miRTarBase - #MIRT404272


—
pre-miRNA Information
pre-miRNA hsa-mir-3678   
Genomic Coordinates chr17: 75406069 - 75406162
Description Homo sapiens miR-3678 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3678-3p
Sequence 69| CUGCAGAGUUUGUACGGACCGG |90
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs988363493 1 dbSNP
rs753118178 5 dbSNP
rs1424776090 14 dbSNP
rs1475188526 15 dbSNP
rs1163369708 17 dbSNP
rs1174219930 19 dbSNP
rs915488824 20 dbSNP
rs1273558782 21 dbSNP
rs755095016 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PLEKHA8   
Synonyms FAPP2
Description pleckstrin homology domain containing A8
Transcript NM_032639   
Expression
Putative miRNA Targets on PLEKHA8
3'UTR of PLEKHA8
(miRNA target sites are highlighted)		 
>PLEKHA8|NM_032639|3'UTR
   1 CACCAAAACATACCCTGATGAAGATCCTGAACTTCAAGAATGAAGAAAGAATTCCTCACCATTCAGGCAGAAAAAGCAAG
  81 TCACCAAGGGACCTCAAACTTCCTTTCCACAAGATTCTGTGACGGGAAACAATGGGGGAGTATTTCCGAAGTTCTGAGTA
 161 GGAAAAAAGAATGACTCAAATGTATTATTGCCAACCAAGTCGTCAAATCTAATGTCAAGTTCTCTTAAGCAGGTAAGAAC
 241 TCAGAACATAATACCTGAGTGCCTTCTTAAGGAAACCATTTGATAGGAAAGATGAACCAAATAACTCAATGATGGATGAG
 321 CTGGTAGAAAAAAAGCTGGTGGTGAACCAAGGTCAAACTGGAAATTATAGTCACAGTATAGATATAGATTATAAATATTA
 401 CAAACCCTAAGATAGCTAATAAATTGGGAATGGGAGAAGGGAGGATATAAGAGCACTAATGCCCTCTTATTTTCATAGCA
 481 GAGACTTGATACTGTCTCAACTTTTTTCAAAAACACAATTTCTTAAATTTTTTGGTAATCTTTTAAATAAACAGATTTCT
 561 AAAAAGAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ggccAGGCA---UGUU-UGAGACGUc 5'
              ||| |   |||| |:||||:: 
Target 5' aactTCCTTTCCACAAGATTCTGTGa 3'
 97 - 122 114.00 -13.30
2 
miRNA  3' ggccAGGCAUGUUUGAGACguc 5'
              ||||   ||::||||   
Target 5' tattTCCG---AAGTTCTGagt 3'
 141 - 159 103.00 -11.70
3 
miRNA  3' ggccagGCAUGUUU--GAGA---CGUc 5'
                :|| |||:  ||||   ||| 
Target 5' atctaaTGT-CAAGTTCTCTTAAGCAg 3'
 207 - 232 101.00 -12.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN25106691 34 COSMIC
COSN30113105 53 COSMIC
COSN30167886 91 COSMIC
COSN20075848 125 COSMIC
COSN18811870 147 COSMIC
COSN30113783 223 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1006862725 4 dbSNP
rs1019615107 7 dbSNP
rs758730528 13 dbSNP
rs752103875 14 dbSNP
rs1234527100 17 dbSNP
rs77266350 18 dbSNP
rs1192743464 19 dbSNP
rs1393075227 23 dbSNP
rs1429731174 27 dbSNP
rs1452759727 28 dbSNP
rs368450760 36 dbSNP
rs1425883179 37 dbSNP
rs372108661 42 dbSNP
rs774324562 43 dbSNP
rs878933264 47 dbSNP
rs763915278 48 dbSNP
rs1325598829 50 dbSNP
rs1403859712 53 dbSNP
rs1421872390 56 dbSNP
rs748192313 60 dbSNP
rs375430992 62 dbSNP
rs1246741144 66 dbSNP
rs187539823 67 dbSNP
rs1468560517 68 dbSNP
rs1196385824 72 dbSNP
rs367614227 73 dbSNP
rs989953991 77 dbSNP
rs914455192 79 dbSNP
rs1477379459 83 dbSNP
rs1273264994 85 dbSNP
rs748363037 96 dbSNP
rs1426788657 98 dbSNP
rs1417532165 108 dbSNP
rs948640362 114 dbSNP
rs116939442 124 dbSNP
rs78818370 125 dbSNP
rs745679433 126 dbSNP
rs531007540 134 dbSNP
rs1036808898 139 dbSNP
rs1321458581 146 dbSNP
rs771847547 148 dbSNP
rs1435810237 149 dbSNP
rs1046240710 155 dbSNP
rs1388663854 156 dbSNP
rs1176101999 182 dbSNP
rs1475125016 185 dbSNP
rs995647182 191 dbSNP
rs1048603774 195 dbSNP
rs192523667 197 dbSNP
rs1481321498 199 dbSNP
rs561254692 202 dbSNP
rs1020026215 203 dbSNP
rs775461557 207 dbSNP
rs999952644 210 dbSNP
rs1234707281 211 dbSNP
rs1347140575 212 dbSNP
rs1299083577 213 dbSNP
rs1354792526 220 dbSNP
rs528433113 234 dbSNP
rs1298990836 236 dbSNP
rs1409386261 240 dbSNP
rs759468549 244 dbSNP
rs957937907 245 dbSNP
rs1288298075 248 dbSNP
rs1010530946 249 dbSNP
rs145064152 252 dbSNP
rs1198922626 253 dbSNP
rs958122242 255 dbSNP
rs1174510399 256 dbSNP
rs386711739 264 dbSNP
rs149087345 265 dbSNP
