pre-miRNA Information
pre-miRNA hsa-mir-4477a   
Genomic Coordinates chr9: 41233755 - 41233835
Description Homo sapiens miR-4477a stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4477a
Sequence 48| CUAUUAAGGACAUUUGUGAUUC |69
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1281813060 1 dbSNP
rs1352899679 1 dbSNP
rs1283566158 2 dbSNP
rs1236244724 4 dbSNP
rs75019967 4 dbSNP
rs1348124293 5 dbSNP
rs34026740 8 dbSNP
rs1288237115 9 dbSNP
rs71262206 10 dbSNP
rs1355759977 11 dbSNP
rs1300249508 16 dbSNP
rs1328879592 18 dbSNP
rs139133717 20 dbSNP
Putative Targets

Gene Information
Gene Symbol YDJC   
Synonyms -
Description YdjC chitooligosaccharide deacetylase homolog
Transcript NM_001017964   
Expression
Putative miRNA Targets on YDJC
3'UTR of YDJC
(miRNA target sites are highlighted)
>YDJC|NM_001017964|3'UTR
   1 CCCCCTACAGACAACCAAGCACTAATCCCCTTAGTACCAAGAAAGGGGAGCCAGGATTTAGTCCTGGCCCAGCCCAGAGC
  81 TGGGACCTGGAGCACGATCTGTTGACTTCCCTGGGTAGGACACTGCCACCTCTGGGCTCAGGTCCTCATGCCTCCAAATG
 161 GCATCTAGAGTTTGAGCAGCCTTCTTGGCTGCAGGCAGGCCTAGCCTGTGGCAGCGGGCTAGGGCCCGCAGAGCATTTGG
 241 TGCCCCTCCATGTTGCAATGCAAACACCTTCACCACTGGGGCAGTGGGGAGAGATGGCTATATTAATAAAATAACGTGTG
 321 TCTTTCAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' cuUAGUGUUUACAGGAAUUAUc 5'
            | ||| |||  |||||:|| 
Target 5' caAGCACTAATCCCCTTAGTAc 3'
16 - 37 152.00 -10.60
2
miRNA  3' cuUAGUGUUUACAGGAA-UUAUC 5'
            || ||: :||||:|| || | 
Target 5' aaATAACGTGTGTCTTTCAAAAA 3'
309 - 331 96.00 -8.07
3
miRNA  3' cuuaGUGUUUACAGGAAUUAUc 5'
              |:||:| |  :||::|: 
Target 5' ggccCGCAGA-GCATTTGGTGc 3'
223 - 243 89.00 -7.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN27005387 23 COSMIC
COSN19019974 25 COSMIC
COSN31575458 41 COSMIC
COSN30141105 81 COSMIC
COSN31480928 90 COSMIC
COSN27005386 96 COSMIC
COSN31581768 96 COSMIC
COSN30150342 132 COSMIC
COSN30526568 136 COSMIC
COSN31481275 168 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1218920821 1 dbSNP
rs765698797 3 dbSNP
rs1490840640 5 dbSNP
rs1272786643 10 dbSNP
rs746075301 15 dbSNP
rs983767330 16 dbSNP
rs951141342 18 dbSNP
rs368164856 32 dbSNP
rs760096487 35 dbSNP
rs1296002866 36 dbSNP
rs754436694 45 dbSNP
rs766825554 47 dbSNP
rs1003692173 53 dbSNP
rs1257032268 57 dbSNP
rs906305899 61 dbSNP
rs1180139120 65 dbSNP
rs1264003817 68 dbSNP
rs551376406 69 dbSNP
rs1238857872 93 dbSNP
rs1213192475 95 dbSNP
rs1352796770 104 dbSNP
rs368181392 107 dbSNP
rs528735816 122 dbSNP
rs1359635063 123 dbSNP
rs1465506167 134 dbSNP
rs12165618 137 dbSNP
rs566063891 139 dbSNP
rs971227325 145 dbSNP
rs12158674 148 dbSNP
rs893687685 153 dbSNP
rs1337983590 165 dbSNP
rs1054131098 172 dbSNP
rs1225690772 182 dbSNP
rs1302437232 183 dbSNP
rs1312099821 191 dbSNP
rs1208690151 192 dbSNP
rs935987396 194 dbSNP
rs1228964894 196 dbSNP
rs1381351626 201 dbSNP
rs1287409851 204 dbSNP
rs1488690139 215 dbSNP
rs529402438 216 dbSNP
rs1017377339 222 dbSNP
rs1481562408 223 dbSNP
rs181013349 225 dbSNP
rs1425672879 226 dbSNP
rs543520905 227 dbSNP
rs1300461508 228 dbSNP
rs1423086919 235 dbSNP
rs759622863 242 dbSNP
rs1297047906 245 dbSNP
rs922721345 251 dbSNP
rs779423811 254 dbSNP
rs866237962 255 dbSNP
rs188657262 263 dbSNP
rs910114480 265 dbSNP
rs1046843 275 dbSNP
rs984794741 277 dbSNP
rs951692103 288 dbSNP
rs934072431 291 dbSNP
rs564302296 296 dbSNP
rs1415323578 300 dbSNP
rs1355052031 302 dbSNP
rs371683483 304 dbSNP
rs1239471643 315 dbSNP
rs1490896390 322 dbSNP
rs772287238 322 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM4903829
Method / RBP HITS-CLIP / AGO
Cell line / Condition Human neurons / CTLTD_shCTL_a
Location of target site NM_001017964 | 3UTR | GGCUAUAUUAAUAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161238
