pre-miRNA Information
pre-miRNA hsa-mir-6127   
Genomic Coordinates chr1: 22633258 - 22633366
Description Homo sapiens miR-6127 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6127
Sequence 21| UGAGGGAGUGGGUGGGAGG |39
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 17 1 - 22633330 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1235631264 1 dbSNP
rs1456508376 2 dbSNP
rs961421537 3 dbSNP
rs1017317298 4 dbSNP
rs1188516918 10 dbSNP
rs564733534 16 dbSNP
rs777916911 18 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ATP6V1F   
Synonyms ATP6S14, VATF, Vma7
Description ATPase H+ transporting V1 subunit F
Transcript NM_004231   
Expression
Putative miRNA Targets on ATP6V1F
3'UTR of ATP6V1F
(miRNA target sites are highlighted)
>ATP6V1F|NM_004231|3'UTR
   1 GGGACTCCTCATAGCCCTCAGCCCTTCCCTCGTTTCCAGGCCTCTCCCCAGGCTTGCCATCAGCCTTCTTTACTTTTTGA
  81 GCCTCTGATTTCCAATTCCCTGCTCCTTCCCACTCCATTAAGAGGCTAGGTGAGGCGCTTCTAGGTTGCTGGGGCTCTGC
 161 TGGTTAAGGAACAGGAAGCCTGACCATCTCCCTCCACTACCTCTTCCCTGTGCTGTTACACAGTGTCATTGTTGATGTTA
 241 AATTAAAGTCATATTCTTGCTTCTCTCCAGAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ggaGGGUGGGU-GAGGGAGu 5'
             ||:: ||| ||||||| 
Target 5' aagCCTGACCATCTCCCTCc 3'
176 - 195 156.00 -20.30
2
miRNA  3' ggaGGGUGGGUGAGGGAGu 5'
             |:|| || :|||||| 
Target 5' gccCTCAGCCCTTCCCTCg 3'
14 - 32 144.00 -25.60
3
miRNA  3' ggAGGGU----GGGUGAGGGAGu 5'
            |:|||    ||::||||:|| 
Target 5' atTTCCAATTCCCTGCTCCTTCc 3'
88 - 110 143.00 -20.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26967334 12 COSMIC
COSN2200997 99 COSMIC
COSN31553302 138 COSMIC
COSN26602786 213 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs765655655 6 dbSNP
rs751276747 8 dbSNP
rs1300295671 13 dbSNP
rs200174156 25 dbSNP
rs780760567 28 dbSNP
rs1276135231 29 dbSNP
rs1325565564 30 dbSNP
rs202007585 32 dbSNP
rs1804888 33 dbSNP
rs767146877 34 dbSNP
rs1315402242 36 dbSNP
rs957166764 37 dbSNP
rs1209138942 53 dbSNP
rs1011409083 57 dbSNP
rs1253037312 60 dbSNP
rs1442251720 67 dbSNP
rs1196155197 100 dbSNP
rs1316764690 107 dbSNP
rs1283454354 109 dbSNP
rs973288015 114 dbSNP
rs1235164002 134 dbSNP
rs919075801 137 dbSNP
rs1299705845 138 dbSNP
rs1050684 142 dbSNP
rs1178114070 145 dbSNP
rs929102865 147 dbSNP
rs549270899 149 dbSNP
rs1020573808 150 dbSNP
rs1046195183 153 dbSNP
rs1378502685 179 dbSNP
rs540964737 180 dbSNP
rs1467815861 187 dbSNP
rs3580 192 dbSNP
rs927666606 193 dbSNP
rs1197851382 198 dbSNP
rs987151668 204 dbSNP
rs15498 207 dbSNP
rs1176704721 218 dbSNP
rs964058658 220 dbSNP
rs894093132 225 dbSNP
rs1330636158 230 dbSNP
rs1201796032 238 dbSNP
rs1342489977 245 dbSNP
rs1255087546 251 dbSNP
rs1355044614 269 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166 , TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' ggagggUGGGUGAGGGAGu 5'
                |||  ||||||| 
Target 5' ------ACCAUCUCCCUCc 3'
1 - 13
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177600. RNA binding protein: AGO2. Condition:p53_V_Ago_CLIP_2_2 PAR-CLIP data was present in ERX177602. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_4 PAR-CLIP data was present in ERX177604. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_6 PAR-CLIP data was present in ERX177606. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_8 PAR-CLIP data was present in ERX177612. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_2 PAR-CLIP data was present in ERX177614. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_4 PAR-CLIP data was present in ERX177616. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_6 PAR-CLIP data was present in ERX177618. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_8 PAR-CLIP data was present in ERX177624. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_2 PAR-CLIP data was present in ERX177628. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_6 PAR-CLIP data was present in ERX177629. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_7 PAR-CLIP data was present in ERX177608. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_10 PAR-CLIP data was present in ERX177620. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_10 PAR-CLIP data was present in ERX177632. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_10 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760583. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_A PAR-CLIP data was present in SRX1760597. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_C PAR-CLIP data was present in SRX1760639. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_A PAR-CLIP data was present in SRX1760638. RNA binding protein: AGO2. Condition:AGO-CLIP-PC3-miR148 ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
CLIP-seq Support 1 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000492758.1 | 3UTR | ACCAUCUCCCUCCACUACCUCUUCCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000492758.1 | 3UTR | ACCAUCUCCCUCCACUACCUCUUCCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000492758.1 | 3UTR | ACCAUCUCCCUCCACUACCUCUUCCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
224 hsa-miR-6127 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT083286 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT113617 ATXN7L3B ataxin 7 like 3B 2 2
MIRT134910 CCND2 cyclin D2 2 2
MIRT177172 ARL5B ADP ribosylation factor like GTPase 5B 2 4
MIRT179548 CAPZA1 capping actin protein of muscle Z-line alpha subunit 1 2 2
MIRT180881 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT197052 NKIRAS2 NFKB inhibitor interacting Ras like 2 2 2
MIRT197845 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT267391 TMEM138 transmembrane protein 138 2 2
MIRT312620 G3BP1 G3BP stress granule assembly factor 1 2 2
MIRT350379 CSTF1 cleavage stimulation factor subunit 1 2 2
MIRT366859 ZXDB zinc finger, X-linked, duplicated B 2 4
MIRT374545 AK2 adenylate kinase 2 2 2
MIRT402072 ATP6V1F ATPase H+ transporting V1 subunit F 2 4
MIRT442348 RAB6B RAB6B, member RAS oncogene family 2 2
MIRT442506 OSBP oxysterol binding protein 2 2
MIRT443823 SH3BP5L SH3 binding domain protein 5 like 2 2
MIRT444970 CDH7 cadherin 7 2 2
MIRT445064 C16orf87 chromosome 16 open reading frame 87 2 2
MIRT445323 SMOC1 SPARC related modular calcium binding 1 2 2
MIRT446216 SLC25A44 solute carrier family 25 member 44 2 2
MIRT448107 TCN2 transcobalamin 2 2 2
MIRT448289 ZDHHC3 zinc finger DHHC-type containing 3 2 2
MIRT450258 MED30 mediator complex subunit 30 2 2
MIRT451022 MYH14 myosin heavy chain 14 2 8
MIRT451425 TJP3 tight junction protein 3 2 4
MIRT451930 TMPRSS5 transmembrane protease, serine 5 2 2
MIRT452000 FKBP5 FK506 binding protein 5 2 2
MIRT452359 DLX6 distal-less homeobox 6 2 8
MIRT452462 SORCS2 sortilin related VPS10 domain containing receptor 2 2 2
MIRT453119 HOXC4 homeobox C4 2 2
MIRT453342 PLEKHG2 pleckstrin homology and RhoGEF domain containing G2 2 2
MIRT453485 PITPNM3 PITPNM family member 3 2 2
MIRT453520 C14orf144 chromosome 14 open reading frame 144 2 2
MIRT453553 PRR12 proline rich 12 2 2
MIRT454220 HLA-A major histocompatibility complex, class I, A 2 2
MIRT454302 ZNF134 zinc finger protein 134 2 2
MIRT454394 NRG4 neuregulin 4 2 2
MIRT454486 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 2
MIRT454695 KIAA1644 KIAA1644 2 2
MIRT454955 TPM2 tropomyosin 2 2 2
MIRT455021 UBA1 ubiquitin like modifier activating enzyme 1 2 2
MIRT455137 TBC1D25 TBC1 domain family member 25 2 2
MIRT455294 BCL2L1 BCL2 like 1 2 2
MIRT456535 TMEM63A transmembrane protein 63A 2 2
MIRT457109 DCX doublecortin 2 2
MIRT457438 NOL10 nucleolar protein 10 2 2
MIRT457774 ZC3H12B zinc finger CCCH-type containing 12B 2 4
MIRT458605 KCTD2 potassium channel tetramerization domain containing 2 2 2
MIRT459452 TMEM37 transmembrane protein 37 2 2
MIRT459580 NLGN2 neuroligin 2 2 2
MIRT459929 HHIP hedgehog interacting protein 2 8
MIRT460150 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT460659 IGFBP4 insulin like growth factor binding protein 4 2 2
MIRT460693 RNF157 ring finger protein 157 2 2
MIRT460892 UBE2S ubiquitin conjugating enzyme E2 S 2 2
MIRT461550 ACTR3B ARP3 actin related protein 3 homolog B 2 6
MIRT462035 FAAH fatty acid amide hydrolase 2 2
MIRT462460 GCDH glutaryl-CoA dehydrogenase 2 2
MIRT462806 NTN1 netrin 1 2 2
MIRT463002 ZNF740 zinc finger protein 740 2 2
MIRT463920 WNT3 Wnt family member 3 2 2
MIRT464597 UBN2 ubinuclein 2 2 2
MIRT464656 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 4
MIRT464999 TUBB2A tubulin beta 2A class IIa 2 10
MIRT465022 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT465368 TPM3 tropomyosin 3 2 6
MIRT465426 TP53 tumor protein p53 2 2
MIRT465919 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 4
MIRT465999 TMEM189 transmembrane protein 189 2 4
MIRT467355 SP2 Sp2 transcription factor 2 2
MIRT467775 SLC2A4 solute carrier family 2 member 4 2 2
MIRT467883 SLC22A23 solute carrier family 22 member 23 2 2
MIRT468303 SFT2D2 SFT2 domain containing 2 2 2
MIRT469153 RNF121 ring finger protein 121 2 2
MIRT469170 RNF111 ring finger protein 111 2 2
MIRT469568 RARA retinoic acid receptor alpha 2 2
MIRT469677 RAB5B RAB5B, member RAS oncogene family 2 4
MIRT470152 PSME3 proteasome activator subunit 3 2 2
MIRT470176 PSMD11 proteasome 26S subunit, non-ATPase 11 2 4
MIRT470780 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT471536 PAX5 paired box 5 2 2
MIRT472072 NOVA2 NOVA alternative splicing regulator 2 2 2
MIRT472186 NHP2L1 small nuclear ribonucleoprotein 13 2 2
MIRT472303 NFAT5 nuclear factor of activated T-cells 5 2 2
MIRT472701 MYBL1 MYB proto-oncogene like 1 2 2
MIRT473108 MLXIP MLX interacting protein 2 2
MIRT474786 KIAA0895L KIAA0895 like 2 2
MIRT475143 IP6K1 inositol hexakisphosphate kinase 1 2 2
MIRT475216 IL2RB interleukin 2 receptor subunit beta 2 2
MIRT475441 HYOU1 hypoxia up-regulated 1 2 2
MIRT475636 HMGA1 high mobility group AT-hook 1 2 2
MIRT475767 HDLBP high density lipoprotein binding protein 2 2
MIRT476091 GRB2 growth factor receptor bound protein 2 2 2
MIRT476509 GATAD2A GATA zinc finger domain containing 2A 2 2
MIRT477048 FAM210A family with sequence similarity 210 member A 2 2
MIRT477390 ENTPD7 ectonucleoside triphosphate diphosphohydrolase 7 2 2
MIRT477416 EN2 engrailed homeobox 2 2 2
MIRT478602 CTDSP2 CTD small phosphatase 2 2 2
MIRT478893 CREB3L2 cAMP responsive element binding protein 3 like 2 2 4
MIRT479128 CNBP CCHC-type zinc finger nucleic acid binding protein 2 4
MIRT479246 CHTF8 chromosome transmission fidelity factor 8 2 2
MIRT482311 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT482774 ANKHD1-EIF4EBP3 ANKHD1-EIF4EBP3 readthrough 2 4
MIRT482822 TRAF6 TNF receptor associated factor 6 2 2
MIRT483320 SLC35C2 solute carrier family 35 member C2 2 4
MIRT483343 CHRDL1 chordin like 1 2 8
MIRT483447 ARHGEF6 Rac/Cdc42 guanine nucleotide exchange factor 6 2 6
MIRT483630 NAV2 neuron navigator 2 2 2
MIRT484076 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone 2 4
MIRT484100 EIF4EBP3 eukaryotic translation initiation factor 4E binding protein 3 2 4
MIRT484219 SUMO1 small ubiquitin-like modifier 1 2 6
MIRT484291 AIP aryl hydrocarbon receptor interacting protein 2 4
MIRT484368 GATA6 GATA binding protein 6 2 12
MIRT484388 ZNF710 zinc finger protein 710 2 4
MIRT484440 RAB7A RAB7A, member RAS oncogene family 2 4
MIRT484586 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 2
MIRT484620 SIX3 SIX homeobox 3 2 6
MIRT484854 ZNF70 zinc finger protein 70 2 4
MIRT485005 TNRC6B trinucleotide repeat containing 6B 2 4
MIRT485837 ARF3 ADP ribosylation factor 3 2 2
MIRT486164 TLE3 transducin like enhancer of split 3 2 2
MIRT486440 NDUFA5 NADH:ubiquinone oxidoreductase subunit A5 2 2
MIRT486578 ZNF619 zinc finger protein 619 2 2
MIRT486636 GFRA1 GDNF family receptor alpha 1 2 2
MIRT486696 GLYR1 glyoxylate reductase 1 homolog 2 2
MIRT486799 PARP11 poly(ADP-ribose) polymerase family member 11 2 2
MIRT486870 DPF1 double PHD fingers 1 2 2
MIRT486904 TSPYL4 TSPY like 4 2 4
MIRT487053 C10orf55 chromosome 10 open reading frame 55 2 2
MIRT487141 NCOR2 nuclear receptor corepressor 2 2 2
MIRT487247 KHSRP KH-type splicing regulatory protein 2 2
MIRT487618 C20orf96 chromosome 20 open reading frame 96 2 2
MIRT487705 CDK14 cyclin dependent kinase 14 2 2
MIRT487842 CLSTN1 calsyntenin 1 2 4
MIRT487915 FBXO44 F-box protein 44 2 2
MIRT487965 IQSEC2 IQ motif and Sec7 domain 2 2 2
MIRT488131 GPR107 G protein-coupled receptor 107 2 2
MIRT488200 MAT1A methionine adenosyltransferase 1A 2 2
MIRT488247 DNLZ DNL-type zinc finger 2 4
MIRT488518 CD3E CD3e molecule 2 2
MIRT488889 ASTN2 astrotactin 2 2 4
MIRT488981 REXO2 RNA exonuclease 2 2 2
MIRT489063 STARD3 StAR related lipid transfer domain containing 3 2 2
MIRT489125 PPFIA3 PTPRF interacting protein alpha 3 2 2
MIRT489539 MRE11A MRE11 homolog, double strand break repair nuclease 2 14
MIRT489628 ALS2CL ALS2 C-terminal like 2 2
MIRT489861 ATP2A3 ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 3 2 2
MIRT490305 HOXB13 homeobox B13 2 2
MIRT490664 NKD1 naked cuticle homolog 1 2 6
MIRT490760 SRCIN1 SRC kinase signaling inhibitor 1 2 2
MIRT490839 ADD2 adducin 2 2 2
MIRT491236 KCNA5 potassium voltage-gated channel subfamily A member 5 2 2
MIRT491450 HOXB5 homeobox B5 2 2
MIRT491562 YAE1D1 Yae1 domain containing 1 2 2
MIRT491827 ZBTB7B zinc finger and BTB domain containing 7B 2 2
MIRT492800 PDE4A phosphodiesterase 4A 2 4
MIRT492887 NFIX nuclear factor I X 2 4
MIRT493404 KIAA0513 KIAA0513 2 2
MIRT493682 HAP1 huntingtin associated protein 1 2 2
MIRT493945 EPB41L1 erythrocyte membrane protein band 4.1 like 1 2 2
MIRT494042 DUSP7 dual specificity phosphatase 7 2 4
MIRT494183 CNOT6L CCR4-NOT transcription complex subunit 6 like 2 2
MIRT494713 ARHGAP31 Rho GTPase activating protein 31 2 2
MIRT494903 UCP2 uncoupling protein 2 2 2
MIRT496600 TAGLN transgelin 2 2
MIRT497050 DYRK1B dual specificity tyrosine phosphorylation regulated kinase 1B 2 2
MIRT497289 TMEM119 transmembrane protein 119 2 2
MIRT498945 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 2 2
MIRT499011 CCDC50 coiled-coil domain containing 50 2 2
MIRT499027 MAG myelin associated glycoprotein 2 2
MIRT499525 SBK1 SH3 domain binding kinase 1 2 6
MIRT499568 CCDC88A coiled-coil domain containing 88A 2 2
MIRT499810 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT500176 CHRM3 cholinergic receptor muscarinic 3 2 2
MIRT502241 HOXC6 homeobox C6 2 2
MIRT502323 GIGYF1 GRB10 interacting GYF protein 1 2 4
MIRT503638 POLR2F RNA polymerase II subunit F 2 4
MIRT510642 TMEM167A transmembrane protein 167A 2 4
MIRT511034 NRF1 nuclear respiratory factor 1 2 2
MIRT512917 UBL4A ubiquitin like 4A 2 2
MIRT520184 WBP2 WW domain binding protein 2 2 2
MIRT527099 VSTM5 V-set and transmembrane domain containing 5 2 2
MIRT529299 AGK acylglycerol kinase 2 2
MIRT532910 ZNF385A zinc finger protein 385A 2 2
MIRT537881 EDA2R ectodysplasin A2 receptor 2 2
MIRT543762 UBXN2B UBX domain protein 2B 2 2
MIRT546668 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT550080 TRAPPC2 trafficking protein particle complex 2 2 2
MIRT560282 HRH2 histamine receptor H2 2 2
MIRT560778 RRP7A ribosomal RNA processing 7 homolog A 2 2
MIRT564299 MED26 mediator complex subunit 26 2 2
MIRT568820 TRIM67 tripartite motif containing 67 2 2
MIRT568907 ATP6V1B1 ATPase H+ transporting V1 subunit B1 2 2
MIRT569193 LRRC3C leucine rich repeat containing 3C 2 2
MIRT569696 FMNL3 formin like 3 2 2
MIRT569735 GPR173 G protein-coupled receptor 173 2 2
MIRT569775 SAMD14 sterile alpha motif domain containing 14 2 2
MIRT570218 SLC27A1 solute carrier family 27 member 1 2 2
MIRT570313 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT570536 RPH3A rabphilin 3A 2 2
MIRT570580 OTUD7B OTU deubiquitinase 7B 2 2
MIRT571304 TPCN2 two pore segment channel 2 2 2
MIRT571584 TOB2 transducer of ERBB2, 2 2 2
MIRT573278 NCAPH non-SMC condensin I complex subunit H 2 2
MIRT573669 HES6 hes family bHLH transcription factor 6 2 2
MIRT574435 SLC7A5 solute carrier family 7 member 5 2 2
MIRT608005 BTBD9 BTB domain containing 9 2 2
MIRT621341 SLC11A1 solute carrier family 11 member 1 2 2
MIRT636387 NAV1 neuron navigator 1 2 4
MIRT645810 OMA1 OMA1 zinc metallopeptidase 2 2
MIRT649925 ACTR2 ARP2 actin related protein 2 homolog 2 2
MIRT654189 RNMTL1 mitochondrial rRNA methyltransferase 3 2 2
MIRT661224 SCIMP SLP adaptor and CSK interacting membrane protein 2 2
MIRT661448 MORC4 MORC family CW-type zinc finger 4 2 2
MIRT683122 MED28 mediator complex subunit 28 2 2
MIRT688013 GSN gelsolin 2 2
MIRT702788 IFNAR2 interferon alpha and beta receptor subunit 2 2 2
MIRT710928 ING5 inhibitor of growth family member 5 2 2
MIRT713049 IFRD1 interferon related developmental regulator 1 2 2
MIRT713581 SLC2A8 solute carrier family 2 member 8 2 2
MIRT714786 ATP6V1A ATPase H+ transporting V1 subunit A 2 2
MIRT719787 PRDM12 PR/SET domain 12 2 2
MIRT722678 RRM2 ribonucleotide reductase regulatory subunit M2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-6127 Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-6127 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-6127 Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-6127 Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-6127 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-6127 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-6127 Cisplatin 5460033 NSC119875 approved resistant cell line (A549)

Error report submission