rs184246044 266 dbSNP
rs1177561519 290 dbSNP
rs746939386 294 dbSNP
rs989901415 300 dbSNP
rs951500654 306 dbSNP
rs914443888 309 dbSNP
rs969938299 310 dbSNP
rs1211401627 317 dbSNP
rs1421250673 322 dbSNP
rs980069624 325 dbSNP
rs1161286319 328 dbSNP
rs1485187743 329 dbSNP
rs189058366 335 dbSNP
rs941367376 337 dbSNP
rs1318836415 340 dbSNP
rs1055770518 341 dbSNP
rs1227830787 353 dbSNP
rs938339383 365 dbSNP
rs1348936737 369 dbSNP
rs1405943087 372 dbSNP
rs1295336949 376 dbSNP
rs1324280761 377 dbSNP
rs1301641872 385 dbSNP
rs1373197929 386 dbSNP
rs1455764712 391 dbSNP
rs569543012 402 dbSNP
rs1346271427 404 dbSNP
rs916502577 413 dbSNP
rs1308737330 429 dbSNP
rs1377967409 435 dbSNP
rs1188138645 438 dbSNP
rs1037119118 448 dbSNP
rs1253758901 450 dbSNP
rs1486177558 476 dbSNP
rs1241579953 480 dbSNP
rs373207770 481 dbSNP
rs536740387 489 dbSNP
rs1327095554 493 dbSNP
rs918308336 495 dbSNP
rs79752857 519 dbSNP
rs1234091336 528 dbSNP
rs1211026086 533 dbSNP
rs1048591508 538 dbSNP
rs796218445 541 dbSNP
rs555715875 544 dbSNP
rs1311094515 545 dbSNP
rs567356743 547 dbSNP
rs906355240 549 dbSNP
rs775620320 562 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 84725.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ggccaggcAUGUU--UGAGACGuc 5'
                  ||| |  |||||||  
Target 5' gaaaaaaaUACCACUACUCUGC-- 3'
 		15 - 36
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_001197026 | 3UTR | UACUCUGCAAUGCAAAAGUCUUCAAAAUUCUUUGUUUCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000449726.1 | 3UTR | CCUUUAAUUAAAAGGAAAAAAAUACCACUACUCUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LIHC -0.489 0.09 -0.400 0.14 9 Click to see details
LUSC -0.371 0.31 -0.400 0.3 4 Click to see details
HNSC -0.067 0.42 -0.191 0.29 11 Click to see details
HNSC -0.067 0.42 -0.191 0.29 11 Click to see details
HNSC -0.067 0.42 -0.191 0.29 11 Click to see details
HNSC -0.067 0.42 -0.191 0.29 11 Click to see details
HNSC -0.067 0.42 -0.191 0.29 11 Click to see details
HNSC -0.067 0.42 -0.191 0.29 11 Click to see details
HNSC -0.067 0.42 -0.191 0.29 11 Click to see details
HNSC -0.067 0.42 -0.191 0.29 11 Click to see details
HNSC -0.067 0.42 -0.191 0.29 11 Click to see details
HNSC -0.067 0.42 -0.191 0.29 11 Click to see details
86 hsa-miR-3678-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT074327 TNRC6A trinucleotide repeat containing 6A 2 10
MIRT107705 CLTA clathrin light chain A 2 2
MIRT114113 AGO1 argonaute 1, RISC catalytic component 2 2
MIRT155293 IFNAR2 interferon alpha and beta receptor subunit 2 2 4
MIRT159171 NRBP1 nuclear receptor binding protein 1 2 2
MIRT185795 ZNF678 zinc finger protein 678 2 2
MIRT282672 SYNM synemin 2 2
MIRT294386 ZNF264 zinc finger protein 264 2 2
MIRT295818 CHMP4B charged multivesicular body protein 4B 2 2
MIRT332777 CAPRIN1 cell cycle associated protein 1 2 4
MIRT334112 PPP6R3 protein phosphatase 6 regulatory subunit 3 2 2
MIRT340971 IPO5 importin 5 2 2
MIRT354679 CDV3 CDV3 homolog 2 2
MIRT366662 PLP2 proteolipid protein 2 2 2
MIRT404272 PLEKHA8 pleckstrin homology domain containing A8 2 2
MIRT447536 RNF165 ring finger protein 165 2 2
MIRT449139 UQCRB ubiquinol-cytochrome c reductase binding protein 2 2
MIRT451301 LGALS3BP galectin 3 binding protein 2 2
MIRT451488 FOPNL FGFR1OP N-terminal like 2 2
MIRT455198 GNL1 G protein nucleolar 1 (putative) 2 2
MIRT459215 MRPS21 mitochondrial ribosomal protein S21 2 2
MIRT461764 MPDU1 mannose-P-dolichol utilization defect 1 2 2
MIRT463273 ZFX zinc finger protein, X-linked 2 2
MIRT464862 UBB ubiquitin B 2 8
MIRT464950 TWIST1 twist family bHLH transcription factor 1 2 2
MIRT467378 SON SON DNA binding protein 2 4
MIRT469282 RHOA ras homolog family member A 2 2
MIRT470293 PPTC7 PTC7 protein phosphatase homolog 2 2
MIRT470639 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT477163 FABP3 fatty acid binding protein 3 2 2
MIRT477686 EFHD2 EF-hand domain family member D2 2 2
MIRT479725 CCNF cyclin F 2 2
MIRT481726 APH1A aph-1 homolog A, gamma-secretase subunit 2 2
MIRT485673 CCDC64 BICD family like cargo adaptor 1 2 2
MIRT498280 PADI2 peptidyl arginine deiminase 2 2 2
MIRT499921 GPX8 glutathione peroxidase 8 (putative) 2 2
MIRT503616 SLC25A36 solute carrier family 25 member 36 2 4
MIRT506927 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 6
MIRT507348 FAM129A family with sequence similarity 129 member A 2 6
MIRT508265 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT508284 YES1 YES proto-oncogene 1, Src family tyrosine kinase 2 4
MIRT509353 COPS8 COP9 signalosome subunit 8 2 2
MIRT510892 RAB1A RAB1A, member RAS oncogene family 2 4
MIRT511882 GAS1 growth arrest specific 1 2 6
MIRT511990 E2F1 E2F transcription factor 1 2 4
MIRT512239 ARPP19 cAMP regulated phosphoprotein 19 2 4
MIRT512392 BUB1 BUB1 mitotic checkpoint serine/threonine kinase 2 4
MIRT514086 EPS15L1 epidermal growth factor receptor pathway substrate 15 like 1 2 6
MIRT514358 UBBP4 ubiquitin B pseudogene 4 2 6
MIRT523149 HNRNPU heterogeneous nuclear ribonucleoprotein U 2 2
MIRT525511 FSIP2 fibrous sheath interacting protein 2 2 2
MIRT526333 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT529962 ZNF71 zinc finger protein 71 2 2
MIRT530337 GABRB3 gamma-aminobutyric acid type A receptor beta3 subunit 2 2
MIRT530884 PHOX2A paired like homeobox 2a 2 2
MIRT533097 YOD1 YOD1 deubiquitinase 2 2
MIRT533250 VCAM1 vascular cell adhesion molecule 1 2 2
MIRT534786 RAB8B RAB8B, member RAS oncogene family 2 2
MIRT537917 DSTYK dual serine/threonine and tyrosine protein kinase 2 2
MIRT547799 JARID2 jumonji and AT-rich interaction domain containing 2 2 2
MIRT548714 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT555509 PMEPA1 prostate transmembrane protein, androgen induced 1 2 2
MIRT555984 NFYB nuclear transcription factor Y subunit beta 2 2
MIRT557942 FAM222B family with sequence similarity 222 member B 2 2
MIRT560830 ZNF786 zinc finger protein 786 2 2
MIRT562720 ZNF714 zinc finger protein 714 2 2
MIRT565337 TMEM104 transmembrane protein 104 2 2
MIRT614453 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT639474 SLC6A4 solute carrier family 6 member 4 2 2
MIRT644056 IQCE IQ motif containing E 2 2
MIRT651652 VWA1 von Willebrand factor A domain containing 1 2 2
MIRT651866 UNC119B unc-119 lipid binding chaperone B 2 2
MIRT653490 SLC43A2 solute carrier family 43 member 2 2 2
MIRT657039 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT657985 GAN gigaxonin 2 2
MIRT672117 ATP6V0A2 ATPase H+ transporting V0 subunit a2 2 2
MIRT683583 GSTCD glutathione S-transferase C-terminal domain containing 2 2
MIRT688689 CPS1 carbamoyl-phosphate synthase 1 2 2
MIRT695375 NSA2 NSA2, ribosome biogenesis homolog 2 2
MIRT696351 EIF2S3 eukaryotic translation initiation factor 2 subunit gamma 2 2
MIRT700614 PRKAA2 protein kinase AMP-activated catalytic subunit alpha 2 2 2
MIRT703512 FKBP15 FK506 binding protein 15 2 2
MIRT705051 C5orf15 chromosome 5 open reading frame 15 2 2
MIRT705180 BTG1 BTG anti-proliferation factor 1 2 2
MIRT709409 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT721053 DCC DCC netrin 1 receptor 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3678-3p Platinum 23939 resistant tissue
hsa-miR-3678-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3678-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-3678-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission