miRTarBase - #MIRT437760


—
pre-miRNA Information
pre-miRNA hsa-mir-202   
Genomic Coordinates chr10: 133247511 - 133247620
Synonyms MIRN202, hsa-mir-202, MIR202
Description Homo sapiens miR-202 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-202-3p
Sequence 64| AGAGGUAUAGGGCAUGGGAA |83
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs926369945 1 dbSNP
rs771209501 6 dbSNP
rs764929236 8 dbSNP
rs980911784 10 dbSNP
rs1184126421 12 dbSNP
rs1417531131 16 dbSNP
rs1237822757 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HAS2   
Synonyms -
Description hyaluronan synthase 2
Transcript NM_005328   
Expression
Putative miRNA Targets on HAS2
3'UTR of HAS2
(miRNA target sites are highlighted)		 
>HAS2|NM_005328|3'UTR
   1 TCTTCCATGTTTTGACGTTTGCAGTCACACACAACACCTTAGTTCCTCTAGGGGCTGTACAGTATTGTGGCATCAGATAA
  81 TGCCACCAAAGGAGACATATCACTGCTGCTGGGACTTGAACAAAGACATTTATATGGGTTTATTTTCATTCTGCCAAAGT
 161 AAAACAATACATCAACAAGAAGAAACTCAGATTTAACCTGTTATTTCTATGAAAATGGGATGAATTCTTTGTTTATGCAC
 241 TTTTTCCTTACTGTGCATCCGCCTGAAAGTGTTTTGCCCTATATACCTCACTAGCCATGCTTTATGTGGGTTATCATGGA
 321 AGAAAAGGATTTTGGAAACTCAAGGAAAAGTTCTTTCAACCTATACAACCTAACTTATGGACTGTTTTGATAGATGATAA
 401 TTTTTTTTTTTTAGGAAGGATTTTCTTTTTAACTTTACCAAATGAAATGCCAAAGGAAGTTTTAAAGGCCGTTGGCTGTG
 481 CTGTATTTTGATATAATTGTACTGTGTTTTTAAATTTTGTATGCCAATCTTAAAGACAAATTTTGCATATTCTCTATTTT
 561 ACTTTTCTGCCAAAATAAACCTGTTCTTCCTTTTTTAAAATAAAATAAGTTCTTAAAAAATTTATACTTAAAAAATCCTG
 641 CCCAAAATGTGAAGCTTGGTTGACTGATGTTCATGATAGAAAGAATAAAATGTTTCTCTCTCTCTACCTTTTAAAATTGA
 721 ATAGTTTATTTCTGTGAAAGAAGTATTTAAACTTTCAATATTTTAACTTTTTGTTTTTATTTCTTTTAGAAAAGGCCAAT
 801 ATACCTATCACACTTTGGAAGTAAAAATACACACTTTCGTGTGTACCTAAAAAAAAAATCGTTGAAAATCAAGGCCAAAG
 881 GTAGTGCAATTTTTTCATTAAGATTTAAAAAAAAGGGAATGATAGTCTTTGAAAGAAAACAGTAGGCATCCAGCACTGGA
 961 CAAAACATGGGTATCAAAGATGAATAATCTTTGGAGATTCTGGCAGTGTTTTCCCAGAACAAGTCAAGTGGAAAGTGGAG
1041 AAATTATCTGTATAATTTTGGACACATACAATGCAGTT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aaggguACGGG--AUAUGGAGa 5'
                |||||  |||||||| 
Target 5' gtgtttTGCCCTATATACCTCa 3'
 269 - 290 160.00 -16.60
2 
miRNA  3' aagggUACGG-GAUAUGGAga 5'
               | |||  |||||||  
Target 5' agaaaAGGCCAATATACCTat 3'
 788 - 808 131.00 -10.80
3 
miRNA  3' aaGGGUACGGGAUAUGGAga 5'
            ::|:||   |:|||||  
Target 5' ctTTCGTG---TGTACCTaa 3'
 834 - 850 115.00 -10.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31606876 2 COSMIC
COSN26110706 6 COSMIC
COSN30166638 6 COSMIC
COSN30187662 6 COSMIC
COSN30498938 28 COSMIC
COSN31524009 63 COSMIC
COSN30181076 72 COSMIC
COSN30156803 74 COSMIC
COSN30181186 109 COSMIC
COSN30495112 153 COSMIC
COSN31573379 175 COSMIC
COSN31551709 207 COSMIC
COSN28888994 227 COSMIC
COSN30575874 256 COSMIC
COSN20215961 261 COSMIC
COSN30110277 269 COSMIC
COSN31483098 357 COSMIC
COSN24858728 400 COSMIC
COSN31529248 400 COSMIC
COSN24302771 401 COSMIC
COSN29468691 537 COSMIC
COSN31534982 541 COSMIC
COSN28815920 545 COSMIC
COSN26550414 562 COSMIC
COSN19658583 577 COSMIC
COSN31514074 612 COSMIC
COSN17744871 621 COSMIC
COSN16755571 624 COSMIC
COSN31547884 646 COSMIC
COSN22171301 661 COSMIC
COSN21686335 683 COSMIC
COSN31538119 702 COSMIC
COSN31569034 783 COSMIC
COSN31589551 796 COSMIC
COSN20105866 848 COSMIC
COSN17391447 849 COSMIC
COSN4876300 881 COSMIC
COSN20852665 907 COSMIC
COSN6910192 1051 COSMIC
COSN24519217 1169 COSMIC
COSN2258648 1339 COSMIC
COSN5232064 1382 COSMIC
COSN1358790 1615 COSMIC
COSN21998455 1659 COSMIC
COSN21809102 1713 COSMIC
COSN2258647 1806 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs779351529 1 dbSNP
rs986303111 10 dbSNP
rs1427729385 11 dbSNP
rs372232676 16 dbSNP
rs948963509 21 dbSNP
rs1300639300 22 dbSNP
rs139967734 32 dbSNP
rs746035385 33 dbSNP
rs781283653 51 dbSNP
rs560621655 52 dbSNP
rs540838681 54 dbSNP
rs1419792819 55 dbSNP
rs1188315863 57 dbSNP
rs1423463314 60 dbSNP
rs1461703823 62 dbSNP
rs764319793 67 dbSNP
rs1049210453 69 dbSNP
rs191314762 71 dbSNP
rs1433471035 72 dbSNP
rs1480986635 80 dbSNP
rs752713726 90 dbSNP
rs770014495 95 dbSNP
rs765020238 102 dbSNP
rs759267187 103 dbSNP
rs750934464 106 dbSNP
rs759601848 107 dbSNP
rs776551211 109 dbSNP
rs765946524 112 dbSNP
rs760413160 114 dbSNP
rs1213364927 115 dbSNP
rs772684593 121 dbSNP
rs1444496616 127 dbSNP
rs771589954 129 dbSNP
rs1016288023 132 dbSNP
rs1005688167 146 dbSNP
rs1306794193 151 dbSNP
rs953009213 162 dbSNP
rs1184559093 176 dbSNP
rs1419836990 182 dbSNP
rs558331138 183 dbSNP
rs1163816176 187 dbSNP
rs1414974790 197 dbSNP
rs1182328971 198 dbSNP
rs1319487901 210 dbSNP
rs77874424 218 dbSNP
rs910521582 219 dbSNP
rs986081107 220 dbSNP
rs1315160661 221 dbSNP
rs1356556822 238 dbSNP
rs967956503 241 dbSNP
rs1324385535 243 dbSNP
rs1438092126 245 dbSNP
rs1232867466 246 dbSNP
rs34528716 246 dbSNP
rs202082371 252 dbSNP
rs1046432225 256 dbSNP
rs987981110 257 dbSNP
rs956718950 260 dbSNP
rs1283737421 261 dbSNP
rs1159255920 263 dbSNP
rs761292199 266 dbSNP
rs1265191044 269 dbSNP
rs1057311 277 dbSNP
rs1034797349 281 dbSNP
rs1214426299 293 dbSNP
rs1361684690 294 dbSNP
rs1485896707 298 dbSNP
rs892375606 304 dbSNP
rs1254974061 311 dbSNP
rs1470840112 314 dbSNP
rs1158633621 319 dbSNP
rs1406680182 326 dbSNP
rs1399441454 338 dbSNP
rs1003209977 340 dbSNP
rs904900152 341 dbSNP
rs1176121577 345 dbSNP
rs1376403140 353 dbSNP
rs1414565483 358 dbSNP
rs1054126435 363 dbSNP
rs1337751592 365 dbSNP
rs1158137992 368 dbSNP
rs575630224 374 dbSNP
rs555494849 378 dbSNP
rs776451636 381 dbSNP
rs1348686574 382 dbSNP
rs1237824987 386 dbSNP
rs1023253070 387 dbSNP
rs541800470 399 dbSNP
rs1013143797 403 dbSNP
rs1191610028 404 dbSNP
rs1050310718 413 dbSNP
rs562501827 413 dbSNP
rs1439179514 414 dbSNP
rs566659648 417 dbSNP
rs888021188 444 dbSNP
rs1049748466 447 dbSNP
rs1437312472 448 dbSNP
rs1248765286 450 dbSNP
rs1206945971 451 dbSNP
rs1396216739 466 dbSNP
rs1434716349 470 dbSNP
rs144202181 470 dbSNP
rs186704539 471 dbSNP
rs1040489860 489 dbSNP
rs1410718322 491 dbSNP
rs971691079 492 dbSNP
rs1334002508 495 dbSNP
rs1443219858 499 dbSNP
rs1234424867 503 dbSNP
rs940372578 511 dbSNP
rs1057315 517 dbSNP
rs910596636 519 dbSNP
rs986113619 521 dbSNP
rs946656152 522 dbSNP
rs952874666 523 dbSNP
rs1341262451 527 dbSNP
rs1195980927 535 dbSNP
rs550292883 536 dbSNP
rs988442526 537 dbSNP
rs1320703233 546 dbSNP
rs1383368124 557 dbSNP
rs1215012256 561 dbSNP
rs1253148400 566 dbSNP
rs1034258270 580 dbSNP
rs1197418652 594 dbSNP
rs1375097257 597 dbSNP
rs956571058 609 dbSNP
rs980977822 612 dbSNP
rs7831685 617 dbSNP
rs1463276692 621 dbSNP
rs1326651064 622 dbSNP
rs1466375907 625 dbSNP
rs981863619 626 dbSNP
rs1025094557 632 dbSNP
rs1396727383 636 dbSNP
rs568019706 637 dbSNP
rs1440042415 644 dbSNP
rs1171487401 646 dbSNP
rs1023285638 649 dbSNP
rs1299146654 650 dbSNP
rs1390656272 663 dbSNP
rs547878052 669 dbSNP
rs1269447482 670 dbSNP
rs1445288296 675 dbSNP
rs529549465 677 dbSNP
rs1315667389 678 dbSNP
rs1234800543 682 dbSNP
rs775452881 696 dbSNP
rs1273233424 698 dbSNP
rs892481329 702 dbSNP
rs1032221828 705 dbSNP
rs1001182992 706 dbSNP
rs1261311713 706 dbSNP
rs1201301339 708 dbSNP
rs182410438 716 dbSNP
rs540826593 717 dbSNP
rs1486775174 718 dbSNP
rs1027908269 720 dbSNP
rs1278691030 724 dbSNP
rs572798677 734 dbSNP
rs898027980 749 dbSNP
rs1291655838 754 dbSNP
rs1387042916 755 dbSNP
rs1382765189 761 dbSNP
rs1040562339 769 dbSNP
rs1317343916 773 dbSNP
rs933181968 777 dbSNP
rs1416198181 779 dbSNP
rs368158785 783 dbSNP
rs1294174729 788 dbSNP
rs376215843 798 dbSNP
rs889193377 802 dbSNP
rs1214691723 805 dbSNP
rs539253255 807 dbSNP
rs1262048400 814 dbSNP
rs1352018520 823 dbSNP
rs1050474657 826 dbSNP
rs940319356 828 dbSNP
rs1486877090 830 dbSNP
rs1188864998 831 dbSNP
rs190987282 838 dbSNP
rs774212095 839 dbSNP
rs559379168 858 dbSNP
rs367887988 859 dbSNP
rs984510333 859 dbSNP
rs555688145 860 dbSNP
rs139560614 861 dbSNP
rs570584209 878 dbSNP
rs1354427677 880 dbSNP
rs1415058797 881 dbSNP
rs572795608 883 dbSNP
rs1238913499 884 dbSNP
rs969164651 887 dbSNP
rs1350431284 896 dbSNP
rs916349264 904 dbSNP
rs1310863073 906 dbSNP
rs552875691 907 dbSNP
rs1482386175 911 dbSNP
rs1179210710 913 dbSNP
rs1251283412 915 dbSNP
rs970899798 920 dbSNP
rs1177864353 921 dbSNP
rs539230909 922 dbSNP
rs1378407201 923 dbSNP
rs1436571989 925 dbSNP
rs1025040818 928 dbSNP
rs952420090 940 dbSNP
rs988227147 941 dbSNP
rs1025724256 952 dbSNP
rs16895778 961 dbSNP
rs1032754526 966 dbSNP
rs1396534334 969 dbSNP
rs1445421901 972 dbSNP
rs1372644545 975 dbSNP
rs1373810777 979 dbSNP
rs556758042 980 dbSNP
rs962590328 986 dbSNP
rs1476337692 988 dbSNP
rs1019153735 989 dbSNP
rs1310840219 990 dbSNP
rs1009084449 1004 dbSNP
rs1252121417 1009 dbSNP
rs1210659636 1010 dbSNP
rs889017566 1026 dbSNP
rs537102678 1027 dbSNP
rs997279514 1030 dbSNP
rs1194230988 1035 dbSNP
rs1424162781 1036 dbSNP
rs1275741022 1040 dbSNP
rs1431251810 1047 dbSNP
rs1172015073 1048 dbSNP
rs901684830 1050 dbSNP
rs186581467 1055 dbSNP
rs1328659356 1057 dbSNP
rs1194654813 1065 dbSNP
rs1050505419 1068 dbSNP
rs1250315165 1072 dbSNP
rs1293481167 1076 dbSNP
rs1233310269 1085 dbSNP
rs1357005296 1089 dbSNP
rs1216691807 1091 dbSNP
rs940425866 1093 dbSNP
rs887577322 1096 dbSNP
rs548159709 1103 dbSNP
rs16895776 1109 dbSNP
rs1468990697 1110 dbSNP
rs893844101 1112 dbSNP
rs1052844647 1117 dbSNP
rs1336188687 1122 dbSNP
rs1246068584 1127 dbSNP
rs1487345943 1128 dbSNP
rs935289850 1129 dbSNP
rs73708096 1134 dbSNP
rs1477273409 1136 dbSNP
rs772816466 1137 dbSNP
rs1165282277 1145 dbSNP
rs1165781644 1146 dbSNP
rs1046274512 1158 dbSNP
rs1164606076 1163 dbSNP
rs1289798041 1163 dbSNP
rs1433566679 1163 dbSNP
rs1461518644 1163 dbSNP
rs35228194 1163 dbSNP
rs1340347560 1164 dbSNP
rs1415966799 1164 dbSNP
rs1187424272 1165 dbSNP
rs547352237 1166 dbSNP
rs1473036111 1169 dbSNP
rs1235031744 1172 dbSNP
rs1335487288 1184 dbSNP
rs1227815610 1196 dbSNP
rs949492701 1201 dbSNP
rs533685162 1204 dbSNP
rs1180074739 1205 dbSNP
rs564644624 1208 dbSNP
rs918097901 1209 dbSNP
rs988347938 1232 dbSNP
rs1437779102 1235 dbSNP
rs1268616676 1251 dbSNP
rs536662003 1254 dbSNP
rs947892975 1260 dbSNP
rs925418593 1264 dbSNP
rs916380620 1266 dbSNP
rs1270712997 1270 dbSNP
rs983921061 1272 dbSNP
rs1475367949 1284 dbSNP
rs1162109593 1287 dbSNP
rs952567923 1290 dbSNP
rs1232371832 1301 dbSNP
rs776809866 1305 dbSNP
rs918283500 1307 dbSNP
rs1160516701 1314 dbSNP
rs953422329 1316 dbSNP
rs1281120631 1321 dbSNP
rs1314930057 1325 dbSNP
rs1356334752 1330 dbSNP
rs1447649155 1344 dbSNP
rs781190696 1345 dbSNP
rs544484408 1347 dbSNP
rs1375657035 1348 dbSNP
rs1335133023 1349 dbSNP
rs1286667170 1354 dbSNP
rs965015408 1360 dbSNP
rs1214168767 1361 dbSNP
rs1326422858 1372 dbSNP
rs771968898 1380 dbSNP
rs965966687 1381 dbSNP
rs530996933 1383 dbSNP
rs1019227675 1384 dbSNP
rs1235206334 1385 dbSNP
rs1470892890 1386 dbSNP
rs1392451618 1395 dbSNP
rs755215765 1398 dbSNP
rs1380232990 1399 dbSNP
rs1438461958 1402 dbSNP
rs1401549386 1404 dbSNP
rs953536179 1406 dbSNP
rs1004745004 1410 dbSNP
rs1410372282 1414 dbSNP
rs1029570492 1415 dbSNP
rs1011013486 1418 dbSNP
rs569310982 1424 dbSNP
rs1356294577 1425 dbSNP
rs1031054399 1429 dbSNP
rs1308700956 1430 dbSNP
rs561811963 1444 dbSNP
rs1403740683 1450 dbSNP
rs1376041424 1455 dbSNP
rs1196116215 1466 dbSNP
rs905530890 1472 dbSNP
rs906503921 1472 dbSNP
rs562085474 1474 dbSNP
rs1046305261 1475 dbSNP
rs879033661 1486 dbSNP
rs1212499481 1489 dbSNP
rs760735544 1495 dbSNP
rs548200064 1498 dbSNP
rs1438978976 1499 dbSNP
rs947964817 1503 dbSNP
rs541136622 1507 dbSNP
rs918195772 1512 dbSNP
rs1053020712 1532 dbSNP
rs935525398 1539 dbSNP
rs1396016783 1540 dbSNP
rs1477913133 1540 dbSNP
rs780294349 1543 dbSNP
rs895022166 1552 dbSNP
rs7014290 1553 dbSNP
rs1303862369 1554 dbSNP
rs953468049 1581 dbSNP
rs921926227 1586 dbSNP
rs1327874040 1587 dbSNP
rs754833998 1589 dbSNP
rs1331418283 1592 dbSNP
rs931108140 1602 dbSNP
rs918346539 1603 dbSNP
rs1368664023 1606 dbSNP
rs1272925951 1609 dbSNP
rs976091243 1619 dbSNP
rs1218919874 1622 dbSNP
rs1325324480 1624 dbSNP
rs112900177 1625 dbSNP
rs145261784 1625 dbSNP
rs760854222 1625 dbSNP
rs879107203 1625 dbSNP
rs573747298 1626 dbSNP
rs943689487 1628 dbSNP
rs1014825857 1631 dbSNP
rs1197178202 1632 dbSNP
rs113650458 1638 dbSNP
rs1316415908 1647 dbSNP
rs200643770 1654 dbSNP
rs951932380 1658 dbSNP
rs1175884746 1660 dbSNP
rs750790637 1661 dbSNP
rs1166931422 1673 dbSNP
rs1391363171 1675 dbSNP
rs10505409 1678 dbSNP
rs545662326 1679 dbSNP
rs1277194018 1685 dbSNP
rs1394956874 1689 dbSNP
rs1234588387 1695 dbSNP
rs1265574083 1696 dbSNP
rs765734366 1702 dbSNP
rs905645505 1704 dbSNP
rs1045407133 1708 dbSNP
rs1029189284 1713 dbSNP
rs990066114 1722 dbSNP
rs1488836482 1726 dbSNP
rs958206995 1728 dbSNP
rs1243504858 1729 dbSNP
rs7013984 1735 dbSNP
rs6996063 1736 dbSNP
rs386729380 1737 dbSNP
rs906577494 1739 dbSNP
rs1476349893 1747 dbSNP
rs1280835378 1749 dbSNP
rs1368020145 1751 dbSNP
rs1024913892 1754 dbSNP
rs1012157731 1755 dbSNP
rs1052720883 1771 dbSNP
rs935457331 1779 dbSNP
rs904027788 1786 dbSNP
rs1420085072 1798 dbSNP
rs1297425215 1806 dbSNP
rs1337942063 1809 dbSNP
rs772401380 1812 dbSNP
rs35627665 1823 dbSNP
rs1416293182 1824 dbSNP
rs1044316015 1831 dbSNP
rs1339395275 1836 dbSNP
rs932063874 1841 dbSNP
rs1263034396 1844 dbSNP
rs1354786309 1845 dbSNP
rs1345677701 1859 dbSNP
rs1284401441 1861 dbSNP
rs922045632 1862 dbSNP
rs186413498 1864 dbSNP
rs1255510743 1874 dbSNP
rs1422159315 1876 dbSNP
rs1185240328 1884 dbSNP
rs1382088237 1898 dbSNP
rs1440302896 1916 dbSNP
rs976044254 1945 dbSNP
rs895047683 1949 dbSNP
rs1358427725 1962 dbSNP
rs1302500281 1970 dbSNP
rs1303086539 1978 dbSNP
rs1400806841 1982 dbSNP
rs944724505 1992 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Disease MIMAT0002811
Location of target site 3'UTR
Tools used in this research miRanda , PITA , RNAhybrid , TargetScan , TargetScanS
Original Description (Extracted from the article) ... "The expression of both luciferase 3' UTR constructs were signi茂卢聛cantly reduced when cotransfected with the miR-202 mimic ...

- Hoffman AE; Liu R; Fu A; Zheng T; Slack F; Zhu Y, 2013, Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology.

Article - Hoffman AE; Liu R; Fu A; Zheng T; Slack F; Zhu Y
- Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology, 2013
BACKGROUND: miRNAs have been implicated in numerous tumorigenic pathways, and previous studies have associated miR-202 dysregulation with various cancer types, including follicular lymphoma. METHODS: The miR-202 targetome was identified by ribonucleoprotein immunoprecipitation-microarray (RIP-Chip), and functional interactions among identified targets were investigated using the Ingenuity Pathway Analysis tool. We also conducted a population-based genetic association study of a polymorphism within the miR-202 stem-loop sequence and risk of non-Hodgkin lymphoma. In vitro gain-of-function experiments were further conducted to elucidate the functional significance of the variant. RESULTS: A total of 141 potential members of the miR-202 targetome were identified by a transcriptome-wide RIP-Chip assay. Functional interactions among identified targets suggested that miR-202-regulated genes are involved in biologic pathways relevant for hematologic function and cancer. Consistent with this, a genetic association analysis using human blood samples revealed a significant association between a germline mutation (rs12355840) in the miR-202 precursor sequence and follicular lymphoma risk. An in vitro functional assay further showed that the variant allele resulted in diminished miR-202 levels, possibly by altering precursor-processing efficiency. CONCLUSIONS: Taken together, our findings suggest that miR-202 is involved in follicular lymphomagenesis. IMPACT: These findings implicate miR-202 as a potential tumor suppressor in follicular lymphoma and warrant the investigation of miR-202 as a novel biomarker of follicular lymphoma risk.
LinkOut: [PMID: 23334589]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.524 5.1e-3 -0.424 2.2e-2 23 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.477 8.0e-3 0.479 7.7e-3 25 Click to see details
GSE28544 Breast cancer 0.314 6.8e-2 0.492 7.3e-3 24 Click to see details
GSE19350 CNS germ cell tumors 0.448 7.2e-2 0.168 3.0e-1 12 Click to see details
GSE26953 Aortic valvular endothelial cells -0.231 1.4e-1 -0.240 1.3e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.22 1.5e-1 -0.263 1.0e-1 25 Click to see details
GSE19783 ER+ ER+ breast cancer -0.226 1.7e-1 -0.020 4.7e-1 20 Click to see details
GSE21032 Prostate cancer -0.106 1.7e-1 -0.103 1.8e-1 83 Click to see details
GSE14794 Lymphoblastoid cells 0.088 2.0e-1 0.117 1.4e-1 90 Click to see details
GSE32688 Pancreatic cancer 0.142 2.2e-1 0.136 2.3e-1 32 Click to see details
GSE27834 Pluripotent stem cells 0.202 2.3e-1 0.312 1.2e-1 16 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.752 2.3e-1 0.500 3.3e-1 3 Click to see details
GSE38226 Liver fibrosis -0.171 2.3e-1 -0.004 4.9e-1 21 Click to see details
GSE17306 Multiple myeloma 0.092 2.6e-1 0.040 3.9e-1 49 Click to see details
GSE19536 Breast cancer 0.054 3.0e-1 0.052 3.0e-1 100 Click to see details
GSE21687 Ependynoma primary tumors -0.063 3.1e-1 0.020 4.4e-1 64 Click to see details
GSE28260 Renal cortex and medulla 0.137 3.3e-1 0.132 3.3e-1 13 Click to see details
GSE17498 Multiple myeloma -0.023 4.4e-1 -0.074 3.2e-1 40 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.033 4.5e-1 0.011 4.8e-1 20 Click to see details
GSE19783 ER- ER- breast cancer 0.014 4.5e-1 0.066 2.8e-1 79 Click to see details
GSE19783 ER- ER- breast cancer 0.014 4.5e-1 0.066 2.8e-1 79 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.058 0.46 -0.543 0.13 6 Click to see details
BRCA -0.058 0.46 -0.543 0.13 6 Click to see details
BRCA -0.058 0.46 -0.543 0.13 6 Click to see details
BRCA -0.058 0.46 -0.543 0.13 6 Click to see details
BRCA -0.058 0.46 -0.543 0.13 6 Click to see details
BRCA -0.058 0.46 -0.543 0.13 6 Click to see details
BRCA -0.058 0.46 -0.543 0.13 6 Click to see details
BRCA -0.058 0.46 -0.543 0.13 6 Click to see details
BRCA -0.058 0.46 -0.543 0.13 6 Click to see details
BRCA -0.058 0.46 -0.543 0.13 6 Click to see details
BRCA -0.058 0.46 -0.543 0.13 6 Click to see details
BRCA -0.058 0.46 -0.543 0.13 6 Click to see details
187 hsa-miR-202-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT016613 MYCN MYCN proto-oncogene, bHLH transcription factor 1 1
MIRT053565 GLI1 GLI family zinc finger 1 3 1
MIRT063201 ADIPOR2 adiponectin receptor 2 2 2
MIRT067406 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 2
MIRT068548 NHLRC3 NHL repeat containing 3 2 6
MIRT080404 ONECUT2 one cut homeobox 2 2 2
MIRT118591 STK4 serine/threonine kinase 4 2 2
MIRT123324 CALU calumenin 2 2
MIRT191784 LIN52 lin-52 DREAM MuvB core complex component 2 2
MIRT194243 FAM103A1 family with sequence similarity 103 member A1 2 6
MIRT252856 ZNF526 zinc finger protein 526 2 4
MIRT268844 C1ORF21 chromosome 1 open reading frame 21 2 2
MIRT273603 SP1 Sp1 transcription factor 2 2
MIRT363747 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 2 2
MIRT437760 HAS2 hyaluronan synthase 2 1 1
MIRT437971 LRP6 LDL receptor related protein 6 3 1
MIRT438223 ARL5A ADP ribosylation factor like GTPase 5A 2 1
MIRT442013 NDUFA4P1 NDUFA4, mitochondrial complex associated pseudogene 1 2 2
MIRT445652 ATP6V1G1 ATPase H+ transporting V1 subunit G1 2 6
MIRT448241 ZNF774 zinc finger protein 774 2 2
MIRT452085 NUCB2 nucleobindin 2 2 2
MIRT454158 HIST1H2BK histone cluster 1 H2B family member k 2 2
MIRT454273 FXN frataxin 2 2
MIRT455669 GLO1 glyoxalase I 2 2
MIRT458010 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT458272 FUT10 fucosyltransferase 10 2 2
MIRT463411 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT463655 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT465107 TSC22D2 TSC22 domain family member 2 2 4
MIRT470409 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT470662 POLR2D RNA polymerase II subunit D 2 4
MIRT470842 PLXND1 plexin D1 2 2
MIRT471411 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT471519 PCGF3 polycomb group ring finger 3 2 6
MIRT472668 NAA20 N(alpha)-acetyltransferase 20, NatB catalytic subunit 2 2
MIRT473124 MLLT10 MLLT10, histone lysine methyltransferase DOT1L cofactor 2 2
MIRT474252 LATS2 large tumor suppressor kinase 2 2 2
MIRT474485 KLHDC8B kelch domain containing 8B 2 2
MIRT474753 KIAA0930 KIAA0930 2 2
MIRT474899 KCTD21 potassium channel tetramerization domain containing 21 2 2
MIRT476815 FNDC3A fibronectin type III domain containing 3A 2 2
MIRT477669 EFHD2 EF-hand domain family member D2 2 2
MIRT477739 EDN1 endothelin 1 2 2
MIRT479745 CCND1 cyclin D1 2 2
MIRT480332 C5orf51 chromosome 5 open reading frame 51 2 10
MIRT481188 ATXN7L3B ataxin 7 like 3B 2 4
MIRT481228 ATXN7L3 ataxin 7 like 3 2 2
MIRT481357 ATG9A autophagy related 9A 2 2
MIRT481645 AREL1 apoptosis resistant E3 ubiquitin protein ligase 1 2 2
MIRT485486 IGF1R insulin like growth factor 1 receptor 2 8
MIRT490467 ABT1 activator of basal transcription 1 2 8
MIRT492050 TNFSF9 TNF superfamily member 9 2 2
MIRT492621 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 2
MIRT494680 ARID3A AT-rich interaction domain 3A 2 2
MIRT497868 SLC12A7 solute carrier family 12 member 7 2 2
MIRT498111 PLEKHO1 pleckstrin homology domain containing O1 2 4
MIRT498793 MDM2 MDM2 proto-oncogene 2 2
MIRT499342 RAB25 RAB25, member RAS oncogene family 2 2
MIRT499398 PLCG2 phospholipase C gamma 2 2 4
MIRT499646 SDR42E1 short chain dehydrogenase/reductase family 42E, member 1 2 2
MIRT500805 THBS1 thrombospondin 1 2 3
MIRT501194 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT501225 SEMA4C semaphorin 4C 2 6
MIRT501317 RNFT1 ring finger protein, transmembrane 1 2 2
MIRT501341 RNF44 ring finger protein 44 2 4
MIRT501381 RBFOX2 RNA binding protein, fox-1 homolog 2 2 10
MIRT501683 PDE12 phosphodiesterase 12 2 8
MIRT501923 MDM4 MDM4, p53 regulator 2 2
MIRT501933 MBD2 methyl-CpG binding domain protein 2 2 8
MIRT502118 KMT2D lysine methyltransferase 2D 2 4
MIRT502260 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 2 2
MIRT502766 CLDN12 claudin 12 2 6
MIRT502831 CELF1 CUGBP Elav-like family member 1 2 2
MIRT505007 ZNF644 zinc finger protein 644 2 2
MIRT505571 SMC1A structural maintenance of chromosomes 1A 2 6
MIRT506930 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 6
MIRT507238 FIGN fidgetin, microtubule severing factor 2 8
MIRT507680 COIL coilin 2 6
MIRT508394 C1orf210 chromosome 1 open reading frame 210 2 6
MIRT508658 DIABLO diablo IAP-binding mitochondrial protein 2 4
MIRT508925 AK4 adenylate kinase 4 2 4
MIRT510382 ZNF566 zinc finger protein 566 2 6
MIRT511379 IKZF3 IKAROS family zinc finger 3 2 4
MIRT512738 CD59 CD59 molecule (CD59 blood group) 2 4
MIRT516076 ZBTB8OS zinc finger and BTB domain containing 8 opposite strand 2 4
MIRT520035 YOD1 YOD1 deubiquitinase 2 6
MIRT521379 RDX radixin 2 4
MIRT523609 FZD9 frizzled class receptor 9 2 4
MIRT523970 DVL3 dishevelled segment polarity protein 3 2 2
MIRT524100 DNA2 DNA replication helicase/nuclease 2 2 2
MIRT525720 SOD2 superoxide dismutase 2 2 2
MIRT529720 OPRL1 opioid related nociceptin receptor 1 2 2
MIRT533174 WASL Wiskott-Aldrich syndrome like 2 6
MIRT536371 LEFTY1 left-right determination factor 1 2 2
MIRT541383 CDKN1A cyclin dependent kinase inhibitor 1A 2 2
MIRT542687 SALL3 spalt like transcription factor 3 2 2
MIRT543861 SLC16A9 solute carrier family 16 member 9 2 2
MIRT545380 PM20D2 peptidase M20 domain containing 2 2 2
MIRT545851 ZNF264 zinc finger protein 264 2 4
MIRT545877 ZNF200 zinc finger protein 200 2 4
MIRT546322 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT546645 RRM2 ribonucleotide reductase regulatory subunit M2 2 2
MIRT547363 MSI2 musashi RNA binding protein 2 2 2
MIRT547564 LRIG3 leucine rich repeats and immunoglobulin like domains 3 2 4
MIRT547828 IGF2BP3 insulin like growth factor 2 mRNA binding protein 3 2 4
MIRT548258 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548331 EPHA4 EPH receptor A4 2 2
MIRT548526 DUSP1 dual specificity phosphatase 1 2 2
MIRT549016 CBX5 chromobox 5 2 2
MIRT549200 BEND4 BEN domain containing 4 2 4
MIRT549756 ZNF611 zinc finger protein 611 2 6
MIRT549792 KIAA0391 KIAA0391 2 2
MIRT549840 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 2
MIRT550720 PMPCA peptidase, mitochondrial processing alpha subunit 2 4
MIRT550891 ACTA1 actin, alpha 1, skeletal muscle 2 2
MIRT551276 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 2 6
MIRT551311 GSG2 histone H3 associated protein kinase 2 6
MIRT551925 AKAP8 A-kinase anchoring protein 8 2 4
MIRT552403 ZNF460 zinc finger protein 460 2 4
MIRT552463 ZNF280B zinc finger protein 280B 2 2
MIRT555533 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT555692 PEX11B peroxisomal biogenesis factor 11 beta 2 2
MIRT555697 PDZD8 PDZ domain containing 8 2 2
MIRT556036 MXD1 MAX dimerization protein 1 2 2
MIRT556264 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT557366 HAND1 heart and neural crest derivatives expressed 1 2 2
MIRT557947 FAM222B family with sequence similarity 222 member B 2 2
MIRT558792 CDV3 CDV3 homolog 2 2
MIRT561769 PEG10 paternally expressed 10 2 2
MIRT564395 EMILIN2 elastin microfibril interfacer 2 2 4
MIRT565223 TRIM71 tripartite motif containing 71 2 2
MIRT565437 SURF4 surfeit 4 2 2
MIRT566494 PBX2P1 PBX homeobox 2 pseudogene 1 2 2
MIRT566511 PARP16 poly(ADP-ribose) polymerase family member 16 2 2
MIRT567315 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 2 2
MIRT567708 E2F6 E2F transcription factor 6 2 2
MIRT568320 BACH1 BTB domain and CNC homolog 1 2 2
MIRT568644 ABHD17C abhydrolase domain containing 17C 2 2
MIRT569491 THYN1 thymocyte nuclear protein 1 2 2
MIRT573813 TGOLN2 trans-golgi network protein 2 2 2
MIRT574356 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT574744 GOLGA4 golgin A4 2 2
MIRT576071 Poteg POTE ankyrin domain family, member G 2 2
MIRT576789 Thbs1 thrombospondin 1 2 3
MIRT616363 RWDD1 RWD domain containing 1 2 2
MIRT642387 ZNF556 zinc finger protein 556 2 2
MIRT650257 ARHGAP22 Rho GTPase activating protein 22 2 2
MIRT680512 PRIM2 DNA primase subunit 2 2 2
MIRT680540 ZNF584 zinc finger protein 584 2 2
MIRT680831 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT681264 RFC2 replication factor C subunit 2 2 2
MIRT681352 BRI3BP BRI3 binding protein 2 2
MIRT681499 STAT2 signal transducer and activator of transcription 2 2 2
MIRT681529 ZNF738 zinc finger protein 738 2 2
MIRT681651 DTX3L deltex E3 ubiquitin ligase 3L 2 2
MIRT681755 CDKAL1 CDK5 regulatory subunit associated protein 1 like 1 2 2
MIRT681790 EIF4A3 eukaryotic translation initiation factor 4A3 2 2
MIRT681935 SLC19A3 solute carrier family 19 member 3 2 2
MIRT682095 ITGA3 integrin subunit alpha 3 2 4
MIRT682174 SLC38A7 solute carrier family 38 member 7 2 2
MIRT682231 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT682378 PHACTR4 phosphatase and actin regulator 4 2 2
MIRT682589 CPA4 carboxypeptidase A4 2 2
MIRT682633 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT689320 FPR1 formyl peptide receptor 1 2 2
MIRT689723 ATXN2 ataxin 2 2 2
MIRT691029 ZNF799 zinc finger protein 799 2 2
MIRT691928 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT694877 ZNF417 zinc finger protein 417 2 2
MIRT695248 ZNF443 zinc finger protein 443 2 2
MIRT701422 NHLRC2 NHL repeat containing 2 2 2
MIRT701992 MIER3 MIER family member 3 2 2
MIRT702477 KIAA1328 KIAA1328 2 2
MIRT702701 IPO9 importin 9 2 2
MIRT704022 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT712363 NAP1L1 nucleosome assembly protein 1 like 1 2 2
MIRT712448 KHNYN KH and NYN domain containing 2 2
MIRT713513 PAFAH2 platelet activating factor acetylhydrolase 2 2 2
MIRT731769 PDCD4 programmed cell death 4 3 1
MIRT733048 TLR4 toll like receptor 4 1 0
MIRT733831 BDNF brain derived neurotrophic factor 3 0
MIRT737334 HK2 hexokinase 2 3 0
MIRT756084 MMP11 matrix metallopeptidase 11 3 1
MIRT756086 FN1 fibronectin 1 2 1
MIRT756087 COL6A1 collagen type VI alpha 1 chain 2 1
MIRT756088 COL6A2 collagen type VI alpha 2 chain 2 1
MIRT756089 COL6A3 collagen type VI alpha 3 chain 2 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-202 Gemcitabine approved 60750 Northern blot Mz-ChA-1 human cholangiocarcinoma cell lines 16762633 2006 up-regulated
miR-202 4-hydroxynonenal NULL 5283344 Microarray human leukemic HL-60 cell 19022373 2009 down-regulated
miR-202 1,2,6-Tri-O-galloyl-beta-D-glucopyranose NULL NULL Microarray HepG2 hepatocarcinoma cells. 22506400 2011 down-regulated
miR-202 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-202 4-hydroxynonenal NULL 5283344 Quantitative real-time PCR human leukemic HL-60 cell 19022373 2009 down-regulated
miR-202-3p (S)-3,5-dihydroxyphenylglycine (DHPG) NULL 443586 Quantitative real-time PCR mouse brain 22309833 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-202 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-202-3p -d-xylose 24203222 NSC727221 sensitive
hsa-miR-202-3p (2Z)-N-(2,4-dimethylphenyl)-3-(6-nitro-3-oxo-4H-quinoxalin-2-yl)-2-[(2-pyridin-1-ium-1-ylacetyl)hydrazinylidene]propanamide 5918855 NSC649808 sensitive
hsa-miR-202-3p (e)-1,3-diphenyl-2-(piperidin-1-ylmethyl)prop-2-en-1-one 6147837 NSC109154 sensitive
hsa-miR-202-3p .beta.-phenylethyl 2,4,5-trihydroxycinnamate 5933247 NSC666592 sensitive
hsa-miR-202-3p 1h-benzo[a]carbazole-1,4(11h)-dione, 11-methyl- 261066 NSC92937 sensitive
hsa-miR-202-3p 2-(5-chloro-2-methylanilino)-6-(trifluoromethyl)pyridine-3-carboxamide 24204601 NSC732287 resistant
hsa-miR-202-3p 2-methyl-1-(2,3,4,5,6-pentafluorobenzoyl)-1h-benzimidazole 383504 NSC671889 sensitive
hsa-miR-202-3p 2-methylolivacinium acetate 5458752 NSC336003 resistant
hsa-miR-202-3p 2-nitro-1-phenylpropan-1-ol 226118 NSC16258 sensitive
hsa-miR-202-3p 3-[2-(1h-indol-3-yl)-2-oxoethyl]quinoxalin-2(1h)-one 400273 NSC711806 sensitive
hsa-miR-202-3p 3-iodoacetamido-benzoic acid ethyl ester 398530 NSC708445 sensitive
hsa-miR-202-3p 3,4,8-trimethyl-7-((2-methyl-4-methylene-5-oxotetrahydro-2-furanyl)methoxy)-2h-chromen-2-one 381508 NSC668264 sensitive
hsa-miR-202-3p 4-[(2Z)-2-[1-amino-3-(methylamino)-1,3-bis(sulfanylidene)propan-2-ylidene]hydrazinyl]-1H-imidazole-5-carboxamide 5466293 NSC684046 sensitive
hsa-miR-202-3p 6-(aziridin-1-yl)-7-methoxy-2,3-dihydro-1h-pyrrolo[1,2-a]benzimidazole-5,8-dione 383842 NSC672472 sensitive
hsa-miR-202-3p 7-chloro-10,11-dimethoxy-2,8-diazatricyclo[7.3.1.05,13]trideca-1(12),5,7,9(13),10-pentaene-3,4-dione 397794 NSC706232 sensitive
hsa-miR-202-3p 8-(6-fluorohexyl)-3-methyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380336 NSC665863 resistant
hsa-miR-202-3p 8-[3-(1,3-dioxolan-2-yl)-2-(4-fluorophenyl)propyl]-3-ethyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380308 NSC665789 resistant
hsa-miR-202-3p 8-azadenosine 251928 NSC72961 sensitive
hsa-miR-202-3p 8(5h)-quinolinone, 7-chloro-5-[[4-(diethylamino)-2-methylphenyl]imino]- 363174 NSC627778 sensitive
hsa-miR-202-3p 9-methoxy-2-methylellipticinium iodide 3086380 NSC155693 resistant
hsa-miR-202-3p Antineoplastic-651590 6369039 NSC651590 sensitive
hsa-miR-202-3p Basic fuchsin 12447 NSC10466 resistant
hsa-miR-202-3p Eh00008 354026 NSC603974 sensitive
hsa-miR-202-3p Go-y103 1352182 NSC677240 sensitive
hsa-miR-202-3p Incarnal 131851 NSC648322 sensitive
hsa-miR-202-3p Kahalide f 9898671 NSC668814 resistant
hsa-miR-202-3p Kuc110490n 377410 NSC658853 sensitive
hsa-miR-202-3p M-232 403374 NSC718170 sensitive
hsa-miR-202-3p Melampodinin 5359028 NSC294600 sensitive
hsa-miR-202-3p Methanesulfonate;2,3,8,9,12-pentamethoxy-5-methylbenzo[c]phenanthridin-5-ium 21144847 NSC344688 resistant
hsa-miR-202-3p Methyl (1S,4S)-6,11-dioxo-4-[3,4,5-triacetyloxy-6-(acetyloxymethyl)oxan-2-yl]oxy-1,4-dihydropyridazino[1,2-b]phthalazine-1-carboxylate 385569 NSC676858 sensitive
hsa-miR-202-3p Mp 317 16683647 NSC30916 sensitive
hsa-miR-202-3p N-(2-aminophenyl)-4-[3-(3-methyl-2,5-dioxoimidazolidin-1-yl)prop-1-en-2-yl]benzamide 11682081 NSC736099 sensitive
hsa-miR-202-3p P-fuchsin 11292 NSC10460 resistant
hsa-miR-202-3p Prumycin 5458561 NSC278619 resistant
hsa-miR-202-3p Stl338719 393017 NSC694265 resistant
hsa-miR-202-3p Tributyrin 6050 NSC661583 sensitive
hsa-miR-202-3p Vorinostat 5311 NSC701852 approved sensitive
hsa-miR-202-3p Xnivbtjmwlisex-djkkodmxsa-n 9571538 NSC681776 resistant
hsa-miR-202-3p Cisplatin 5460033 NSC119875 approved sensitive High Esophageal Squamous Cell Carcinoma tissue and cell line (TE1, TE5, TE8, TE9, TE10, TE11, TE13)
hsa-miR-202-3p Etoposide 36462 NSC141540 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-202-3p Bortezomib 387447 NSC681239 approved sensitive Low Multiple Myeloma cell line (HS-5)
hsa-miR-202-3p Doxorubicin 31703 NSC123127 approved resistant Low Osteosarcoma cell line (U-2-OS, G293)
hsa-miR-202-3p Doxorubicin 31703 NSC123127 approved resistant Low Osteosarcoma cell line (U-2-OS, G293)
hsa-miR-202-3p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-202-3p Bortezomib 387447 NSC681239 approved sensitive Low Multiple Myeloma cell line
hsa-miR-202-3p Bortezomib 387447 NSC681239 approved sensitive Low Multiple Myeloma cell line (U-266)
hsa-miR-202-3p Bortezomib 387447 NSC681239 approved sensitive Low Multiple Myeloma cell line
hsa-miR-202-3p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia cell line (K562, KU812)
hsa-miR-202-3p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (M14) (50nM)
hsa-miR-202-3p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (WM266) (200nM)
hsa-miR-202-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (M14) (50nM)
hsa-miR-202-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (WM266) (200nM)
hsa-miR-202-3p Cisplatin 5460033 NSC119875 approved sensitive Low Non-Small Cell Lung Cancer cell line (NCI-H441, A549)
hsa-miR-202-3p Fluorouracil 3385 NSC19893 approved resistant High Gastric Cancer cell line (MGC-803)
hsa-miR-202-3p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-202-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-202-3p Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-202-3p Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-202-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-202-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-202-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-202-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-202-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-202-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-miR-202-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission