pre-miRNA Information
pre-miRNA hsa-mir-190b   
Genomic Coordinates chr1: 154193665 - 154193743
Description Homo sapiens miR-190b stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-190b
Sequence 11| UGAUAUGUUUGAUAUUGGGUU |31
Evidence Not_experimental
Experiments
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Gene Information
Gene Symbol MTMR6
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions CD4+ T cell
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... Luciferase reporter assays confirmed MTMR6 as a direct miR-190b target. ...

- Mohan M; Chandra LC; Torben W; Aye PP; et al., 2014, Journal of immunology (Baltimore, Md. : 1950).

Article - Mohan M; Chandra LC; Torben W; Aye PP; et al.
- Journal of immunology (Baltimore, Md. : 1950), 2014
HIV replication and the cellular micro-RNA (miRNA) machinery interconnect at several posttranscriptional levels. To understand their regulatory role in the intestine, a major site of HIV/SIV replication, dissemination, and CD4(+) T cell depletion, we profiled miRNA expression in colon following SIV infection (10 acute SIV, 5 uninfected). Nine (four up and five down) miRNAs showed statistically significant differential expression. Most notably, miR-190b expression showed high statistical significance (adjusted p = 0.0032), the greatest fold change, and was markedly elevated in colon and jejunum throughout SIV infection. In addition, miR-190b upregulation was detected before peak viral replication and the nadir of CD4(+) T cell depletion predominantly in lamina propria leukocytes. Interestingly non-SIV-infected macaques with diarrhea and colitis failed to upregulate miR-190b, suggesting that its upregulation was neither inflammation nor immune-activation driven. SIV infection of in vitro-cultured CD4(+) T cells and primary intestinal macrophages conclusively identified miR-190b upregulation to be driven in response to viral replication. Further miR-190b expression levels in colon and jejunum positively correlated with tissue viral loads. In contrast, mRNA expression of myotubularin-related protein 6 (MTMR6), a negative regulator of CD4(+) T cell activation/proliferation, significantly decreased in SIV-infected macrophages. Luciferase reporter assays confirmed MTMR6 as a direct miR-190b target. To our knowledge, this is the first report, which describes dysregulated miRNA expression in the intestine, that identifies a potentially significant role for miR-190b in HIV/SIV pathogenesis. More importantly, miR-190b-mediated MTMR6 downregulation suggests an important mechanism that could keep infected cells in an activated state, thereby promoting viral replication. In the future, the mechanisms driving miR-190b upregulation including other cellular processes it regulates in SIV-infected cells need determination.
LinkOut: [PMID: 24981450]
60 hsa-miR-190b Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT054581 IGF1 insulin like growth factor 1 4 1
MIRT066966 ATXN7L3B ataxin 7 like 3B 2 2
MIRT192449 SPRED1 sprouty related EVH1 domain containing 1 2 2
MIRT250414 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT306294 KLHL24 kelch like family member 24 2 2
MIRT355845 SGMS2 sphingomyelin synthase 2 2 4
MIRT437770 MTMR6 myotubularin related protein 6 1 1
MIRT437771 MTMR6 myotubularin related protein 6 1 1
MIRT437772 Mtmr6 myotubularin related protein 6 1 1
MIRT444672 CDKL2 cyclin dependent kinase like 2 2 2
MIRT446389 PCDHB11 protocadherin beta 11 2 2
MIRT446634 SDC3 syndecan 3 2 2
MIRT449410 TRIM5 tripartite motif containing 5 2 2
MIRT449560 GPC5 glypican 5 2 2
MIRT469928 PTPRJ protein tyrosine phosphatase, receptor type J 2 6
MIRT473736 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT474210 LDHA lactate dehydrogenase A 2 2
MIRT474583 KLF6 Kruppel like factor 6 2 2
MIRT476732 FOXN2 forkhead box N2 2 2
MIRT478455 DAB2 DAB2, clathrin adaptor protein 2 2
MIRT495327 ADAMTS8 ADAM metallopeptidase with thrombospondin type 1 motif 8 2 4
MIRT498615 MTRNR2L10 MT-RNR2-like 10 2 12
MIRT501734 OVOL1 ovo like transcriptional repressor 1 2 2
MIRT501849 MTRNR2L8 MT-RNR2-like 8 2 14
MIRT504678 CYGB cytoglobin 2 4
MIRT506517 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 6
MIRT507984 BCL2L13 BCL2 like 13 2 4
MIRT508444 ZNF608 zinc finger protein 608 2 4
MIRT511366 IL6ST interleukin 6 signal transducer 2 4
MIRT520515 TRA2B transformer 2 beta homolog 2 2
MIRT524571 CALML4 calmodulin like 4 2 4
MIRT531896 INVS inversin 2 4
MIRT533916 TATDN2 TatD DNase domain containing 2 2 2
MIRT537503 FAM13B family with sequence similarity 13 member B 2 2
MIRT541689 CCDC160 coiled-coil domain containing 160 2 8
MIRT544419 ZNF460 zinc finger protein 460 2 4
MIRT544615 CSDE1 cold shock domain containing E1 2 2
MIRT545076 IL7R interleukin 7 receptor 2 2
MIRT545849 ZNF264 zinc finger protein 264 2 4
MIRT547436 MED4 mediator complex subunit 4 2 2
MIRT550157 ZNF223 zinc finger protein 223 2 4
MIRT553948 STAMBP STAM binding protein 2 2
MIRT554395 SERP1 stress associated endoplasmic reticulum protein 1 2 2
MIRT555667 PGAM4 phosphoglycerate mutase family member 4 2 4
MIRT564193 PM20D2 peptidase M20 domain containing 2 2 2
MIRT566792 MKL2 MKL1/myocardin like 2 2 2
MIRT566843 LRRC58 leucine rich repeat containing 58 2 2
MIRT572516 KIAA0232 KIAA0232 2 2
MIRT607428 NOTCH2NL notch 2 N-terminal like 2 10
MIRT627779 RAB30 RAB30, member RAS oncogene family 2 2
MIRT635159 ENO4 enolase family member 4 2 2
MIRT642159 ADCYAP1R1 ADCYAP receptor type I 3 2
MIRT646205 DUSP10 dual specificity phosphatase 10 2 2
MIRT657007 KCNMB4 potassium calcium-activated channel subfamily M regulatory beta subunit 4 2 2
MIRT665817 TMEM161B transmembrane protein 161B 2 2
MIRT667488 MAP3K2 mitogen-activated protein kinase kinase kinase 2 2 2
MIRT707098 ZNF850 zinc finger protein 850 2 2
MIRT708719 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT735521 HUS1 HUS1 checkpoint clamp component 3 0
MIRT736644 AGPAT3 1-acylglycerol-3-phosphate O-acyltransferase 3 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1 Anthocyanin NULL 145858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Caffeic acid NULL 689043 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Ferulic acid NULL 445858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-1 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR myocardial differentiation of mouse ES cells 19521018 2009 down-regulated
miR-1 Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-1 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-1 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-1 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-1 Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 Palmitic acid approved 985 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-1 Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-1 Hydrogen peroxide (H2O2) NULL 784 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-1 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR cardia 22889704 2012 up-regulated
miR-1 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-1 Quinidine approved 441074 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 up-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 down-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR post-infarction rat cardiomyocytes 21220930 2011 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-1 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miR-190b Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-190b Atorvastatin approved 60823 Microarray PC3 prostate cancer cells 23936432 2013 up-regualted
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-190b Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)

Error report submission