miRTarBase - #MIRT435011


—
pre-miRNA Information
pre-miRNA mmu-mir-350   
Genomic Coordinates chr1: 176772325 - 176772423
Synonyms Mirn350, mmu-mir-350, Mir350
Description Mus musculus miR-350 stem-loop
Comment Kim et al. cloned 40 new miRNAs from rat E18 primary cortical neurons .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-350-3p
Sequence 61| UUCACAAAGCCCAUACACUUUC |82
Evidence Experimental
Experiments Cloned
Putative Targets

Gene Information
Gene Symbol Lars2   
Synonyms AI035546, Kiaa0028, LEURS
Description leucyl-tRNA synthetase, mitochondrial
Transcript NM_153168   
Expression
Putative miRNA Targets on Lars2
3'UTR of Lars2
(miRNA target sites are highlighted)		 
>Lars2|NM_153168|3'UTR
   1 CCAGGGCTTCTAGGACCCTCCTTCTCTGCCCAGATCAAGGGAAGGAATGTTAACGTGGGAAAAAAGGCAAACATCAGGGA
  81 CATTGGCCTTTGTGCCAGGACCAGCAGGAGTCAGCAGGAGGCCTAAGGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGA
 161 GCAGAAGGGCAAAAGCTCGCTTGATCTTGATTTTCAGTAGGAATACAGACCGTGAAAGCGGGGCCTCACGATCCTTCTGA
 241 CCTTTTGGGTTTTAAGCAGGATGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTGGCGGCCAAGCGTTCATAGCGA
 321 CGTCGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGCGTTGGATTGTTCACCCAC
 401 TAATAGGGAACGTGAGCTGGGATTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGATGTGTTGTTGCCATGGT
 481 AATCCTGCTCAGTACGAGAGGAACCGCAGCTAGCTTGTGTCTCCAGTGTCTTTTACCATCACAGGCCCTGGCTCTGTGCT
 561 ACCTCCCTAGAATACCTGTGGTTCATCACCTTCAGCTCACACTCCATTCAGACAATGCTCACTTAGGCCTACAAGCAAGG
 641 GAGAGGCTTAAGCACAAGGTCTTTAAGCTTGATACTGTGCCTGGTCTCAATGCCTAGAAATTCCAACTTAACTGTCGCTA
 721 TCATAAAGGATTTTAAATTTTTTTACAAGTGAGAACCTAGCATGTCAAGGTCCTAGGTTCCATCTCCAACACGAAAAAAG
 801 CAAGGCAACTCTACCAAAGAAACTAATTACATACTTGTATTCCCAATATGTGAGAAGCTGAGGAAGGAGGATCATGAGTT
 881 TAAAGCCATCCTTGGTTACATGAGACTCTTGTCTCAAAGAACTACCAGGGATCCTAATGGACAACAAAGGTTGAAAACCA
 961 TTGAATTAATAAATGTTGTGAACCATAATTTCTACCC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cuuucacauACCCGAAACACuu 5'
                   ||| |||||||  
Target 5' cagggacatTGGCCTTTGTGcc 3'
 75 - 96 137.00 -11.90
2 
miRNA  3' cuUUCACA--UACC-------CGAAACACUu 5'
            ||| ||  || |       ||||| ||| 
Target 5' ccAAGCGTTCATAGCGACGTCGCTTTTTGAt 3'
 304 - 334 122.00 -6.90
3 
miRNA  3' cuuucacauacccgaAACACUu 5'
                         |||||| 
Target 5' cggctcttcctatcaTTGTGAa 3'
 345 - 366 120.00 -8.10
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions mESCs
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM622572. RNA binding protein: AGO2. Condition:WT2 HITS-CLIP data was present in GSM622573. RNA binding protein: AGO2. Condition:KO1 ...

- Leung AK; Young AG; Bhutkar A; Zheng GX; et al., 2011, Nature structural & molecular biology.

Article - Leung AK; Young AG; Bhutkar A; Zheng GX; et al.
- Nature structural & molecular biology, 2011
MicroRNAs (miRNAs) are 19-22-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking immunoprecipitation using antibodies to Argonaute (Ago2) followed by deep sequencing of RNAs (CLIP-seq). We also performed CLIP-seq in Dicer(-)/(-) mESCs that lack mature miRNAs, allowing us to define whether the association of Ago2 with the identified sites was miRNA dependent. A significantly enriched motif, GCACUU, was identified only in wild-type mESCs in 3' untranslated and coding regions. This motif matches the seed of a miRNA family that constitutes ~68% of the mESC miRNA population. Unexpectedly, a G-rich motif was enriched in sequences cross-linked to Ago2 in both the presence and absence of miRNAs. Expression analysis and reporter assays confirmed that the seed-related motif confers miRNA-directed regulation on host mRNAs and that the G-rich motif can modulate this regulation.
LinkOut: [PMID: 21258322]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Liver
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in ERR266298. RNA binding protein: AGO2. Condition:A_Untreated HITS-CLIP data was present in ERR266300. RNA binding protein: AGO2. Condition:B_Untreated ...

- Schug J; McKenna LB; Walton G; Hand N; et al., 2013, BMC genomics.

Article - Schug J; McKenna LB; Walton G; Hand N; et al.
- BMC genomics, 2013
BACKGROUND: Validation of physiologic miRNA targets has been met with significant challenges. We employed HITS-CLIP to identify which miRNAs participate in liver regeneration, and to identify their target mRNAs. RESULTS: miRNA recruitment to the RISC is highly dynamic, changing more than five-fold for several miRNAs. miRNA recruitment to the RISC did not correlate with changes in overall miRNA expression for these dynamically recruited miRNAs, emphasizing the necessity to determine miRNA recruitment to the RISC in order to fully assess the impact of miRNA regulation. We incorporated RNA-seq quantification of total mRNA to identify expression-weighted Ago footprints, and developed a microRNA regulatory element (MRE) prediction algorithm that represents a greater than 20-fold refinement over computational methods alone. These high confidence MREs were used to generate candidate 'competing endogenous RNA' (ceRNA) networks. CONCLUSION: HITS-CLIP analysis provide novel insights into global miRNA:mRNA relationships in the regenerating liver.
LinkOut: [PMID: 23597149]
27 mmu-miR-350-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT435011 Lars2 leucyl-tRNA synthetase, mitochondrial 1 2
MIRT577176 Tet1 tet methylcytosine dioxygenase 1 1 5
MIRT577951 Pole4 polymerase (DNA-directed), epsilon 4 (p12 subunit) 1 1
MIRT579173 Cd70 CD70 antigen 1 1
MIRT580234 Tsga10 testis specific 10 1 1
MIRT581630 Prkaa1 protein kinase, AMP-activated, alpha 1 catalytic subunit 1 1
MIRT584029 D230025D16Rik RIKEN cDNA D230025D16 gene 1 1
MIRT588424 Zbtb6 zinc finger and BTB domain containing 6 1 1
MIRT588528 Usp45 ubiquitin specific petidase 45 1 2
MIRT588917 Skor1 SKI family transcriptional corepressor 1 1 1
MIRT589679 Larp1 La ribonucleoprotein domain family, member 1 1 2
MIRT590168 Elp4 elongator acetyltransferase complex subunit 4 1 1
MIRT593065 Ehf ets homologous factor 1 1
MIRT593183 BC068281 WD repeat and coiled coil containing 1 4
MIRT595160 Cbfa2t3 core-binding factor, runt domain, alpha subunit 2, translocated to, 3 (human) 1 1
MIRT596758 Utp23 UTP23 small subunit processome component 1 1
MIRT596783 Ubxn2a UBX domain protein 2A 1 1
MIRT597289 Slc1a7 solute carrier family 1 (glutamate transporter), member 7 1 1
MIRT597494 Rbm41 RNA binding motif protein 41 1 1
MIRT600204 Ube2j2 ubiquitin-conjugating enzyme E2J 2 1 1
MIRT603448 Ric3 RIC3 acetylcholine receptor chaperone 1 1
MIRT604253 Cercam cerebral endothelial cell adhesion molecule 1 1
MIRT604915 Iqcj IQ motif containing J 1 1
MIRT605131 Cnnm3 cyclin M3 1 1
MIRT605214 Arnt aryl hydrocarbon receptor nuclear translocator 1 1
MIRT605697 Ifnar1 interferon (alpha and beta) receptor 1 1 1
MIRT606256 Polr1e polymerase (RNA) I polypeptide E 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-350 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-350 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) NULL 16078949 Microarray hepatocytes 23107762 2013 down-regulated
miR-350 Tamoxifen approved 2733526 Microarray rat liver 17343880 2007 down-regulated
miR-350 Ursodeoxycholic acid (UDCA) approved 31401 Microarray rat Liver 20689055 2010 down-regulated

Error report submission