>NR0B1|NM_000475|3'UTR
   1 AGTCATGTGGGCCACACAAGTGCAGTAGTGCAGTTCACCATGAGGGAAGAATAAAGAGCTGTGGGCAAAAGAGTGTAAAA
  81 TATTTTAAAATAAACTTTCTTAATATTTTTACATGCAGAGTATTTTTGTATTCAATTAAAGAAATAATTTTATTCCAAAA
 161 AAA

Mutant ID	Mutant Position	Mutant Source
444073	17	ClinVar

Mutant ID	Mutant Position	Mutant Source
rs779673698	5	dbSNP
rs1165222593	6	dbSNP
rs773543388	9	dbSNP
rs1351831448	13	dbSNP
rs755657305	14	dbSNP
rs760506998	19	dbSNP
rs1330738945	20	dbSNP
rs1280369422	22	dbSNP
rs1231618839	24	dbSNP
rs775163498	28	dbSNP
rs367648839	34	dbSNP
rs745827190	39	dbSNP
rs181865731	40	dbSNP
rs1229238920	51	dbSNP
rs888475253	81	dbSNP
rs940899112	87	dbSNP
rs1050164139	88	dbSNP
rs1399007630	90	dbSNP
rs909468362	91	dbSNP
rs1257069442	98	dbSNP
rs1457784674	100	dbSNP
rs768113469	106	dbSNP
rs984459681	120	dbSNP
rs947734773	121	dbSNP
rs757562464	135	dbSNP
rs1440133860	162	dbSNP
rs777257083	163	dbSNP
rs992351248	168	dbSNP
rs751982802	173	dbSNP
rs1041148581	175	dbSNP
rs1030751103	180	dbSNP
rs1424621817	181	dbSNP
rs1467189354	197	dbSNP
rs772845875	206	dbSNP
rs1443563312	211	dbSNP
rs944558014	214	dbSNP
rs771698153	217	dbSNP
rs977910050	221	dbSNP
rs2301131	232	dbSNP
rs1022659394	233	dbSNP
rs77062635	242	dbSNP
rs1277120651	243	dbSNP
rs373100951	243	dbSNP
rs763096792	243	dbSNP
rs1444777377	247	dbSNP
rs1011577087	286	dbSNP
rs1318169263	288	dbSNP
rs1215810806	299	dbSNP
rs1275965855	327	dbSNP
rs1311512498	329	dbSNP
rs923736383	331	dbSNP
rs1259555504	336	dbSNP
rs1487152244	336	dbSNP
rs889150565	343	dbSNP
rs1476544032	348	dbSNP
rs1029004316	361	dbSNP
rs1206219718	370	dbSNP
rs1246816929	370	dbSNP

- Drug metabolism and disposition: the biological fate of chemicals, 2014

One of the major mechanisms involved in acetaminophen (APAP)-induced hepatotoxicity is hepatocyte nuclear factor 4alpha (HNF4alpha)-mediated activation of pregnane X receptor (PXR) and constitutive androstane receptor (CAR). In the present study, we investigated the role of miR-561 and its target gene DAX-1 encoding a corepressor of HNF4alpha in the process of APAP-induced hepatotoxicity. We used both human hepatocellular liver carcinoma cell line (HepG2) cells and primary human hepatocytes in this study and monitored the levels of reactive oxygen species, lactate dehydrogenase, and glutathione. Our bioinformatics study suggests an association between miR-561 and DAX-1, but not HNF4alpha. Treatment of HepG2 cells with APAP significantly reduced the expression of DAX-1 in a concentration-dependent manner. miR-561 was induced by APAP treatment in HepG2 cells. Transfection of HepG2 cells with an miR-561 mimic exacerbated APAP-induced hepatotoxicity. HNF4alpha is physically associated with DAX-1 in HepG2 cells. A decreased protein level of DAX-1 by APAP treatment was also enhanced by miR-561 mimic transfection in HepG2 cells and primary human hepatocytes. The basal and APAP-induced expression of PXR and CAR was enhanced by miR-561 mimic transfection; however, transfection of HepG2 cells or primary human hepatocytes with a miR-561 inhibitor or DAX-1 small interfering RNA reversed these effects. Additionally, the chromatin immunoprecipitation assay revealed that recruitment of DAX-1 onto the PXR promoter was inversely correlated with the recruitment of peroxisome proliferator-activated receptor-alpha coactivator-1alpha and HNF4alpha on APAP treatment. These results indicate that miR-561 worsens APAP-induced hepatotoxicity via inhibition of DAX-1 and consequent transactivation of nuclear receptors.