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000398873.3 | 3UTR | CUAUAUUAAUAAAAUAACGUGUGUCUUUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
134 hsa-miR-4477a Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055843 PLEKHA1 pleckstrin homology domain containing A1 2 10
MIRT061259 AMOTL1 angiomotin like 1 2 4
MIRT071895 BTF3L4 basic transcription factor 3 like 4 2 6
MIRT076933 MLLT6 MLLT6, PHD finger containing 2 2
MIRT078652 ICT1 mitochondrial ribosomal protein L58 2 2
MIRT083633 PRNP prion protein 2 2
MIRT091629 RPL15 ribosomal protein L15 2 4
MIRT107076 PPP6C protein phosphatase 6 catalytic subunit 2 2
MIRT111191 TRIM33 tripartite motif containing 33 2 2
MIRT114515 ARF6 ADP ribosylation factor 6 2 2
MIRT175250 PSAT1 phosphoserine aminotransferase 1 2 4
MIRT175430 ACSL4 acyl-CoA synthetase long chain family member 4 2 2
MIRT178687 FAM102B family with sequence similarity 102 member B 2 2
MIRT189771 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT229450 RPL10 ribosomal protein L10 2 2
MIRT244899 PHF6 PHD finger protein 6 2 2
MIRT249189 AKIRIN1 akirin 1 2 8
MIRT261134 TRIM8 tripartite motif containing 8 2 2
MIRT275561 ZIC5 Zic family member 5 2 4
MIRT275652 ABHD13 abhydrolase domain containing 13 2 2
MIRT288082 UTP18 UTP18, small subunit processome component 2 2
MIRT303605 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 2
MIRT307924 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT316787 FOXC1 forkhead box C1 2 2
MIRT326910 SCML2 Scm polycomb group protein like 2 2 2
MIRT327713 SPIN4 spindlin family member 4 2 2
MIRT331632 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 2 2
MIRT342506 TMOD3 tropomodulin 3 2 4
MIRT354470 LRRC58 leucine rich repeat containing 58 2 2
MIRT378711 TRIM24 tripartite motif containing 24 2 2
MIRT407462 YDJC YdjC chitooligosaccharide deacetylase homolog 2 2
MIRT408226 SMAD5 SMAD family member 5 2 4
MIRT441824 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT442783 CHD8 chromodomain helicase DNA binding protein 8 2 2
MIRT443184 NHS NHS actin remodeling regulator 2 4
MIRT447615 CUL3 cullin 3 2 2
MIRT450156 DSEL dermatan sulfate epimerase-like 2 2
MIRT454801 NEDD9 neural precursor cell expressed, developmentally down-regulated 9 2 2
MIRT463050 ZNF644 zinc finger protein 644 2 2
MIRT467400 SOCS3 suppressor of cytokine signaling 3 2 2
MIRT468174 SGMS1 sphingomyelin synthase 1 2 2
MIRT468949 RPS14 ribosomal protein S14 2 6
MIRT469835 R3HDM4 R3H domain containing 4 2 2
MIRT470724 POFUT1 protein O-fucosyltransferase 1 2 2
MIRT470902 PLIN3 perilipin 3 2 2
MIRT472467 NAPG NSF attachment protein gamma 2 12
MIRT472602 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT492350 SEMA7A semaphorin 7A (John Milton Hagen blood group) 2 2
MIRT493840 FOXN3 forkhead box N3 2 4
MIRT496318 DOCK9 dedicator of cytokinesis 9 2 2
MIRT500159 CLEC2D C-type lectin domain family 2 member D 2 8
MIRT500535 XPO4 exportin 4 2 4
MIRT503916 FBXL13 F-box and leucine rich repeat protein 13 2 4
MIRT504003 SAT1 spermidine/spermine N1-acetyltransferase 1 2 4
MIRT505647 SHMT1 serine hydroxymethyltransferase 1 2 4
MIRT506574 MIER3 MIER family member 3 2 4
MIRT506945 HS3ST3B1 heparan sulfate-glucosamine 3-sulfotransferase 3B1 2 4
MIRT508196 RPS19 ribosomal protein S19 2 6
MIRT511417 HSPA13 heat shock protein family A (Hsp70) member 13 2 4
MIRT512326 ACTB actin beta 2 4
MIRT515376 RPL7 ribosomal protein L7 2 2
MIRT520422 TUBG1 tubulin gamma 1 2 4
MIRT524844 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT526320 UGT2A1 UDP glucuronosyltransferase family 2 member A1 complex locus 2 2
MIRT526561 UGT2A2 UDP glucuronosyltransferase family 2 member A2 2 2
MIRT528027 FEZ2 fasciculation and elongation protein zeta 2 2 2
MIRT529874 RBM43 RNA binding motif protein 43 2 2
MIRT530826 CLEC4D C-type lectin domain family 4 member D 2 2
MIRT531334 GDPD1 glycerophosphodiester phosphodiesterase domain containing 1 2 2
MIRT532068 CCNB1 cyclin B1 2 4
MIRT532870 ZNF566 zinc finger protein 566 2 2
MIRT535580 NUP35 nucleoporin 35 2 2
MIRT537644 ERGIC2 ERGIC and golgi 2 2 4
MIRT537725 ELAVL2 ELAV like RNA binding protein 2 2 2
MIRT538894 BRI3BP BRI3 binding protein 2 2
MIRT538945 BMP2K BMP2 inducible kinase 2 2
MIRT540703 PDPK1 3-phosphoinositide dependent protein kinase 1 2 4
MIRT543210 TMEM117 transmembrane protein 117 2 3
MIRT543357 LYRM2 LYR motif containing 2 2 2
MIRT544905 CLSPN claspin 2 2
MIRT545532 ARF3 ADP ribosylation factor 3 2 2
MIRT546446 SMOC1 SPARC related modular calcium binding 1 2 2
MIRT546882 PURB purine rich element binding protein B 2 4
MIRT547440 MED13 mediator complex subunit 13 2 2
MIRT548027 GOLIM4 golgi integral membrane protein 4 2 2
MIRT548673 CRNKL1 crooked neck pre-mRNA splicing factor 1 2 2
MIRT550435 LLGL2 LLGL2, scribble cell polarity complex component 2 2
MIRT551850 RPS3 ribosomal protein S3 2 2
MIRT556072 MRFAP1 Morf4 family associated protein 1 2 2
MIRT556554 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT557132 HOXA13 homeobox A13 2 2
MIRT557875 FEM1B fem-1 homolog B 2 4
MIRT558146 ELK4 ELK4, ETS transcription factor 2 2
MIRT558862 CD2AP CD2 associated protein 2 2
MIRT558884 CCNE1 cyclin E1 2 4
MIRT558907 CBX5 chromobox 5 2 2
MIRT559175 BRAP BRCA1 associated protein 2 2
MIRT560860 GAL3ST3 galactose-3-O-sulfotransferase 3 2 2
MIRT561729 PPIF peptidylprolyl isomerase F 2 2
MIRT564024 CEBPB CCAAT/enhancer binding protein beta 2 2
MIRT564366 TRMT5 tRNA methyltransferase 5 2 2
MIRT564609 ZNF703 zinc finger protein 703 2 2
MIRT565494 AZF1 azoospermia factor 1 2 2
MIRT565577 SLC6A8 solute carrier family 6 member 8 2 2
MIRT566947 LEPROT leptin receptor overlapping transcript 2 2
MIRT567293 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT567308 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT568048 CHSY1 chondroitin sulfate synthase 1 2 2
MIRT571807 PHF19 PHD finger protein 19 2 2
MIRT609234 RBM23 RNA binding motif protein 23 2 2
MIRT610328 SSX5 SSX family member 5 2 2
MIRT611428 UGT8 UDP glycosyltransferase 8 2 4
MIRT611709 SLFN13 schlafen family member 13 2 2
MIRT612069 CEP135 centrosomal protein 135 2 4
MIRT617676 JRKL JRK like 2 2
MIRT623684 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT635634 PRR15L proline rich 15 like 2 2
MIRT636422 MBOAT2 membrane bound O-acyltransferase domain containing 2 2 2
MIRT637011 GPATCH11 G-patch domain containing 11 2 2
MIRT644150 C4orf3 chromosome 4 open reading frame 3 2 2
MIRT648562 MEMO1 mediator of cell motility 1 2 2
MIRT650752 WNT16 Wnt family member 16 2 2
MIRT651914 UEVLD UEV and lactate/malate dehyrogenase domains 2 2
MIRT653556 SLC38A7 solute carrier family 38 member 7 2 2
MIRT692277 XRN2 5'-3' exoribonuclease 2 2 2
MIRT697650 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT703876 ERCC6 ERCC excision repair 6, chromatin remodeling factor 2 2
MIRT704615 CLIP1 CAP-Gly domain containing linker protein 1 2 2
MIRT708562 BBOX1 gamma-butyrobetaine hydroxylase 1 2 2
MIRT709614 KBTBD6 kelch repeat and BTB domain containing 6 2 2
MIRT712955 SGCD sarcoglycan delta 2 2
MIRT713502 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT720239 GPBP1 GC-rich promoter binding protein 1 2 2
MIRT724255 GLUD1 glutamate dehydrogenase 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4477a Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-4477a Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-4477a Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)

Error report submission