1832 dbSNP
rs1179079019 1834 dbSNP
rs1234505547 1837 dbSNP
rs1471809643 1838 dbSNP
rs1413904773 1862 dbSNP
rs1021970715 1873 dbSNP
rs1168122304 1880 dbSNP
rs558009916 1881 dbSNP
rs1009273819 1893 dbSNP
rs539282888 1898 dbSNP
rs775679873 1900 dbSNP
rs1034802276 1904 dbSNP
rs770185484 1914 dbSNP
rs1284781881 1922 dbSNP
rs138942667 1955 dbSNP
rs550710327 1956 dbSNP
rs746061486 1961 dbSNP
rs1363656242 1985 dbSNP
rs1199036181 1989 dbSNP
rs1267997527 1997 dbSNP
rs538806036 2006 dbSNP
rs1186755976 2007 dbSNP
rs1394631951 2008 dbSNP
rs1475889341 2011 dbSNP
rs1190926083 2017 dbSNP
rs1327309452 2023 dbSNP
rs543347774 2028 dbSNP
rs1465868039 2033 dbSNP
rs771202205 2034 dbSNP
rs1459866793 2037 dbSNP
rs1393640335 2041 dbSNP
rs941285060 2056 dbSNP
rs886047633 2057 dbSNP
rs1170887065 2063 dbSNP
rs1047043222 2064 dbSNP
rs1342838556 2070 dbSNP
rs930008269 2071 dbSNP
rs1430019397 2079 dbSNP
rs747342832 2085 dbSNP
rs1184957714 2088 dbSNP
rs976881626 2089 dbSNP
rs1199710432 2092 dbSNP
rs1342651025 2092 dbSNP
rs942832359 2095 dbSNP
rs529351423 2098 dbSNP
rs978968162 2101 dbSNP
rs968956016 2102 dbSNP
rs1467576636 2104 dbSNP
rs576545515 2105 dbSNP
rs1020581251 2111 dbSNP
rs568502944 2112 dbSNP
rs1309592364 2120 dbSNP
rs1271284920 2124 dbSNP
rs956419899 2126 dbSNP
rs1173571713 2138 dbSNP
rs878912281 2141 dbSNP
rs1227282109 2152 dbSNP
rs546695734 2152 dbSNP
rs1418474488 2163 dbSNP
rs1297594057 2168 dbSNP
rs1361251727 2181 dbSNP
rs1371267942 2189 dbSNP
rs1402038632 2193 dbSNP
rs1299495700 2194 dbSNP
rs1305082698 2196 dbSNP
rs1035156590 2199 dbSNP
rs1275281706 2199 dbSNP
rs1349892554 2204 dbSNP
rs1003304038 2208 dbSNP
rs1284631678 2209 dbSNP
rs1366832360 2225 dbSNP
rs904986367 2234 dbSNP
rs1264792297 2253 dbSNP
rs796924843 2254 dbSNP
rs1352582462 2255 dbSNP
rs756622618 2256 dbSNP
rs888351599 2268 dbSNP
rs1046991685 2270 dbSNP
rs150659432 2277 dbSNP
rs901185113 2281 dbSNP
rs1395913913 2286 dbSNP
rs1390272309 2295 dbSNP
rs1195584125 2303 dbSNP
rs1041491297 2308 dbSNP
rs1267308851 2311 dbSNP
rs557049038 2312 dbSNP
rs778278496 2313 dbSNP
rs1372946381 2318 dbSNP
rs942800256 2326 dbSNP
rs1308412512 2327 dbSNP
rs1354378698 2327 dbSNP
rs911333837 2332 dbSNP
rs1263233968 2339 dbSNP
rs1355144520 2343 dbSNP
rs1178325321 2348 dbSNP
rs1481894559 2351 dbSNP
rs1456735102 2359 dbSNP
rs1178466247 2362 dbSNP
rs55805022 2370 dbSNP
rs1239312499 2379 dbSNP
rs865923054 2380 dbSNP
rs190321080 2381 dbSNP
rs1367969285 2383 dbSNP
rs913464454 2389 dbSNP
rs989078206 2393 dbSNP
rs1398433458 2409 dbSNP
rs1231588343 2411 dbSNP
rs886047632 2423 dbSNP
rs956540799 2428 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control HITS-CLIP data was present in GSM1048188. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_ptb_knockdown ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gaCGUCCCUUCACCCUCUCUCu 5'
            |:: | : ||| | | | | 
Target 5' cuGUGUGUGUGUGUGUGUGUGu 3'
 		2 - 23
Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084040. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep1 HITS-CLIP data was present in GSM1084041. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep1 HITS-CLIP data was present in GSM1084042. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep2 HITS-CLIP data was present in GSM1084046. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep4 HITS-CLIP data was present in GSM1084047. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep4 HITS-CLIP data was present in GSM1084066. RNA binding protein: AGO2. Condition:CLIP_noemetine_SantaCruzAb HITS-CLIP data was present in GSM1084068. RNA binding protein: AGO2. Condition:CLIP_noemetine_SigmaAb HITS-CLIP data was present in GSM1084069. RNA binding protein: AGO2. Condition:CLIP_emetine_SigmaAb HITS-CLIP data was present in GSM1084072. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep1_AbnovaAb HITS-CLIP data was present in GSM1084073. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_AbnovaAb HITS-CLIP data was present in GSM1084074. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep1_SantaCruzAb HITS-CLIP data was present in GSM1084075. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_SantaCruzAb HITS-CLIP data was present in GSM1084077. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_SigmaAb HITS-CLIP data was present in GSM1084078. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_AbnovaAb HITS-CLIP data was present in GSM1084079. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_AbnovaAb HITS-CLIP data was present in GSM1084080. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_SantaCruzAb HITS-CLIP data was present in GSM1084081. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_SantaCruzAb HITS-CLIP data was present in GSM1084082. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_SigmaAb HITS-CLIP data was present in GSM1084083. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_SigmaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Cardiac Tissues
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM2202480. RNA binding protein: AGO2. Condition:S5_LV_36yo_Male_AGO2_bound_RNA HITS-CLIP data was present in GSM2202478. RNA binding protein: AGO2. Condition:S3_LV_36yo_Male_AGO2_bound_RNA HITS-CLIP data was present in GSM2202476. RNA binding protein: AGO2. Condition:S1_LV_54yo_Male_AGO2_bound_RNA HITS-CLIP data was present in GSM2202481. RNA binding protein: AGO2. Condition:S6_LV_61yo_Male_AGO2_bound_RNA HITS-CLIP data was present in GSM2202477. RNA binding protein: AGO2. Condition:S2_LV_25yo_Male_AGO2_bound_RNA ...

- Spengler RM; Zhang X; Cheng C; McLendon JM; et al., 2016, Nucleic acids research.

Article - Spengler RM; Zhang X; Cheng C; McLendon JM; et al.
- Nucleic acids research, 2016
MicroRNAs (miRs) have emerged as key biological effectors in human health and disease. These small noncoding RNAs are incorporated into Argonaute (Ago) proteins, where they direct post-transcriptional gene silencing via base-pairing with target transcripts. Although miRs have become intriguing biological entities and attractive therapeutic targets, the translational impacts of miR research remain limited by a paucity of empirical miR targeting data, particularly in human primary tissues. Here, to improve our understanding of the diverse roles miRs play in cardiovascular function and disease, we applied high-throughput methods to globally profile miR:target interactions in human heart tissues. We deciphered Ago2:RNA interactions using crosslinking immunoprecipitation coupled with high-throughput sequencing (HITS-CLIP) to generate the first transcriptome-wide map of miR targeting events in human myocardium, detecting 4000 cardiac Ago2 binding sites across >2200 target transcripts. Our initial exploration of this interactome revealed an abundance of miR target sites in gene coding regions, including several sites pointing to new miR-29 functions in regulating cardiomyocyte calcium, growth and metabolism. Also, we uncovered several clinically-relevant interactions involving common genetic variants that alter miR targeting events in cardiomyopathy-associated genes. Overall, these data provide a critical resource for bolstering translational miR research in heart, and likely beyond.
LinkOut: [PMID: 27418678]
CLIP-seq Support 1 for dataset GSM1048187
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000343115.4 | 3UTR | AGACUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1048188
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_ptb_knockdown
Location of target site ENST00000343115.4 | 3UTR | ACUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUACUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1084040
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep1
Location of target site ENST00000343115.4 | 3UTR | GAGAGACUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1084041
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep1
Location of target site ENST00000343115.4 | 3UTR | GAGAGAGACUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1084042
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep2
Location of target site ENST00000343115.4 | 3UTR | GAGAGAGACUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1084046
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep4
Location of target site ENST00000343115.4 | 3UTR | GAAUGAGAGAGAGACUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1084047
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep4
Location of target site ENST00000343115.4 | 3UTR | GAGAGACUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1084066
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_SantaCruzAb
Location of target site ENST00000343115.4 | 3UTR | GAAUGAGAGAGAGACUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1084068
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_SigmaAb
Location of target site ENST00000343115.4 | 3UTR | GCAAGAGAGAGAGAGAAUGAGAGAGAGACUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM1084069
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_SigmaAb
Location of target site ENST00000343115.4 | 3UTR | GCAAGAGAGAGAGAGAAUGAGAGAGAGACUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset GSM1084072
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep1_AbnovaAb
Location of target site ENST00000343115.4 | 3UTR | GCAAGAGAGAGAGAGAAUGAGAGAGAGACUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 12 for dataset GSM1084073
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_AbnovaAb
Location of target site ENST00000343115.4 | 3UTR | GCAAGAGAGAGAGAGAAUGAGAGAGAGACUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 13 for dataset GSM1084074
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep1_SantaCruzAb
Location of target site ENST00000343115.4 | 3UTR | AGACUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 14 for dataset GSM1084075
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_SantaCruzAb
Location of target site ENST00000343115.4 | 3UTR | AGACUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 15 for dataset GSM1084077
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_SigmaAb
Location of target site ENST00000343115.4 | 3UTR | GAGAGAGACUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 16 for dataset GSM1084078
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep2_AbnovaAb
Location of target site ENST00000343115.4 | 3UTR | GCAAGAGAGAGAGAGAAUGAGAGAGAGACUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 17 for dataset GSM1084079
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_AbnovaAb
Location of target site ENST00000343115.4 | 3UTR | AGCAAGAGAGAGAGAGAAUGAGAGAGAGACUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 18 for dataset GSM1084081
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_SantaCruzAb
Location of target site ENST00000343115.4 | 3UTR | AGACUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 19 for dataset GSM1084082
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep2_SigmaAb
Location of target site ENST00000343115.4 | 3UTR | AGACUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 20 for dataset GSM1084083
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_SigmaAb
Location of target site ENST00000343115.4 | 3UTR | GAGAGAGAGACUGUGUGUGUGUGUGUGUGUGUGUGUGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
342 hsa-miR-7110-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT082983 KHSRP KH-type splicing regulatory protein 2 2
MIRT234314 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT287120 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 2 2
MIRT292290 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT312255 DIAPH1 diaphanous related formin 1 2 2
MIRT384907 ATP2B1 ATPase plasma membrane Ca2+ transporting 1 2 2
MIRT390883 ANTXR2 anthrax toxin receptor 2 2 2
MIRT395373 CDC42EP4 CDC42 effector protein 4 2 2
MIRT396751 RDX radixin 2 4
MIRT442600 SIX1 SIX homeobox 1 2 2
MIRT443088 PTPRN2 protein tyrosine phosphatase, receptor type N2 2 2
MIRT448987 ARL15 ADP ribosylation factor like GTPase 15 2 2
MIRT483987 PANK1 pantothenate kinase 1 2 4
MIRT499233 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT506650 MAPK1 mitogen-activated protein kinase 1 2 6
MIRT512272 ARHGDIA Rho GDP dissociation inhibitor alpha 2 6
MIRT515228 GPATCH11 G-patch domain containing 11 2 6
MIRT520713 TMCO1 transmembrane and coiled-coil domains 1 2 8
MIRT526527 MDM2 MDM2 proto-oncogene 2 6
MIRT526652 C17orf105 chromosome 17 open reading frame 105 2 6
MIRT526668 IL5RA interleukin 5 receptor subunit alpha 2 6
MIRT536723 IGF1R insulin like growth factor 1 receptor 2 2
MIRT537027 GRIN2B glutamate ionotropic receptor NMDA type subunit 2B 2 2
MIRT539905 MTA3 metastasis associated 1 family member 3 2 11
MIRT540192 SH3PXD2A SH3 and PX domains 2A 2 8
MIRT540469 MC2R melanocortin 2 receptor 2 9
MIRT540586 ERCC1 ERCC excision repair 1, endonuclease non-catalytic subunit 2 4
MIRT541343 FRMD3 FERM domain containing 3 2 4
MIRT542703 RPS15A ribosomal protein S15a 2 2
MIRT543153 AKT1 AKT serine/threonine kinase 1 2 2
MIRT543264 ZNF662 zinc finger protein 662 2 2
MIRT551388 EHD3 EH domain containing 3 2 2
MIRT569346 EFHC1 EF-hand domain containing 1 2 2
MIRT571949 LARP1 La ribonucleoprotein domain family member 1 2 2
MIRT575098 Mta3 metastasis associated 3 2 7
MIRT575106 Mc2r melanocortin 2 receptor 2 6
MIRT575132 Myo1f myosin IF 2 4
MIRT575397 Zdhhc22 zinc finger, DHHC-type containing 22 2 3
MIRT575405 Rnf152 ring finger protein 152 2 4
MIRT576209 Baz2a bromodomain adjacent to zinc finger domain, 2A 2 4
MIRT576245 Asah2 N-acylsphingosine amidohydrolase 2 2 5
MIRT606791 RREB1 ras responsive element binding protein 1 2 8
MIRT606862 YAE1D1 Yae1 domain containing 1 2 6
MIRT607087 RNF152 ring finger protein 152 2 5
MIRT607210 ASAH2 N-acylsphingosine amidohydrolase 2 2 7
MIRT607224 ACSM2A acyl-CoA synthetase medium chain family member 2A 2 4
MIRT607235 LINS lines homolog 1 2 4
MIRT607263 GRAMD1B GRAM domain containing 1B 2 6
MIRT607279 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 4
MIRT607299 CD300E CD300e molecule 2 6
MIRT607363 TNS1 tensin 1 2 4
MIRT609543 ADPRH ADP-ribosylarginine hydrolase 2 2
MIRT609568 CATSPER4 cation channel sperm associated 4 2 2
MIRT609691 EMX2 empty spiracles homeobox 2 2 2
MIRT609848 ZNF557 zinc finger protein 557 2 2
MIRT610227 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 5
MIRT610389 FOXE1 forkhead box E1 2 2
MIRT610431 ASAH2B N-acylsphingosine amidohydrolase 2B 2 2
MIRT610765 ARNT aryl hydrocarbon receptor nuclear translocator 2 2
MIRT611103 MYO1F myosin IF 2 5
MIRT611128 STARD7 StAR related lipid transfer domain containing 7 2 2
MIRT611287 PAGR1 PAXIP1 associated glutamate rich protein 1 2 2
MIRT611758 PLA2G7 phospholipase A2 group VII 2 6
MIRT612409 STRN striatin 2 6
MIRT612682 PLXNA4 plexin A4 2 2
MIRT613175 CYLD CYLD lysine 63 deubiquitinase 2 2
MIRT613696 QPRT quinolinate phosphoribosyltransferase 2 2
MIRT613741 GK5 glycerol kinase 5 (putative) 2 4
MIRT613916 POU3F1 POU class 3 homeobox 1 2 2
MIRT614281 WSCD2 WSC domain containing 2 2 2
MIRT614289 NPAP1 nuclear pore associated protein 1 2 2
MIRT614664 ZNF280B zinc finger protein 280B 2 2
MIRT614771 SLC41A2 solute carrier family 41 member 2 2 2
MIRT614854 PLEKHA6 pleckstrin homology domain containing A6 2 4
MIRT614887 PARD3B par-3 family cell polarity regulator beta 2 2
MIRT615052 DCAF12 DDB1 and CUL4 associated factor 12 2 2
MIRT615195 CLUAP1 clusterin associated protein 1 2 2
MIRT615337 ABCC12 ATP binding cassette subfamily C member 12 2 2
MIRT615344 LONRF1 LON peptidase N-terminal domain and ring finger 1 2 2
MIRT615685 NAV2 neuron navigator 2 2 2
MIRT615767 ENTPD5 ectonucleoside triphosphate diphosphohydrolase 5 2 2
MIRT615844 ZDHHC22 zinc finger DHHC-type containing 22 2 3
MIRT615866 HSPA6 heat shock protein family A (Hsp70) member 6 2 2
MIRT615999 WDR59 WD repeat domain 59 2 2
MIRT616246 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 4
MIRT616342 DPF3 double PHD fingers 3 2 2
MIRT617185 GOSR2 golgi SNAP receptor complex member 2 2 4
MIRT617244 SPATS2 spermatogenesis associated serine rich 2 2 2
MIRT617524 SORCS2 sortilin related VPS10 domain containing receptor 2 2 2
MIRT617656 RWDD1 RWD domain containing 1 2 2
MIRT618017 SLC9A3R2 SLC9A3 regulator 2 2 2
MIRT618116 OPRM1 opioid receptor mu 1 2 2
MIRT618226 CST3 cystatin C 2 2
MIRT618407 AGPAT1 1-acylglycerol-3-phosphate O-acyltransferase 1 2 2
MIRT618483 SIGLEC15 sialic acid binding Ig like lectin 15 2 2
MIRT618612 SHOX short stature homeobox 2 2
MIRT618641 ATP6AP1L ATPase H+ transporting accessory protein 1 like 2 2
MIRT619069 BSND barttin CLCNK type accessory beta subunit 2 4
MIRT619105 IFI44L interferon induced protein 44 like 2 2
MIRT619268 QRSL1 glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1 2 4
MIRT619286 FAM26E calcium homeostasis modulator family member 5 2 2
MIRT619365 CFHR5 complement factor H related 5 2 2
MIRT619379 KLHL12 kelch like family member 12 2 2
MIRT619471 PRDM10 PR/SET domain 10 2 4
MIRT619488 QSOX2 quiescin sulfhydryl oxidase 2 2 2
MIRT619509 TXLNB taxilin beta 2 2
MIRT619549 GABRG2 gamma-aminobutyric acid type A receptor gamma2 subunit 2 2
MIRT619941 C8orf33 chromosome 8 open reading frame 33 2 2
MIRT620021 NFAM1 NFAT activating protein with ITAM motif 1 2 2
MIRT620178 EGFLAM EGF like, fibronectin type III and laminin G domains 2 2
MIRT620552 C10orf10 chromosome 10 open reading frame 10 2 4
MIRT620639 RFT1 RFT1 homolog 2 2
MIRT620706 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT620733 CCL16 C-C motif chemokine ligand 16 2 2
MIRT620746 CCR5 C-C motif chemokine receptor 5 (gene/pseudogene) 2 2
MIRT620836 ZNF551 zinc finger protein 551 2 2
MIRT620848 ATG10 autophagy related 10 2 2
MIRT620925 LRRTM2 leucine rich repeat transmembrane neuronal 2 2 2
MIRT621407 VPS18 VPS18, CORVET/HOPS core subunit 2 2
MIRT621435 CABP7 calcium binding protein 7 2 2
MIRT621560 ZFP1 ZFP1 zinc finger protein 2 2
MIRT621911 TAB1 TGF-beta activated kinase 1 (MAP3K7) binding protein 1 2 2
MIRT622036 STAT5A signal transducer and activator of transcription 5A 2 2
MIRT622066 SS18 SS18, nBAF chromatin remodeling complex subunit 2 2
MIRT622119 SPRY3 sprouty RTK signaling antagonist 3 2 2
MIRT622270 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT622511 RBM20 RNA binding motif protein 20 2 2
MIRT622606 PROM1 prominin 1 2 2
MIRT622636 PPAP2B phospholipid phosphatase 3 2 2
MIRT622692 PLSCR1 phospholipid scramblase 1 2 2
MIRT622732 PITPNM3 PITPNM family member 3 2 4
MIRT622776 PGM2L1 phosphoglucomutase 2 like 1 2 2
MIRT622855 PDGFA platelet derived growth factor subunit A 2 2
MIRT622911 PCDH17 protocadherin 17 2 2
MIRT622998 ONECUT3 one cut homeobox 3 2 2
MIRT623104 NLGN4X neuroligin 4, X-linked 2 2
MIRT623123 NEURL1B neuralized E3 ubiquitin protein ligase 1B 2 2
MIRT623537 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT623706 HHAT hedgehog acyltransferase 2 2
MIRT623757 GRID1 glutamate ionotropic receptor delta type subunit 1 2 2
MIRT623770 GPR37L1 G protein-coupled receptor 37 like 1 2 2
MIRT623960 FBXL16 F-box and leucine rich repeat protein 16 2 2
MIRT624045 ELAVL3 ELAV like RNA binding protein 3 2 2
MIRT624120 DNAH10OS dynein axonemal heavy chain 10 opposite strand 2 2
MIRT624261 CSNK2A1 casein kinase 2 alpha 1 2 4
MIRT624460 CALCOCO2 calcium binding and coiled-coil domain 2 2 2
MIRT624470 CADM2 cell adhesion molecule 2 2 2
MIRT624495 CABP4 calcium binding protein 4 2 2
MIRT624742 ANKRD28 ankyrin repeat domain 28 2 2
MIRT625305 SHISA6 shisa family member 6 2 2
MIRT625454 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT625951 OLIG3 oligodendrocyte transcription factor 3 2 2
MIRT626507 ATP1A3 ATPase Na+/K+ transporting subunit alpha 3 2 2
MIRT626523 TSC1 TSC complex subunit 1 2 2
MIRT626909 NRN1 neuritin 1 2 2
MIRT627927 KANSL1 KAT8 regulatory NSL complex subunit 1 2 2
MIRT628036 LSAMP limbic system-associated membrane protein 2 4
MIRT628121 HRK harakiri, BCL2 interacting protein 2 2
MIRT628154 HIP1 huntingtin interacting protein 1 2 2
MIRT628205 FREM2 FRAS1 related extracellular matrix protein 2 2 2
MIRT628762 MX2 MX dynamin like GTPase 2 2 4
MIRT628943 AICDA activation induced cytidine deaminase 2 2
MIRT629759 STK17A serine/threonine kinase 17a 2 2
MIRT629935 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT630149 ZDHHC9 zinc finger DHHC-type containing 9 2 2
MIRT630434 LHX9 LIM homeobox 9 2 2
MIRT632932 FGF9 fibroblast growth factor 9 2 2
MIRT635075 MICA MHC class I polypeptide-related sequence A 2 2
MIRT635101 PLCL1 phospholipase C like 1 (inactive) 2 2
MIRT635195 NFKBID NFKB inhibitor delta 2 2
MIRT635815 KCNK6 potassium two pore domain channel subfamily K member 6 2 2
MIRT636506 GDAP1L1 ganglioside induced differentiation associated protein 1 like 1 2 2
MIRT637301 ACTN2 actinin alpha 2 2 2
MIRT638307 SCO1 SCO1, cytochrome c oxidase assembly protein 2 2
MIRT638340 RCAN1 regulator of calcineurin 1 2 2
MIRT638955 BHLHB9 basic helix-loop-helix family member b9 2 2
MIRT639271 SLC5A12 solute carrier family 5 member 12 2 4
MIRT639355 TBXA2R thromboxane A2 receptor 2 2
MIRT639534 CD86 CD86 molecule 2 2
MIRT640147 CEP104 centrosomal protein 104 2 2
MIRT640425 COG6 component of oligomeric golgi complex 6 2 2
MIRT641232 SEMA3E semaphorin 3E 2 2
MIRT641417 SCN2B sodium voltage-gated channel beta subunit 2 2 2
MIRT641796 USP32 ubiquitin specific peptidase 32 2 2
MIRT642048 KIAA1161 myogenesis regulating glycosidase (putative) 2 2
MIRT642427 STAT3 signal transducer and activator of transcription 3 2 2
MIRT642482 ALDOA aldolase, fructose-bisphosphate A 2 2
MIRT642737 TDRD6 tudor domain containing 6 2 2
MIRT643103 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT643311 TMEM151B transmembrane protein 151B 2 2
MIRT643622 ABCF3 ATP binding cassette subfamily F member 3 2 2
MIRT643734 CTU1 cytosolic thiouridylase subunit 1 2 2
MIRT644061 IQCE IQ motif containing E 2 2
MIRT644162 GIN1 gypsy retrotransposon integrase 1 2 2
MIRT644376 ZNF286A zinc finger protein 286A 2 2
MIRT644519 TADA2A transcriptional adaptor 2A 2 2
MIRT644566 SPOP speckle type BTB/POZ protein 2 2
MIRT645046 ID4 inhibitor of DNA binding 4, HLH protein 2 2
MIRT645311 AGTRAP angiotensin II receptor associated protein 2 2
MIRT645329 C9orf64 chromosome 9 open reading frame 64 2 2
MIRT645337 DHRS3 dehydrogenase/reductase 3 2 2
MIRT645410 FAM110A family with sequence similarity 110 member A 2 2
MIRT645922 PLXNA3 plexin A3 2 2
MIRT645957 TTF2 transcription termination factor 2 2 2
MIRT646210 DUSP10 dual specificity phosphatase 10 2 2
MIRT646553 TMCC2 transmembrane and coiled-coil domain family 2 2 2
MIRT646799 EVC2 EvC ciliary complex subunit 2 2 2
MIRT647231 OR6A2 olfactory receptor family 6 subfamily A member 2 2 2
MIRT647256 PTGDR2 prostaglandin D2 receptor 2 2 2
MIRT647618 IGSF9B immunoglobulin superfamily member 9B 2 2
MIRT647659 FOXL1 forkhead box L1 2 2
MIRT648009 ZNF431 zinc finger protein 431 2 2
MIRT648490 CMBL carboxymethylenebutenolidase homolog 2 2
MIRT649372 ASCL1 achaete-scute family bHLH transcription factor 1 2 2
MIRT649443 HIBADH 3-hydroxyisobutyrate dehydrogenase 2 2
MIRT649458 WDR70 WD repeat domain 70 2 2
MIRT649543 VAMP8 vesicle associated membrane protein 8 2 2
MIRT649554 FAM20B FAM20B, glycosaminoglycan xylosylkinase 2 2
MIRT650273 KLF2 Kruppel like factor 2 2 4
MIRT650443 CPXM2 carboxypeptidase X, M14 family member 2 2 2
MIRT650640 LTF lactotransferrin 2 2
MIRT650825 LZTR1 leucine zipper like transcription regulator 1 2 2
MIRT650951 INMT indolethylamine N-methyltransferase 2 2
MIRT651089 ZNF516 zinc finger protein 516 2 2
MIRT651329 ZCCHC2 zinc finger CCHC-type containing 2 2 2
MIRT651406 ZBTB12 zinc finger and BTB domain containing 12 2 2
MIRT651514 WNT4 Wnt family member 4 2 4
MIRT651571 WDR77 WD repeat domain 77 2 2
MIRT651987 UBE2H ubiquitin conjugating enzyme E2 H 2 4
MIRT652091 TSKU tsukushi, small leucine rich proteoglycan 2 2
MIRT652388 TMEM55A phosphatidylinositol-4,5-bisphosphate 4-phosphatase 2 2 2
MIRT652426 TMEM239 transmembrane protein 239 2 2
MIRT652606 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT652747 TGFA transforming growth factor alpha 2 4
MIRT652810 TBL2 transducin beta like 2 2 2
MIRT653253 SORD sorbitol dehydrogenase 2 2
MIRT653298 SMUG1 single-strand-selective monofunctional uracil-DNA glycosylase 1 2 2
MIRT653344 SMG7 SMG7, nonsense mediated mRNA decay factor 2 2
MIRT653402 SLCO5A1 solute carrier organic anion transporter family member 5A1 2 2
MIRT653508 SLC43A2 solute carrier family 43 member 2 2 2
MIRT653582 SLC35B3 solute carrier family 35 member B3 2 2
MIRT653774 SIX4 SIX homeobox 4 2 2
MIRT653909 SERTAD4 SERTA domain containing 4 2 2
MIRT653937 SERPINC1 serpin family C member 1 2 2
MIRT654248 RIMS4 regulating synaptic membrane exocytosis 4 2 2
MIRT654684 PSMB5 proteasome subunit beta 5 2 2
MIRT654734 PRLR prolactin receptor 2 2
MIRT655437 PALM2-AKAP2 PALM2-AKAP2 readthrough 2 2
MIRT655855 NFE2L1 nuclear factor, erythroid 2 like 1 2 2
MIRT656077 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT656663 LPP LIM domain containing preferred translocation partner in lipoma 2 2
MIRT657297 HOXB5 homeobox B5 2 2
MIRT657410 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 2 2
MIRT657438 HHIP hedgehog interacting protein 2 2
MIRT657633 GPX8 glutathione peroxidase 8 (putative) 2 2
MIRT657864 GJD2 gap junction protein delta 2 2 2
MIRT657952 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT658494 EXOC7 exocyst complex component 7 2 2
MIRT658682 EMP2 epithelial membrane protein 2 2 2
MIRT659026 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 2 2
MIRT659087 DENR density regulated re-initiation and release factor 2 2
MIRT659127 DENND5B DENN domain containing 5B 2 2
MIRT659419 COL4A4 collagen type IV alpha 4 chain 2 2
MIRT660014 C1orf115 chromosome 1 open reading frame 115 2 4
MIRT660297 BICC1 BicC family RNA binding protein 1 2 2
MIRT660782 AKAP2 A-kinase anchoring protein 2 2 2
MIRT660801 AIFM2 apoptosis inducing factor, mitochondria associated 2 2 2
MIRT661570 EPHX2 epoxide hydrolase 2 2 2
MIRT662198 MEI1 meiotic double-stranded break formation protein 1 2 2
MIRT662606 MAGEB4 MAGE family member B4 2 2
MIRT663443 FBXO2 F-box protein 2 2 2
MIRT663794 DDX53 DEAD-box helicase 53 2 2
MIRT664336 RAB8A RAB8A, member RAS oncogene family 2 2
MIRT664751 SAMHD1 SAM and HD domain containing deoxynucleoside triphosphate triphosphohydrolase 1 2 2
MIRT665495 VAPA VAMP associated protein A 2 2
MIRT666450 SETBP1 SET binding protein 1 2 4
MIRT666741 RALY RALY heterogeneous nuclear ribonucleoprotein 2 2
MIRT666827 PRCP prolylcarboxypeptidase 2 2
MIRT667502 LZIC leucine zipper and CTNNBIP1 domain containing 2 2
MIRT667624 LIMCH1 LIM and calponin homology domains 1 2 2
MIRT668226 GABRA1 gamma-aminobutyric acid type A receptor alpha1 subunit 2 2
MIRT669054 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 2 2
MIRT669142 CD200 CD200 molecule 2 2
MIRT669414 ATP9A ATPase phospholipid transporting 9A (putative) 2 2
MIRT671525 SEPT3 septin 3 2 4
MIRT671846 PDE3A phosphodiesterase 3A 2 2
MIRT675441 LEAP2 liver enriched antimicrobial peptide 2 2 2
MIRT698694 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT700023 RPP25 ribonuclease P and MRP subunit p25 2 2
MIRT700227 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT707380 VCAM1 vascular cell adhesion molecule 1 2 2
MIRT708303 MPPE1 metallophosphoesterase 1 2 2
MIRT708310 CDH8 cadherin 8 2 2
MIRT709297 LDLRAD4 low density lipoprotein receptor class A domain containing 4 2 2
MIRT710969 CMKLR1 chemerin chemokine-like receptor 1 2 2
MIRT711207 SMIM14 small integral membrane protein 14 2 2
MIRT711606 LHX5 LIM homeobox 5 2 2
MIRT712464 KCNC3 potassium voltage-gated channel subfamily C member 3 2 2
MIRT712763 SLC35F2 solute carrier family 35 member F2 2 2
MIRT712838 RHOA ras homolog family member A 2 2
MIRT713259 ZFP30 ZFP30 zinc finger protein 2 2
MIRT713386 NLN neurolysin 2 2
MIRT713548 GJB1 gap junction protein beta 1 2 2
MIRT714532 ZBTB39 zinc finger and BTB domain containing 39 2 2
MIRT714568 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 2 2
MIRT714608 EXO5 exonuclease 5 2 2
MIRT715130 ACADL acyl-CoA dehydrogenase, long chain 2 2
MIRT715225 NPVF neuropeptide VF precursor 2 2
MIRT715346 VMP1 vacuole membrane protein 1 2 2
MIRT715920 ACVRL1 activin A receptor like type 1 2 2
MIRT716016 TMPRSS5 transmembrane protease, serine 5 2 2
MIRT716670 PPP6R1 protein phosphatase 6 regulatory subunit 1 2 2
MIRT716805 TMEM196 transmembrane protein 196 2 2
MIRT716881 PHF16 jade family PHD finger 3 1 1
MIRT717303 RNF8 ring finger protein 8 2 2
MIRT717470 ZNF292 zinc finger protein 292 2 2
MIRT718048 GPT2 glutamic--pyruvic transaminase 2 2 2
MIRT718139 PALM paralemmin 2 2
MIRT718501 GYS1 glycogen synthase 1 2 2
MIRT718631 DIP2A disco interacting protein 2 homolog A 2 2
MIRT718719 ANKRD18A ankyrin repeat domain 18A 2 2
MIRT718844 SNX20 sorting nexin 20 2 2
MIRT718909 GALR1 galanin receptor 1 2 2
MIRT718920 TRIM66 tripartite motif containing 66 2 2
MIRT719141 DPYSL5 dihydropyrimidinase like 5 2 2
MIRT719407 B4GALNT3 beta-1,4-N-acetyl-galactosaminyltransferase 3 2 2
MIRT719552 CBLB Cbl proto-oncogene B 2 2
MIRT719642 AP5M1 adaptor related protein complex 5 mu 1 subunit 2 2
MIRT720186 CMC4 C-X9-C motif containing 4 2 2
MIRT720251 FAM83F family with sequence similarity 83 member F 2 2
MIRT720660 C11orf54 chromosome 11 open reading frame 54 2 2
MIRT720939 PPP1R3E protein phosphatase 1 regulatory subunit 3E 2 2
MIRT721090 CCBE1 collagen and calcium binding EGF domains 1 2 2
MIRT721137 SNRK SNF related kinase 2 2
MIRT721656 RPL34 ribosomal protein L34 2 2
MIRT721782 ARL6IP4 ADP ribosylation factor like GTPase 6 interacting protein 4 2 2
MIRT721873 RHOH ras homolog family member H 2 2
MIRT722131 TTLL11 tubulin tyrosine ligase like 11 2 2
MIRT722332 PKHD1 PKHD1, fibrocystin/polyductin 2 2
MIRT724319 CGN cingulin 2 2
MIRT724637 PKDREJ polycystin family receptor for egg jelly 2 2
MIRT725276 OSTM1 osteopetrosis associated transmembrane protein 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-7110-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)

Error report submission